Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to

Size: px
Start display at page:

Download "Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to"

Transcription

1 THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum

2 Programs The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to be held on 1 October in conjoined with CBD COP 12 at Pyeongchang, Republic of Korea. The activities are sponsored by the projet Construction of the Biodiversity Conservation Network in East Asia which is supported by Korea Forest Service. Time 9 Oct (Thu) 10 Oct (Fri) 11 Oct (Sat) 12 Oct (Sun) 13 Oct (Mon) Time 1 Oct (Tue) 1 Oct (Wed) 08:00 10:00 10:00 11:00 11:00 12:00 12:00 13:00 13:00 1:00 1:00 1:00 A Field Trip Field Trip Field Trip The 201 EABCN Symposium 13:1 1:2 EABCN Side event CBD COP 12 D 1:00 18:00 1:2 1:0 MoU Signing Ceremony 18:00 20:00 * A: Arrival, D: Departure Dinner 18:00 20:00 Dinner presided over by KNA General Information Room and Meals Field trip participants are housed at the Hoam Faculty House (9 th Oct, Seoul), Walkerhill motel (10 th -11 th Oct, Yangyang), Yongpyeong resort (12-1 th Oct, Pyeongchang). Meals are typically served in restaurant. In second-day field trip, you will receive lunch box (w/ Sandwich). Individuals with serious food allergies (ex. Shushi) or special dietary restrictions let us know at any time. Transportation A vehicle will be arranged between accommodation and visiting places during the field trips. To ensure this transportation, it is important that participants arrive on time. From 13 th -1 th of October, you may use shuttle service provided by CBD or move by walk within Yongpyeong resort.

3 The shuttle service is provided (Hotels Alpensia Convention Center Incheon International Airport). This route will operate from Thursday, 2 October to Sunday, 19 October 201. All airport departures will take place from the Alpensia Convention Center. Shuttle bus schedules between the venue and designated hotels can be found at: Weather In October, temperatures in Pyeongchang range between a maximum of 18.6 C in the daytime and a minimum of 10 C at night. Please bring appropriate outer garments for outside. The time zone is GMT/UTC + 9 hours. Contact Us *Please contact us if you have any questions. You may find more information on our website: Temporary EABCN Secretariat Ms. Kae Sun Chang natu17@korea.kr, prunus17@gmail.com Tel: Fax: Address: Korea National Arboretum, 1 Gwangneungsumokwon-ro, Soheul-eup, Pocheon-si, Gyeonggi-do, , Korea Points of Contact Korea National Arboretum Dr. Seung Hwan Oh oshwan@korea.kr Tel: Dr. Hye Jin Kwon hjkwon@forest.go.kr Tel: Mr. Jong Bin Jung Jongbin.jung@gmail.com Tel: ASEAN-ROK Forest Cooperation Dr. Ho Sang Kang silvi@chol.com Tel: Ms. Sun Yeong Jeon jsyp9@gmail.com Tel: Ms. Hye Jeong Lee dkdlslem@gmail.com Tel:

4 FIELD TRIPS

5 FIELD TRIPS & WORKSHOP During the field trips, we will visit several locations including temperate deciduous forests in Mt. Jumbongsan and DMZ Botanical Garden in Gangwon-do province. At the Mt. Jumbongsan, a workshop on the vegetation monitoring for climate change will be provided by Forestry and Forest Products Research Institute and Korea National Arboretum, also we may enjoy the beauty of the fall colors in Korea. The cost of travels and accommodations will be covered by Korea National Arboretum. Notification: Workshop on the Vegetation Monitoring for Climate Change (Appendix 2) Date and Time: 11 Oct 201 (12:00~13:00) Venue: Mt. Jumbongsan Background: Changes in biodiversity, physiology, ecology, species composition, and distribution according to climate change are expected, but research is being conducted that is limited only to the nationlevel. Thus, it is necessary to conduct international monitoring and collaborative research by selecting species that are widely distributed in East Asia and that have habitat limits of northern limits or southern limits as the species susceptible to climate change. Purpose and Contents: This workshop aims to share the methodological knowledge among members and to discuss proper methods and species for the joint monitoring. For the efficient discussion, KNA will introduce its monitoring site in Mt. Jumbongsan and FFPRI will demonstrate their techniques for detecting the expansion and restriction of species distribution. 10 October (Friday) Venue: DMZ Botanic Garden, Yanggu Time ~08:00 Breakfast 08:00~09:30 Depart from Hoam Faculty House Contents 09:30~10:00 Arrive at Gapyeong rest area (Coffee Break) 10:00~11:30 Depart from Gapyeong rest area 11:30~12:00 DMZ Botanical Garden 12:10~13:10 Lunch 13:20~1:00 The th underground tunnel 1:10~1:0 Eulji Observary 1:0~1:0 Depart to Dutayeon Valley 1:0~16:20 Dutayeon Valley 16:20~18:20 Depart to Walkerhill Motel 18:20~20:20 Dinner 20:20~ Arrive at Walkerhill Motel Room assignments

6 11 October (Saturday) Venue: Mt. Jumbongsan experimental forest, Inje Time 08:00~09:00 Breakfast 09:00~09:0 Depart to Mt. Jumbongsan 09:0~10:00 10:00~12:00 Hiking Arrive at Mt. Jumbongsan Lunch Box provided 12:00~13:00 EABCN Workshop* 13:00~13:30 Hiking 13:30~1:00 1:00~16:00 Hiking Contents Arrive at Gombaeryeong Hill (1,16 m) Lunch 16:00~16:0 Move to Walkerhill Motel 16:0~18:00 Personal Hygiene 18:00~20:00 Dinner 12 October (Sunday) Venue: Yongpyong resort, Pyeongchang Time Contents 09:00~10:00 Breakfast 10:00~11:00 Coffee Break 11:00~12:10 Move to Dodukjae 12:10~13:00 Arrive at Dodukjae (Pinus densiflora Forest) 13:10~1:00 Lunch 1:00~1:30 Depart to Yongpyeong resort* 1:30~19:00 Check-in 19:00~21:00 Dinner *Yongpyeong resort is the place the symposium will be held

7 Tour course DMZ Botanical Garden Korean Demilitarized zone is a strip of land running across the Korean Peninsula that serves as a buffer zone between North and South Korea. During the past half century, since human access and habitation has been prohibited, DMZ formed a unique ecosystem that cannot be found in any other region. Several endangered animal and plant species now exist among the heavily fortified fences, landmines and listening posts. The DMZ and its surrounding areas owes varied biodiversity including 2,237 plants, 106 fishes, 29 amphibians and reptiles, 201 birds and 2 mammals. DMZ Botanical Garden s mission is to collect northern plants resources and to conserve the rare and endangered species in DMZ. The th underground tunnel The th underground tunnel was discovered in March North Korea has dug a series of secret underground tunnels reaching behind the South s defensive lines. At the entrance, the commemorating monument is established for the faithful military dog named Hunt that protected the soldiers from being killed by the land mines while searching the tunnel. Inside the tunnel, a glass-covered electric vehicle with 20 seats is available and visitors can take a look at the tunnel.

8 Eulji Observary Eulji Observatory is located 27km northeast from Yanggu and on the ridges of Gachilbong Peak which is 1km south from the Military Demarcation Line. If weather permits, visitors can see Birobong Peak and four other peaks (Chailbong, Wolchulbong, Mireukbong, Ilchulbong Peaks) of Geumgangsan Mountain in North Korea. Dutayeon Valley Dutayeon ecological tour course as an alley to Geumgangsan Mountain had been the off-limits militarized zone for 0 years until it was open to the public in 200. Through a demilitarized zone surrounded by intact primitive nature, visitors can experience superb and mysterious beauty of nature Pine Forest in Daegwallyeong hill Pine trees which have morphological characteristic of erecting stem is called Geumgang pine in Korea. Geumgang pines is founded in around Gangwan-do and Gyeongsang-do provinces. This pine forest in Daegwallyeong hill had been established by direct seeding in Currently, total 00 hectares has remained and its average volume stock reached 171m 3 per hectare. Korea Forest Service had selected this forest as Beautiful forest for the 21st Century in 2000 and has managed this forest by thinning and seeding for the next generation.

9 Mt. Jumbongsan Mt. Jumbongsan (1,2 m) is located at Inje-gun in Gangwon-do province and had been protected from human disturbances due to the difficulty in access. The number of plant species founded in this mountain is ca. 600 species. Among trees species, Quercus mongolica is the most pre-dominant species in this temperate deciduous forest. Along the hiking trails, Abies holophylla naturally grows in form of patches. The habitats of rare and endangered plants including Lysimachia coreana Nakai have been protected by laws on national park and numerous ecological studies has been conducted in Mt. Jumbongsan as a LTER site. Mt. Jumbongsan Gombaeryeong Hill

10 SYMPOSIUM

11 The 201 EABCN SYMPOSIUM Conservation and Sustainable Development of Biodiversity in East Asia Date 13 October 201 (09:30-20:30) Venue Rainbow Hall, Greenpia Condominium, Yongpyong Resort Theme This year s symposium is titled Conservation and Sustainable Development of Biodiversity in East Asia and provides opportunities to share our past experiences on biodiversity conservation efforts and to discuss on future efforts among international colleagues. The symposium will be held on 13 October. Session (Topics) The symposium is organized into plenary lectures and sessions with a wide range of topics on biodiversity conservation efforts in various research fields. Topics of this session based on following main themes. - Introduction of endangered species and biodiversity - Conservation project for the threatened species - Current and Future biodiversity conservation efforts - Introduction of plants and vegetation monitoring - Climate change and biodiversity researches - Roles of EABCN for conserving biodiversity

12 13 October (Monday) Venue: Rainbow Hall, Greenpia Condo., Yongpyong resort, Pyeongchang The 201 EABCN symposium 09:30~10:30 Registration 10:30~10:0 10:0~11:00 Group photo MC: Dr. Il-Kwon Kim(Korea National Arboretum) Opening address Dr. You Mi Lee (Dongyang University, former Director General of Korea National Arboretum) Congratulatory remarks Prof. Woo Shin Lee (Project Leader of AKECOP, Korean Society of Restoration Ecology) 11:00-13:00 Plenary lectures 11:00~11:30 11:30~12:00 12:00~13:00 Lunch Plenary lectures 1 Dr. Hadisusanto Pasaribu (Executive Director of Asian Forest Cooperation Organization) Plenary lectures 2 Dr. Roberto V. Oliva (Executive Director of ASEAN Centre for Biodiversity) 13:00~1:00 Session 1 Moderator: Prof. Chang Gee Jang (Kongju National University) 13:00~13:30 13:30~1:00 1:00~1:30 1:30~1:00 1:00~1:30 Coffee break Northeast Asian plant refugia under the climate change Dr. Pavel V. Krestov (Botanical Garden-Institute, Far East Branch, Russia Academy of Sciences) Climate Change Impact Assessments by EABCN Dr. Nobuyuki Tanaka (Forestry and Forest Product, Research Institute) Chinese Forest Biodiversity Monitoring Network (CForBio): Changbaishan Temperate Forest Plots Dr. Zhanqing Hao (Institute of Applied Ecology, Chinese Academy of Sciences) Current and Future Contribution for Conserving Biodiversity at the Regional level by Korea National Arboretum Dr. You Mi Lee (Korea National Arboretum) 1:30~17:00 Session 2 Moderator: Prof. Woo Seok Kong (Kyunghee University) 1:30~16:00 16:00~16:30 16:30~17:00 Conservation issues of Rare and Endangered species in Mongolia Prof. Badamdorj Bayartogtokh (National University of Mongolia) Basic results of current floristic researches in Uzbekistan (Central Asia) Dr. Tojibaev Komiljon Sh. (Institute of Gene Pool of Plants and Animals of the Academy Sciences of Uzbekistan) Plant Ecosystems Structure of the Tajikistan National Forest Landscapes Prof. Hikmat Hisoriev (Institute of Botany, Physiology and Genetics, Tajik Acaedmy of Sciences) 17:00~17:0 Session discussion Moderator: Prof. Woo Seok Kong(Kyunghee University) 19:00~20:30 Reception

13 SIDE EVENT IN CBD COP 12

14 EABCN SIDE EVENT Strengthening the Regional Biodiversity Conservation Activities in East Asia for the GSPC 2020 implementation F Hall, Alpensia resort, Pyeongchang, Republic of Korea, 13:1 to 1:, 1 October 201 Background It is essential to cooperate through international network to perform following the selection of the agenda (September 2012, Jeju) proposed by the th IUCN WCC which the Korea Forest Service and Korea National Arboretum has selected to achieve goal GSPC2020. The Vladivostok Botanical Gardens-institute of Russian Academy hosted the International Symposium (September 2002). Six countries of East Asia have participated and agreed to set up the working group and contact point and also agreed to carry out joint research and business in openrounded meeting, Research cooperation meeting for Asia plant diversity conservation. Even if the National level business is promoting according to the characteristics of each country to achieve GSPC 2020 through BGCI, to achieve the Regional level goal, substantial research and business, construction of network and cooperation of the organizations are required. The EABCN is a regional level network for responding issues related to the biodiversity in East Asia. Recently, the necessity of regional cooperation has been more emphasized to deal with decreasing biodiversity caused by various reasons such as climate change, anthropogenic or natural disturbances. Main Content Overview - About the existing Regional level collaboration (Southeast Asia, Vietnam and Indonesia) and the pursuing goals of East Asia Biodiversity Conservation Network (EABCN) etc. - Proposed joint cooperation center for Northeast Asian Biodiversity Conservation - Introduction and first cooperation projects presented Organized by: East Asia Biodiversity Conservation Network (EABCN), Botanic Gardens Conservation International (BGCI) * The participating members of EABCN: - The Botanical Garden-Institute Far East Branch of the Russian Academy of Sciences - Forestry and Forest product Research Institute, Japan - Institute of Applied Ecology, Chines Academy of Sciences - Korea National Arboretum, Korea Forest Service - National University of Mongolia - South China Botanical Garden, Chinese Academy of Sciences Sponsored by: Korea National Arboretum & Korea Forest Service

15 1 October (Tuesday) Venue: Room 1, Hall F, The Alpensia Resort, Pyeongchang Time 13:1~13:20 13:20~13:2 13:2~13: Opening address Dr. Kang Ho Sang (AKECOP) Contents Congratulatory remarks Dr. You Mi Lee (Director General of Korea National Arboretum) Keynote address 13:2-13:3 Dr. Joon Hwan Shin (Dongyang Uvinersity, former DG of KNA) 13:3-13: Dr. Vo Dai Hai (Vietnamese Academy of Forest Sciences) 13:-13: Indonesian Institute of Sciences-LIPI 13:~1:20 Discussion 1:2~1:0 EABCN Memorandum of Understanding signing ceremony 18:00~20:00 Dinner (presided over by Director General of Korea National Arboretum)

16 Information 1 October (Friday) Venue: Yongpyong resort / Hoam Faculty House Time Contents Depart to Incheon Airport Shuttle Bus Schedule Ticket Booth in Alpensia Resort Ticket booth is at the Main Transportation Center. There, you can buy tickets to get to the airport. Ticket Prices (One Way) Incheon International Airport The Alpensia Resort: KRW 29,000 (USD 29) Gimpo International Airtport The Alpensia Resort: KRW 23,000 (USD 23) Route 3-1 Schedule (The Alpensia Convention Center Airport) The shuttle service will operate from 07:30 a.m. to 16:30 and the detailed schedule is shown below. Days of Operation : 2 and 3 October / 11 to 16 October 201 NO The Alpensia Convention Center (Departure) DeokPyeong Rest Area (Arrival) Gimpo International Airport (Arrival) Incheon Airport (Arrival) 1 7:30 9:20 10:30 11: :30 12:20 13:30 1: :30 1:20 16:30 17:00 16:30 18:20 19:30 20:00 Route 3-2 Schedule (Alpensia Convention Center Airport) The shuttle service will operate from :00 to 17:30 and the detailed schedule is shown below. Days of Operation : and October / 17 to 19 October 201 NO The Alpensia Convention Center (Departure) DeokPyeong Rest Area (Arrival) Gimpo International Airport (Arrival) Incheon Airport (Arrival) 1 :00 6:0-8:20 2 7:00 8:0-10:20 3 7:30 9:20 10:30 11:00 10:30 12:20-13:0 12:30 1:20 1:30 16: :30 1:20-16:0 7 *16:30 18:20-19:0 8 *17:30 19:20-20:0 * The shuttles at this time will NOT operate on Sunday, 19 October 201

17 Mt. Jumbongsan Experimental Forest v Information F Location The Mt. Jumbongsan Experimental Forest is located in east south Korea situated between longitude E and and between latitude N and It has an area of 2,02 ha. Figure 1. Mt. Jumbongsan experimental Forest location shown as a red spot. F Climate Mt. Jumbongsan experimental forest which ecological characteristics at central temperate province in south korea is very importance place in academic value. Figure 2. Mt. Jumbong experimental forest average annual temperature, average annual precipitation, average annual min temperature and average annual max temperature from 1973 to 2012(left) and Climate diagram from 1992 to 2011(right). Sourec: Korea Meteorological Administration. Mt. Jumbong experimental forest Quercus mongolica forest

18 v Flora F Floristic study on vascular plants of Mt. Jumbong experimental forest Family Genus Species Subsp. Var. For. No. of Taxa Pterodophyte Gymnospermae Angiospermae Dicotyledoneae Monocotyledoneae Total F List of the Endemic, Rare plant and Naturalized plant in Mt. Jumbong experimental forest Family Genus Species Subsp. Var. No. of Taxa CR EN (Endangered) VU LC Endemic plant Rare plantb a (Critically Endangered) (Vulnerable) (Least Concern) DD (Date Deficient) Naturalized plantc a b c : Endemic plant of Korea Peninsula(200; Korea National Arboretum) : Rare data book in Korea(2008; Korea National Arboretum) : Field Guide Naturalized Plants of Korea(2012; Korea National Arboretum) Lysimachia coreana Nakai Cimicifuga heracleifolia var. bifida Leontice microrhyncha S.Moore (LC; Endemic) Nakai (VU) (VU) Anemone Koraiensis Nakai Clematis fusca var. coreana Patrinia (Endemic) (H.Lev.&Vaniot) Nakai (Endemic) (LC: Endemic) saniculaefolia Hemsl.

19 v Our Research F LTER ( Long-term Ecological Research) Mt. Jumbong LTER was designated from Ministry of Environment, since 200 ü Objective of research 1. Understanding of global environmental change dimension 2. Systematization of information into LTER is the production base 3. Predict ecosystem changes due to climate change using the basic data ü Material and methods 1. vegetation Dynamic - species composition - spatial distribution - diameter and height classes distribution - species diversity - mortality 2. Carbon cycle - litterfall reproduction - Nutrients and Decomposition Rate Accumulated on Soil Layers 3. Phenology - leaf unfolding monitoring - Flowering monitoring. Coarse woody debris Dynamics ü Result Ÿ Stands destiny : Quercus mongolica forest 1,16 stems/ha, Pinus densiflora forest 1,93 stems/ha, Q. mongolica-abies holophylla forest 1,623 stems/ha. Ÿ Ÿ Organic carbon of total soil 7~ 63% mort than that of plants. Leaf unfolding time late in 2010~2012 year low Tn(Nuttonson s Index) and relatively high Tn(Nuttonson s Index) 2008 ~ 2009 year was comparatively faster. Ÿ In contrast, some species with high Tn Dunn slowed further, showing an opposite tendency to leaf unfolding. Ÿ In the case of Quercus mongolica, dead wood biomass from jeombongsan area (Mg / ha) decreased by 2. to 17.7 for years and 6 months, and Pinus densiflora decreased for two years from 7.1 to 6..

20 F Health monitoring for conservation of ecological integrity in Mt. Jumbong experimental Mt. Jumbong experimental forest was designated from Korea National Arboretum of Feb. 16, 2010 ü Objective of research 1. Study for Biodiversity 2. Sustainable conservation 3. Management on the forest plant resource. Accumulate Biodiversity and Ecosystem function baseline data ü Material and methods 1. Stand structure - diameter classes distribution - species composition - Vitality of tree species - Density, importance value and species richness 2. Stand function - diameter growth - mortality rate and recruitment rate 3. Actual vegetation map. Physiognomical vegetation map ü Result Ÿ Stand structure - Stem destiny in year 2012 was 0.3±1.7m 2, and increased to 0.6±1.8m 2 in year Q. mongolica stem density was highest. - Importance value : Q. mongolica 3.7%, Tilia amurensis 1%, Acer pseudosieboldianum 1.6% Fraxinus rhynchophyllus 10.%. Ÿ Stand function - 2 species of DBH was increased, and 2 species of DBH (Carpinus laxiflora, Cornus controversa) was decreased. - Mortality rate 1.1 %, recruitment rate 0.1%. - Relatively high altitude ridge displayed low mortality rates.

21 Ÿ Actual vegetation map Ÿ Physiognomical vegetation map

22 F Evolutionary Ecology(Insect Herbivory) ü Objective of research Biodiversity research through the evolution ecology study of forest ecosystems approach ü Material and methods 1. Feeding pattern 2. Leaves with herbivory (%) 3. Leaf damage tissue (%). Mortality rate and Recruitment rate ü Result Ÿ Herbivory increased by 1.% ( 13;n=363, '1;n=28) to a total of 86.6% Ÿ Herbivory ratio was.8%, showing an increase of 9% over year Ÿ Leaf damage tissue was 1.2%, showing an increase of 8.3% over year Ÿ Seedling and sampling had 1% mortality rate, with 32% recruitment rate. Ÿ Relation with the feeding of the insects is significant (p = < 0.0), with a feeding mortality rate of 2.9% and survival rate of 7.1%.

23 점봉산시험림의관속식물및야생동물조사보고서 부 록 점봉산시험림의관속식물목록 과명 국명 학 명 표본번호 표본수 석송과 만년석송 Lycopodium obscurum L. JMC 뱀톱 Lycopodium serratum Thunb. JMC12216, JMC 고사리삼과 고사리삼 Sceptridium ternatum (Thunb.) Lyon JMC11883, JMC12996, MC131 3 속새과 속새 Equisetum hyemale L. JMC112 1 쇠뜨기 Equisetum arvense L. JMC 고비과 꿩고비 Osmunda cinnamomea var. forkiensis Copel. JMC 고비 Osmunda japonica Thunb. JMC 공작고사리과고비고사리 Coniogramme intermedia Hieron. JMC11717, JMC 잔고사리과 산일엽초 Lepisorus ussuriensis (Regel & Maack) Ching JMC1217, JMC1237, MC13281, JMC1332 왕고사리 Deparia pterorachis (H.Christ) M.Kato JMC1308, JMC 좀진고사리 Deparia conilii (Franch. & Sav.) M.Kato JMC12163, JMC12182, MC 진고사리 Deparia japonica (Thunb.) M.Kato JMC 털고사리 Deparia pycnosora (H.Christ) M.Kato JMC11887, JMC1218, JMC1220, JMC13080, JMC13096 황고사리 Dennstaedtia wilfordii (T.Moore) H.Christ JMC11896, JMC 꼬리고사리과참새발고사리 Athyrium brevifrons Kodama ex Nakai JMC12328, JMC13003, JMC1332, JMC131, JMC137 개고사리 Athyrium niponicum (Mett.) Hance JMC1219, JMC1313, JMC 뱀고사리 Athyrium yokoscense (Franch. & Sav.) H.Christ JMC1216, JMC12222, JMC12300, JMC12313 고사리 Pteridium aquilinum var. latiusculum (Desv.) Underw. ex Hell. JMC11990, JMC 면마과 왁살고사리 Arachniodes borealis Seriz. JMC11989, JMC12191, JMC122, JMC12339, JMC1310 가는잎족제비고사리 Dryopteris chinensis (Baker) Koidz. JMC 관중 Dryopteris crassirhizoma Nakai JMC1173, JMC1186, JMC11999, JMC1218 퍼진고사리 Dryopteris expansa (C.Presl) Fraser-Jenk. & Jermy JMC1299, JMC 바위틈고사리 Dryopteris laeta (Kom.) C.Chr. JMC132 1 왕지네고사리 Dryopteris monticola (Makino) C.Chr. JMC12218, JMC1306, MC13099, JMC1310, JMC12668 곰비늘고사리 Dryopteris uniformis (Makino) Makino JMC 청나래고사리 Matteuccia struthiopteris (L.) Tod. JMC 개면마 Onoclea orientalis (Hook.) Hook. JMC 야산고비 Onoclea sensibilis var. interrupta Maxim. JMC 넉줄고사리과처녀고사리 Thelypteris palustris (Salisb.) Schott JMC 가래고사리 Thelypteris phegopteris (L.) Sloss. JMC1307, JMC 만주우드풀 Woodsia manchuriensis Hook. JMC 우드풀 Woodsia polystichoides D.C.Eaton JMC _ 국립수목원

24 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 고란초과 응달고사리 Cornopteris crenulatoserrulata (Makino) Nakai JMC1191, JMC11966, JMC 좀나도히초미 Polystichum braunii (Spenn.) Fee JMC Polystichum ovatopaleaceum var. coraiense (H.Christ) 참나도히초미 Sa.Kurata JMC130 1 나도히초미 Polystichumpolyblepharum(Roem.exKunze)C.Presl JMC1207, JMC 비늘개관중 Polystichum retrosopaleaceum (Kodama) Tagawa JMC11866, JMC120 2 십자고사리 Polystichumtripteron(Kunze) C.Presl JMC12193, JMC 소나무과 전나무 Abies holophylla Maxim. JMC 분비나무 Abies nephrolepis (Trautv.) Maxim. JMC126, JMC 소나무 Pinus densiflora Siebold & Zucc. JMC 잣나무 Pinus koraiensis Siebold & Zucc. JMC 측백나무과 눈측백 Thuja koraiensis Nakai JMC 주목과 주목 Taxus cuspidata Siebold & Zucc. JMC11728, JMC1221, JMC 목련과 함박꽃나무 Magnolia sieboldii K.Koch JMC11907, JMC13082, JMC1332, JMC13331 녹나무과 생강나무 Lindera obtusiloba Blume JMC 홀아비꽃대과홀아비꽃대 Chloranthus japonicus Siebold JMC 쥐방울덩굴과등칡 Aristolochia manshuriensis Kom. JMC 족도리풀 Asarum sieboldii Miq. JMC1160, JMC11623, JMC 오미자과 오미자 Schisandra chinensis (Turcz.) Baill. JMC 천남성과 천남성 Arisaema amurense for. serratum (Nakai) Kitag. JMC113 1 반하 Pinellia ternata (Thunb.) Breitenb. JMC 애기앉은부채 Symplocarpus nipponicus Makino JMC1127, JMC 부추과 산달래 Allium macrostemon Bunge JMC 달래 Allium monanthum Maxim. JMC 참산부추 Allium sacculiferum Maxim. JMC 산부추 Allium thunbergii G.Don JMC 붓꽃과 붓꽃 Iris sanguinea Donn ex Horn JMC 난초과 복주머니란 Cypripedium macranthos Sw. Photo 은대난초 Cephalanthera longibracteata Blume JMC1172, JMC1197, JMC 옥잠난초 Liparis kumokiri F.Maek. JMC 나리난초 Liparis makinoana Schlech. JMC1189, JMC 감자난초 Oreorchis patens (Lindl.) Lindl. JMC11716, JMC 둥굴레과 은방울꽃 Convallaria keiskei Miq. JMC1161, JMC 두루미꽃 Maianthemum bifolium (L.) F.W.Schmidt JMC11627, JMC 목포용둥굴레 Polygonatum cryptanthum H.Lev. & Vaniot JMC113 1 퉁둥굴레 Polygonatum inflatum Kom. JMC1136, JMC1187, JMC 용둥굴레 Polygonatum involucratum (Franch. & Sav.) Maxim. JMC11973, JMC 죽대 Polygonatum lasianthum Maxim. JMC 둥굴레 Polygonatum odoratum var. pluriflorum (Miq.) Ohwi JMC11608, JMC 자주솜대 Smilacina bicolor Nakai JMC 풀솜대 Smilacina japonica A.Gray JMC1167, JMC 금강애기나리 Streptopus ovalis (Ohwi) F.T.Wang & Y.C.Tang JMC 마과 부채마 Dioscorea nipponica Makino JMC11816, JMC 부록 _ 37

25 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 애기나리과 애기나리 Disporum smilacinum A.Gray JMC11609, JMC11986, JMC 백합과 나도옥잠화 Clintonia udensis Trautv. & C.A.Mey. JMC 얼레지 Erythronium japonicum (Balrer) Decne. JMC119, JMC13230, JMC 말나리 Lilium distichum Nakai ex Kamib. JMC1176, JMC 하늘말나리 Lilium tsingtauense Gilg JMC 나도개감채 Lloydia triflora (Ledeb.) Baker JMC110 1 여로과 처녀치마 Heloniopsis koreana Fuse & al. JMC 삿갓나물 Paris verticillata M.Bieb. JMC1176, JMC118, JMC 연영초 Trillium kamtschaticum Pall. ex Pursh JMC1183, JMC1188, JMC 여로 Veratrum maackii var. japonicum (Baker) T.Schmizu JMC11836, JMC13296, JMC133 3 파란여로 Veratrum maackii var. parviflorum (Maxim.) Hara JMC 참여로 Veratrum nigrum var. ussuriense Lose.f. JMC123 1 박새 Veratrum oxysepalum Turcz. JMC 청미래덩굴과선밀나물 Smilax nipponica Miq. JMC 밀나물 Smilax riparia var. ussuriensis (Regel) Hara & T.Koyama JMC 닭의장풀과 닭의장풀 Commelina communis L. JMC11738, JMC 사초과 골사초 Carex aphanolepis Franch. & Sav. JMC11617, JMC1162, JMC 길뚝사초 Carex bostrychostigma Maxim. JMC117, JMC 산사초 Carex curta Gooden. JMC 이삭사초 Carex dimorpholepis Steud. JMC 삿갓사초 Carex dispalata Boott JMC1128, JMC1180, JMC1199, JMC13260 한라사초 Carex erythrobasis H.Lev. & Vaniot JMC 낚시사초 Carex filipes Franch. & Sav. JMC 산뚝사초 Carex forficula Franch.&Sav. JMC1266, JMC1267, JMC13219, JMC1333 곱슬사초 Carex glabrescens Ohwi JMC11863, JMC11881, JMC 산비늘사초 Carex heterolepis Bunge JMC 가는잎그늘사초 Carex humilis var. nana (H.Lev. & Vaniot) Ohwi JMC13220, JMC 개찌버리사초 Carex japonica Thunb. JMC 그늘사초 Carex lanceolata Boott JMC112, JMC 난사초 Carex lasiolepis Franch. JMC1323, JMC 산괭이사초 Carex leiorhyncha C.A.Mey. JMC1181, JMC11810, JMC12279, JMC12671, JMC13308, JMC 산이삭사초 Carex lyngbyei Hornem. JMC12660, JMC 타래사초 Carex maackii Maxim. JMC12676, JMC1338, JMC 지리대사초 Carex okamotoi Ohwi JMC1162, JMC 바늘사초 Carex onoei Franch. & Sav. JMC 넓은잎그늘사초 Carex pediformis C.A.Mey. JMC 비늘사초 Carex phacota Spreng. JMC1171, JMC 그늘흰사초 Carex planiculmis Kom. JMC 햇사초 Carex pseudochinensis H.Lev. & Vaniot JMC 가는청사초 Carex puberula Boott JMC 실청사초 Carex sabynensis Less. ex Kunth JMC12661, JMC13221, JMC _ 국립수목원

26 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 대사초 Carex siderosticta Hance JMC11, JMC13202, JMC 넓은잎피사초 Carex xiphium Meinsh. JMC 금방동사니 Cyperus microiria Steud. JMC 참바늘골 Eleocharis attenuata for. laeviseta (Nakai) Hara JMC132 1 솔방울고랭이 Scirpus karuizawensis Makino JMC 방울고랭이 Scirpus wichurae var. asiaticus (Beetle) T.Koyama JMC13116, JMC 골풀과 골풀 Juncus effusus var. decipiens Buchenau JMC11922, JMC122, JMC1232, JMC12672, JMC133 길골풀 Juncus tenuis Willd. JMC13336, JMC133 2 꿩의밥 Luzula capitata (Miq.) Miq. JMC 산꿩의밥 Luzula multiflora Lej. JMC112, JMC 오대산새밥 Luzula odaesanesis Y.N.Lee & Chae Y. ( 비합법명 ) JMC13201, JMC1269, JMC 좀꿩의밥 Luzula wahlenbergii Rupr. JMC126 1 벼과 털개밀 Agropyron gmelini (Griseb.) Scribn. & Sm. JMC 개밀 Agropyron tsukushiense var. transiens (Hack.) Ohwi JMC 흰겨이삭 Agrostis alba L. JMC 산겨이삭 Agrostis clavata Trin. JMC11811, JMC 겨이삭 Agrostis clavata var. nukabo Ohwi JMC1191, JMC1203, JMC 검정겨이삭 Agrostis flaccida var. trinii (Turcz. ex Litv.) Ohwi JMC 긴겨이삭 Agrostis scabra Willd. JMC12677, JMC 뚝새풀 Alopecurus aequalis Sobol. JMC120 1 새 Arundinella hirta (Thunb.) Koidz. JMC1192, JMC12212, JMC1223, JMC13127 민숲개밀 Brachypodium sylvaticum var. miserum (Thunb.) Koidz. JMC 실새풀 Calamagrostis arundinacea (L.) Roth JMC1222, JMC12272, JMC12323, JMC13078, JMC12993, JMC1301, JMC11, JMC1301, JMC1392, 11 JMC1389, JMC1396 산조풀 Calamagrostis epigeios (L.) Roth JMC 산새풀 Calamagrostis langsdorfii (Link) Trin. JMC 갯조풀 Calamagrostis pseudophragmites (Haller f.) Koeler JMC 오리새 Dactylis glomerata L. JMC 용수염 Diarrhena japonica (Franch. & Sav.) Franch. & Sav. JMC 껍질용수염 Diarrhena mandshurica Maxim. JMC12161, JMC12186, JMC12223, JMC1228, JMC1231, JMC12686, JMC12997, JMC1302, JMC13077, 10 JMC13106 바랭이 Digitaria ciliaris (Retz.) Koel. JMC 돌피 Echinochloa crusgalli (L.)P.Beauv. JMC12280, JMC 김의털 Festuca ovina L. JMC1179, JMC11897, JMC1269, JMC12680,JMC1328, JMC 왕김의털아재비 Festuca subulata var. japonica Hack. JMC11839, JMC12009, JMC13262, JMC13300 총전광이 Glyceria lithuanica (Gorski) Lindm. JMC 도랭이피 Koeleria cristata (L.) Pers. JMC12023, JMC 부록 _ 39

27 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 드렁새 Leptochloa chinensis (L.) Nees JMC 왕쌀새 Melica nutans L. JMC 쌀새 Melica onoei Franch. & Sav. JMC11780, JMC1189, JMC119, JMC11970, JMC1319, JMC 나도바랭이새 Microstegium vimineum (Trin.)A.Camus JMC 물억새 Miscanthus sacchariflorus (Maxim.) Benth. JMC 억새 Miscanthus sinensis var. purpurascens (Andersson) Rendle JMC 쥐꼬리새 Muhlenbergia japonica Steud. JMC1300, JMC 개기장 Panicum bisulcatum Thunb. JMC 달뿌리풀 Phragmites japonica Steud. JMC13031, JMC 새포아풀 Poa annua L. JMC 자주포아풀 Poa glauca Vahl JMC 포아풀 Poa sphondylodes Trin. JMC1173, JMC 청포아풀 Poa viridula Palib. JMC11906, JMC1233, JMC 조릿대 Sasa borealis (Hack.) Makino JMC116 1 가을강아지풀 Setaria faberii Herrm. JMC121, JMC1230, JMC 금강아지풀 Setaria glauca (L.) P.Beauv. JMC12263, JMC13016, JMC 강아지풀 Setaria viridis (L.) P.Beauv. JMC 큰기름새 Spodiopogon sibiricus Trin. JMC12361, JMC13067, JMC 참나래새 Stipa coreana Honda ex Nakai JMC 나래새 Stipa pekinensis Hance JMC1212, JMC12211, JMC1226, JMC123, JMC1302, JMC13076, JMC1309, JMC13111, JMC1313, 10 JMC130 매자나무과 매발톱나무 Berberis amurensis Rupr. JMC11768, JMC12001, JMC1331, JMC1300 꿩의다리아재비 Caulophyllum robustum Maxim. JMC 한계령풀 Leontice microrhyncha S.Moore JMC1186, JMC 으름덩굴과 으름덩굴 Akebia quinata(thunb.exmurray)decne. JMC 양귀비과 애기똥풀 Chelidonium majus var. asiaticum (Hara) Ohwi JMC119 1 피나물 Hylomecon vernalis Maxim. JMC 현호색과 눈괴불주머니 Corydalis ochotensis Turcz. JMC12301, JMC 현호색 Corydalis remota Fisch. ex Maxim. JMC1189, JMC13229, JMC 산괴불주머니 Corydalis speciosa Maxim. JMC117, JMC 미나리아재비과투구꽃 Aconitum jaluense Kom. JMC13073, JMC13110, JMC1210, JMC12203, JMC12299, JMC 진범 Aconitum pseudolaeve Nakai JMC 노루삼 Actaea asiatica H.Hara JMC118, JMC11731, JMC122 3 복수초 Adonis amurensis Regel & Radde JMC116, JMC 홀아비바람꽃 Anemone koraiensis Nakai JMC111, JMC 바람꽃 Anemone narcissiflora L. JMC 꿩의바람꽃 Anemone raddeana Regel JMC 회리바람꽃 Anemone reflexa Steph. & Willd. JMC1138, JMC11601, JMC 동의나물 Caltha palustris L. JMC1163, JMC1197, JMC _ 국립수목원

28 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 눈빛승마 Cimicifuga dahurica (Turcz. ex Fisch. & C.A.Mey.) Maxim. JMC 승마 Cimicifuga heracleifolia Kom. JMC1312, JMC136, JMC 세잎승마 Cimicifuga heracleifolia var. bifida Nakai JMC 촛대승마 Cimicifuga simplex (DC.) Turcz. JMC12166, JMC12238, JMC13093, JMC13126 요강나물 Clematis fusca var. coreana (H.Lev. & Vaniot) Nakai JMC1179, JMC11969, JMC 병조희풀 Clematis heracleifolia DC. JMC11797, JMC 자주조희풀 Clematis heracleifolia var. davidiana Hemsl. JMC 세잎종덩굴 Clematis koreana Kom. JMC1177, JMC 할미밀망 Clematis trichotoma Nakai JMC 너도바람꽃 Eranthis stellata Maxim. JMC 노루귀 Hepatica asiatica Nakai JMC116 1 만주바람꽃 Isopyrum manshuricum (Kom.) Kom. JMC 모데미풀 Megaleranthis saniculifolia Ohwi JMC117, JMC 젓가락나물 Ranunculus chinensis Bunge JMC 미나리아재비 Ranunculus japonicus Thunb. JMC1178, JMC11932, JMC 개구리갓 Ranunculus ternatus Thunb. JMC13227, JMC 산꿩의다리 Thalictrum filamentosum var. tenerum (Huth) Ohwi JMC 명아주과 명아주 Chenopodium album var. centrorubrum Makino JMC 석죽과 동자꽃 Lychnis cognata Maxim. JMC11787, JMC11880, JMC 덩굴개별꽃 Pseudostellaria davidii (Franch.) Pax ex Pax & Hoffm. JMC116, JMC 긴개별꽃 Pseudostellaria japonica Pax JMC 큰개별꽃 Pseudostellaria palibiniana (Takeda) Ohwi JMC1139, JMC11893, JMC1321, JMC13238 끈끈이대나물 Silene armeria L. JMC 장구채 Silene firma Siebold & Zucc. JMC12028, JMC12171, JMC12362, JMC1302 쇠별꽃 Stellaria aquatica (L.) Scop. JMC 별꽃 Stellaria media (L.) Vill. JMC 마디풀과 흰범꼬리 Bistorta incana (Nakai) Nakai ex Mori JMC 범꼬리 Bistorta manshuriensis (Petrov ex Kom.) Kom. JMC1236, JMC 나도하수오 Fallopia ciliinervis (Nakai) Hammer JMC1200, JMC 닭의덩굴 Fallopia dumetorum (L.) Holub JMC12178, JMC131, JMC137 3 이삭여뀌 Persicaria filiformis (Thunb.) Nakai ex Mori JMC 여뀌 Persicaria hydropiper (L.)Spach JMC12270, JMC 흰꽃여뀌 Persicaria japonica (Meisn.) H.Gross ex Nakai JMC12180, JMC12273, JMC 흰여뀌 Persicaria lapathifolia (L.)Gray JMC13020, JMC 개여뀌 Persicaria longiseta (Bruijn) Kitag. JMC 산여뀌 Persicaria nepalensis (Meisn.) H.Gross JMC12206, JMC13008, JMC 명아자여뀌 Persicaria nodosa (Pers.)Opiz JMC 장대여뀌 Persicaria posumbu var. laxiflora (Meisn.) H.Hara JMC1221, JMC12293, JMC13000, JMC13112, JMC1331 부록 _ 1

29 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 JMC12018, JMC1218, JMC1223, 미꾸리낚시 Persicaria sagittata (L.) H.Gross ex Nakai JMC1227, JMC123, JMC13019, JMC 며느리밑씻개 Persicaria senticosa (Meisn.) H.Gross ex Nakai JMC 고마리 Persicaria thunbergii (Siebold & Zucc.) H.Gross ex Nakai JMC12296, JMC13109, JMC136 3 기생여뀌 Persicaria viscosa (Hamilt. ex D.Don) H.Gross ex Nakai JMC 마디풀 Polygonum aviculare L. JMC12031, JMC12282, JMC1336, JMC136 수영 Rumex acetosa L. JMC 애기수영 Rumex acetosella L. JMC119, JMC11908, JMC138 1 소리쟁이 Rumex crispus L. JMC 겨우살이과 겨우살이 Viscum album var. coloratum (Kom.) Ohwi JMC11612, JMC123 2 돌나물과 꿩의비름 Hylotelephium erythrostictum (Miq.) H.Ohba JMC12219, JMC 새끼꿩의비름 Hylotelephium viviparum (Maxim.) H.Ohba JMC12331, JMC 기린초 Sedum kamtschaticum Fisch. & Mey. JMC1188, JMC 바위채송화 Sedum polytrichoides Hemsl. JMC 돌나물 Sedum sarmentosum Bunge JMC 작약과 산작약 Paeonia obovata Maxim. JMC 범의귀과 돌단풍 Aceriphyllum rossii Engl. JMC 노루오줌 Astilbe rubra Hook.f. & Thomson JMC 애기괭이눈 Chrysosplenium flagelliferum F.Schmidt JMC 괭이눈 Chrysosplenium grayanum Maxim. JMC1131, JMC 선괭이눈 Chrysosplenium pseudofauriei H.Lev. JMC 가지괭이눈 Chrysosplenium ramosum Maxim. JMC 매화말발도리 Deutzia coreana Lev. JMC 물참대 Deutzia glabrata Kom. JMC1176, JMC11829, JMC13083, JMC1320, JMC1327 말발도리 Deutzia parviflora Bunge JMC 고광나무 Philadelphus schrenkii Rupr. JMC1183, JMC11910, JMC12000, JMC1266 까마귀밥나무 Ribes fasciculatum var. chinense Maxim. JMC 까치밥나무 Ribes mandshuricum (Maxim.)Kom. JMC1126, JMC11838, JMC130, JMC13236, JMC1321 도깨비부채 Rodgersia podophylla A.Gray JMC 바위떡풀 Saxifraga fortunei var. incisolobata (Engl. & Irmsch.) Nakai JMC12217, JMC 구실바위취 Saxifraga octopetala Nakai JMC 포도과 왕머루 Vitis amurensis Rupr. JMC 고추나무과 고추나무 Staphylea bumalda DC. JMC11833, JMC 쥐손이풀과 산쥐손이 Geranium dahuricum DC. JMC 꽃쥐손이 Geranium eriostemon FisherexDC. JMC 분홍쥐손이 Geranium maximowiczii Regel JMC 쥐손이풀 Geranium sibiricum L. JMC12311, JMC1303, JMC 이질풀 Geranium thunbergii Siebold & Zucc. JMC 세잎쥐손이 Geranium wilfordii Maxim. JMC1229, JMC _ 국립수목원

30 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 바늘꽃과 털이슬 Circaea mollis Slebold & Zucc. JMC1217, JMC 말털이슬 Circaea quadrisulcata (Maxim.) Franch. & Sav. JMC 분홍바늘꽃 Epilobium angustifolium L. JMC 바늘꽃 Epilobium pyrricholophum Franch. & Sav. JMC 여뀌바늘 Ludwigia prostrata Roxb. JMC 달맞이꽃 Oenothera biennis L. JMC13371, JMC 노박덩굴과 노박덩굴 Celastrus orbiculatus Thunb. JMC11916, JMC13039, JMC13332, JMC1337, JMC1361 화살나무 Euonymus alatus (Thunb.) Siebold JMC 회잎나무 Euonymus alatus for. ciliatodentatus (Franch. & Sav.) Hiyama JMC1130, JMC 참빗살나무 Euonymus hamiltonianus Wall. JMC11901, JMC11972, JMC 나래회나무 Euonymus macropterus Rupr. JMC11773, JMC 참회나무 Euonymus oxyphyllus Miq. JMC 회나무 Euonymus sachalinensis (F.Schmidt) Maxim. JMC117, JMC11827, JMC1188, JMC1193, JMC11977, JMC12288, 8 JMC13232, JMC1328 미역줄나무 Tripterygium regelii Sprague & Takeda JMC11739, JMC 물레나물과 물레나물 Hypericum ascyron L. JMC11719, JMC 채고추나물 Hypericum attenuatum Choisy JMC11800, JMC 버드나무과 호랑버들 Salix caprea L. JMC1233, JMC 왕버들 Salix chaenomeloides Kimura JMC 갯버들 Salix gracilistyla Miq. JMC1137, JMC12220, JMC 버드나무 Salix koreensis Andersson JMC 키버들 Salix koriyanagi Kimura JMC1160, JMC132, JMC 쪽버들 Salix maximowiczii Kom. JMC11622, JMC 분버들 Salix rorida Laksch. JMC 선버들 Salix subfragilis Andersson JMC 여우버들 Salix xerophila Flod. JMC 제비꽃과 졸방제비꽃 Viola acuminata Ledeb. JMC111, JMC1186, JMC1322, JMC13369 태백제비꽃 Viola albida Palib. JMC11732, JMC 남산제비꽃 Viola albida var. chaerophylloides (Regel) F.Maek. ex Hara JMC 둥근털제비꽃 Viola collina Besser JMC1193, JMC 금강제비꽃 Viola diamantiaca Nakai JMC 제비꽃 Viola mandshurica W.Becker JMC 노랑제비꽃 Viola orientalis (Maxim.) W.Becker JMC1173, JMC11628, JMC 고깔제비꽃 Viola rossii Hemsl. JMC 뫼제비꽃 Viola selkirkii Purshex Golde JMC 민둥뫼제비꽃 Viola tokubuchiana var. takedana (Makino) F.Maek. JMC13231, JMC 콩제비꽃 Viola verecunda A.Gray JMC11606, JMC12662, JMC 호제비꽃 Viola yedoensis Makino JMC11 1 대극과 깨풀 Acalypha australis L. JMC136 1 부록 _ 3

31 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 개감수 Euphorbia sieboldiana Morren & Decne. JMC113, JMC11820, JMC 광대싸리 Securinega suffruticosa (Pall.) Rehder JMC136 1 괭이밥과 괭이밥 Oxalis corniculata L. JMC 큰괭이밥 Oxalis obtriangulata Maxim. JMC 박과 산외 Schizopepon bryoniaefolius Maxim. JMC11869, JMC 자작나무과 거제수나무 Betula costata Trautv. JMC 물박달나무 Betula davurica Pall. JMC 사스래나무 Betula ermanii Cham. JMC1177, JMC 박달나무 Betula schmidtii Regel JMC11928, JMC 까치박달 Carpinus cordata Blume JMC 서어나무 Carpinus laxiflora (Siebold & Zucc.) Blume JMC11607, JMC1269, JMC1313, JMC1388 개암나무 Corylus heterophylla Fisch.ex Trautv. JMC12338, JMC 참나무과 신갈나무 Quercus mongolica Fisch. ex Ledeb. JMC11939, JMC 졸참나무 Quercus serrata Thunb. ex Murray JMC 가래나무과 가래나무 Juglans mandshurica Maxim. JMC 콩과 황기 Astragalus membranaceus Bunge JMC 큰도둑놈의갈고리 Desmodium oldhami Oliv. JMC 애기도둑놈의갈고리 Desmodium podocarpum var. mandshuricum Maxim. JMC11978, JMC 도둑놈의갈고리 Desmodium podocarpum var. oxyphyllum (DC.) H.Ohashi JMC 돌콩 Glycine soja Siebold & Zucc. JMC 활량나물 Lathyrus davidii Hance JMC 싸리 Lespedeza bicolor Turcz. JMC 비수리 Lespedeza cuneata G.Don JMC 참싸리 Lespedeza cyrtobotrya Miq. JMC11937, JMC12011, JMC 조록싸리 Lespedeza maximowiczii C.K.Schneid. JMC11812, JMC 다릅나무 Maackia amurensis Rupr.&Maxim. JMC12016, JMC138 2 토끼풀 Trifolium repens L. JMC 벌완두 Vicia amurensis Oett. JMC11911, JMC12019, JMC 네잎갈퀴나물 Vicia nipponica Matsum. JMC11782, JMC 나비나물 Vicia unijuga A.Braun JMC 큰네잎갈퀴 Vicia venosa var. albiflora (Turcz.) Maxim. JMC 광릉갈퀴 Vicia venosa var. cuspidata Maxim. JMC11831, JMC1206, JMC13120, JMC13266, JMC13327 느릅나무과 느릅나무 Ulmus davidiana var. japonica (Rehder) Nakai JMC1360, JMC1336, JMC11992, JMC1362 난티나무 Ulmus laciniata (Trautv.) Mayr JMC1182, JMC122, JMC 삼과 환삼덩굴 Humulus japonicus Sieboid & Zucc. JMC 뽕나무과 산뽕나무 Morus bombycis Koidz. JMC 쐐기풀과 좀깨잎나무 Boehmeria spicata (Thunb.) Thunb. JMC 거북꼬리 Boehmeria tricuspis (Hance) Makino JMC1177, JMC11919, JMC 혹쐐기풀 Laportea bulbifera (Siebold & Zucc.) Wedd. JMC1188, JMC1197, JMC1222, JMC1326 _ 국립수목원

32 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 큰물통이 Pilea hamaoi Makino JMC12276, JMC132, JMC13380, JMC13261 산물통이 Pilea japonica (Maxim.) Hand.-Mazz. JMC1226, JMC 모시물통이 Pilea mongolica Wedd. JMC13 1 가는잎쐐기풀 Urtica angustifolia Fisch. ex Hornem. JMC11722, JMC12689, JMC 애기쐐기풀 Urtica laetevirens Maxim. JMC 갈매나무과 갈매나무 Rhamnus davurica Pall. JMC12308, JMC 장미과 산짚신나물 Agrimonia coreana Nakai JMC1182, JMC 눈개승마 Aruncus dioicus var. kamtschaticus (Maxim.) H.Hara JMC11778, JMC1199, JMC 뱀딸기 Duchesnea indica (Andr.) Focke JMC119 1 터리풀 Filipendula glaberrima (Nakai) Nakai JMC 뱀무 Geum japonicum Thunb. JMC11822, JMC 야광나무 Malus baccata Borkh. JMC12207, JMC 털야광나무 Malus baccata var. mandshurica (Maxim.) C.K.Schneid. JMC 좀딸기 Potentilla centigrana Maxim. JMC11823, JMC12678, JMC 딱지꽃 Potentilla chinensis Ser. JMC 물양지꽃 Potentilla cryptotaeniae Maxim. JMC12262, JMC13029, JMC1368, JMC13269, JMC1303 돌양지꽃 Potentilla dickinsii Franch.&Sav. JMC 세잎양지꽃 Potentilla freyniana Bornm. JMC 윤노리나무 Pourthiaea villosa (Thunb.)Decne. JMC139 1 귀룽나무 Prunus padus L. JMC11602, JMC11997, JMC13279, JMC13330, JMC1339 산돌배 Pyrus ussuriensis Maxim. JMC12190, JMC 찔레꽃 Rosa multiflora Thunb. JMC 인가목 Rosa suavis Willd. JMC11767, JMC12199, JMC1237, JMC13070 산딸기 Rubus crataegifolius Bunge JMC117, JMC 줄딸기 Rubus oldhamii Miq. JMC118, JMC11991, JMC13117, JMC13328, JMC1372 멍석딸기 Rubus parvifolius L. JMC 곰딸기 Rubus phoenicolasius Maxim. JMC 산오이풀 Sanguisorba hakusanensis Makino JMC12198, JMC 가는오이풀 Sanguisorba tenuifolia Fisch. ex Link JMC130 1 쉬땅나무 Sorbaria sorbifolia var. stellipila Maxim. JMC1376, JMC11938, JMC1201, JMC1312 팥배나무 Sorbus alnifolia (Siebold & Zucc.) K.Koch JMC11976, JMC 당마가목 Sorbus amurensis Koehne JMC 참조팝나무 Spiraea fritschiana Schneid JMC11769, JMC12003, JMC 아구장나무 Spiraea pubescens Turcz. JMC 국수나무 Stephanandra incisa (Thunb.) Zabel JMC11818, JMC1187, JMC 나도양지꽃 Waldsteinia ternata (Stephan) Fritsch JMC 옻나무과 붉나무 Rhus javanica L. JMC 개옻나무 Rhus tricocarpa Miq. JMC119 1 부록 _

33 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 운향과 황벽나무 Phellodendron amurense Rupr. JMC 산초나무 Zanthoxylum schinifolium Siebold & Zucc. JMC 단풍나무과 청시닥나무 Acer barbinerve Maxim. JMC 시닥나무 Acer komarovii Pojark. JMC12007, JMC12683, JMC 복장나무 Acer mandshuricum Maxim. JMC118 1 고로쇠나무 Acer pictum subsp. mono (Maxim.) Ohashi JMC 당단풍나무 Acer pseudosieboldianum (Pax) Kom. JMC 신나무 Acer tataricum subsp. ginnala (Maxim.) Wesm. JMC11872, JMC12013, JMC139, JMC130 산겨릅나무 Acer tegmentosum Maxim. JMC11861, JMC 부게꽃나무 Acer ukurunduense Trautv. & C.A.Mey. JMC 피나무과 피나무 Tilia amurensis Rupr. JMC1191, JMC12229, JMC 찰피나무 Tilia mandshurica Rupr. & Maxim. JMC11923, JMC13237, JMC 뽕잎피나무 Tilia taquetii C.K.Schneid. JMC1176, JMC12209, JMC13277, JMC13307 십자화과 산장대 Arabis gemmifera(matsum.)makino JMC11603, JMC 장대나물 Arabis glabra Bernh. JMC 나도냉이 Barbarea orthoceras Ledeb. JMC1192, JMC 냉이 Capsella bursapastoris (L.) L.W.Medicus JMC118, JMC 꽃황새냉이 Cardamine amaraeformis Nakai JMC11620, JMC11727, JMC 는쟁이냉이 Cardamine komarovii Nakai JMC 미나리냉이 Cardamine leucantha (Tausch)O.E.Schulz JMC110, JMC 꽃다지 Draba nemorosa L. JMC 콩다닥냉이 Lepidium virginicum L. JMC 속속이풀 Rorippa palustris (Leyss.) Besser JMC 노란장대 Sisymbrium luteum (Maxim.) O.E.Schulz JMC1181, JMC1192, JMC 층층나무과 층층나무 Cornus controversa Hemsl. ex Prain JMC1178, JMC 박쥐나무과 박쥐나무 Alangium platanifolium var. trilobum (Miq.) Ohwi JMC 다래나무과 다래 Actinidia arguta (Siebold&Zucc.)Planch.exMiq. JMC 쥐다래 Actinidia kolomikta (Maxim. & Rupr.) Maxim. JMC 개다래 Actinidia polygama (Siebold & Zucc.) Planch. ex Maxim. JMC11870, JMC 봉선화과 노랑물봉선 Impatiens nolitangere L. JMC11888, JMC 물봉선 Impatiens textori Miq. JMC12172, JMC 감나무과 고욤나무 Diospyros lotus L. JMC 진달래과 만병초 Rhododendron brachycarpum D.Don ex G.Don JMC 진달래 Rhododendron mucronulatum Turcz. JMC 철쭉 Rhododendron schlippenbachii Maxim. JMC1129, JMC 산앵도나무 Vaccinium hirtum var. koreanum (Nakai) Kitam. JMC11960, JMC 노루발과 노루발 Pyrola japonica Klenze ex Alef. JMC11763, JMC1180, JMC 앵초과 큰까치수염 Lysimachia clethroides Duby JMC 참좁쌀풀 Lysimachia coreana Nakai JMC11729, JMC 좁쌀풀 Lysimachia vulgaris var. davurica (Ledeb.) R.Kunth JMC1170, JMC 큰앵초 Primula jesoana Miq. JMC11, JMC12360, JMC12669, JMC133 6 _ 국립수목원

34 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 때죽나무과 쪽동백나무 Styrax obassia Siebold & Zucc. JMC 노린재나무과검노린재나무 Symplocos tanakana Nakai JMC11762, JMC1179, JMC1198, JMC12213, JMC12667, JMC 지치과 당개지치 Brachybotrys paridiformis Maxim. ex Oliv. JMC 덩굴꽃마리 Trigonotis icumae (Maxim.) Makino JMC117 1 박주가리과 박주가리 Metaplexis japonica (Thunb.) Makino JMC 용담과 과남풀 Gentiana triflora var. japonica (Kusn.) H.Hara JMC1231, JMC 큰구슬붕이 Gentiana zollingeri Faw. JMC 꼭두선이과 갈퀴아재비 Asperula lasiantha Nakai JMC11971, JMC12266, JMC13089, JMC13121, JMC13 선갈퀴 Asperula odorata L. JMC117, JMC11832, JMC 좀네잎갈퀴 Galium gracilens (A.Gray) Makino JMC 두메갈퀴 Galium paradoxum Maxim. JMC1187, JMC11891, JMC13100, JMC1322 가는네잎갈퀴 Galium trifidum L. JMC 솔나물 Galium verum var. asiaticum Nakai JMC 꼭두서니 Rubia akane Nakai JMC 큰꼭두서니 Rubia chinensis Regel&Maack JMC11610, JMC11792, JMC1269, JMC13066, JMC13122, JMC 갈퀴꼭두서니 Rubia cordifolia var. pratensis Maxim. JMC11996, JMC 꿀풀과 배초향 Agastache rugosa (Fisch. & Mey.) Kuntze JMC1220, JMC12269, JMC 층층이꽃 Clinopodium chinense var. parviflorum (Kudo) Hara JMC12029, JMC12188, JMC12307, JMC13321 탑꽃 Clinopodium gracile var. multicaule (Maxim.) Ohwi JMC 두메층층이 Clinopodium micranthum (Regel) Hara JMC 향유 Elsholtzia ciliata (Thunb.) Hyl. JMC12376, JMC13033, JMC13370, JMC139 꽃향유 Elsholtzia splendens Nakai JMC13139, JMC 오리방풀 Isodon excisus (Maxim.) Kudo JMC 산박하 Isodon inflexus (Thunb.) Kudo JMC 광대수염 Lamium album var. barbatum (Siebold & Zucc.) Franch. & Sav. JMC112, JMC 익모초 Leonurus japonicus Houtt. JMC 송장풀 Leonurus macranthus Maxim. JMC 쉽싸리 Lycopus lucidus Turcz. JMC1299, JMC13021, JMC121, JMC12327, JMC13387 벌깨덩굴 Meehania urticifolia (Miq.) Makino JMC 들깨풀 Mosla punctulata (J.F.Gmelin) Nakai JMC 속단 Phlomis umbrosa Turcz. JMC1176, JMC 꿀풀 Prunella vulgaris var. lilacina Nakai JMC1173, JMC 참배암차즈기 Salvia chanryonica Nakai JMC1199, JMC13119, JMC132 3 산골무꽃 Scutellaria pekinensis var. transitra (Makino) Hara JMC11723, JMC 석잠풀 Stachys japonica Miq. JMC11981, JMC 물푸레나무과들메나무 Fraxinus mandshurica Rupr. JMC11873, JMC11879, JMC12228, JMC13386 부록 _ 7

35 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 물푸레나무 Fraxinus rhynchophylla Hance JMC11968, JMC1200, JMC12227, JMC1268, JMC13278 쥐똥나무 Ligustrum obtusifolium Siebold & Zucc. JMC 털개회나무 Syringa patula (Palib.) Nakai JMC11766, JMC12237, JMC 개회나무 Syringa reticulata var. mandshurica (Maxim.) H.Hara JMC11796, JMC1266, JMC137 3 꽃개회나무 Syringa wolfii C.K.Schneid. JMC11799, JMC1306, JMC 열당과 가지더부살이 Phacellanthus tubiflorus Siebold & Zucc. JMC 파리풀과 파리풀 Phryma leptostachya var. asiatica H.Hara JMC11837, JMC 질경이과 질경이 Plantago asiatica L. JMC11918, JMC13309, JMC 현삼과 꽃며느리밥풀 Melampyrum roseum Maxim. JMC 새며느리밥풀 Melampyrum setaceum var. nakaianum (Tuyama) T.Yamaz. JMC12230, JMC 송이풀 Pedicularis resupinata L. JMC12167, JMC13013, JMC1302, JMC13010, JMC11760, JMC 나도송이풀 Phtheirospermum japonicum (Thunb.) Kanitz JMC 토현삼 Scrophularia koraiensis Nakai JMC1178, JMC119, JMC12202, JMC1226, JMC130, JMC13138, JMC 넓은잎꼬리풀 Veronica kiusiana Furumi JMC 큰산꼬리풀 Veronica kiusiana var. glabrifolia (Kitag.) Kitag. JMC1231, JMC12999, JMC136 3 큰꼬리풀 Veronica linariifolia var. dilatata (Nakai & Kitag.) Nakai & Kitag. JMC 긴산꼬리풀 Veronica longifolia L. JMC 산꼬리풀 Veronica rotunda var. subintegra (Nakai) T.Yamaz. JMC 냉초 Veronicastrum sibiricum (L.) Pennell JMC 메꽃과 큰메꽃 Calystegia sepium (L.) R.Br. JMC 새삼 Cuscuta japonica Choisy JMC 산형과 왜방풍 Aegopodium alpestre Ledeb. JMC1219, JMC12291, JMC1230, JMC13002 바디나물 Angelica decursiva (Miq.) Franch. & Sav. JMC1223, JMC12320, JMC1311, JMC13267, JMC13319 왜천궁 Angelica genuflexa Nutt. ex Torr. & A.Gray JMC12261, JMC1236, JMC12998, JMC1399 참당귀 Angelica gigas Nakai JMC1196, JMC12200, JMC12303, JMC13001, JMC13107 궁궁이 Angelica polymorpha Maxim. JMC1230, JMC12992, JMC 지리강활 Angelica purpuraefolia Chung JMC12312, JMC 고본 Angelica tenuissima Nakai JMC12197, JMC 전호 Anthriscus sylvestris (L.) Hoffm. JMC11876, JMC126 2 개시호 Bupleurum longeradiatum Turcz. JMC1196, JMC 파드득나물 Cryptotaenia japonica Hassk. JMC118 1 큰참나물 Cymopterus melanotilingia (H.Boissieu) C.Y.Yoon JMC 좁은어수리 Heracleum moellendorffii for. angustum (Kitag.) Kitag. JMC 어수리 Heracleum moellendorffii Hance JMC 긴사상자 Osmorhiza aristata (Thunb.) Makino & Yabe JMC113 1 신감채 Ostericum grosseserratum (Maxim.) Kitag. JMC1213, JMC12289, JMC _ 국립수목원

36 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 기름나물 Peucedanum terebinthaceum (Fisch.) Fisch. ex DC. JMC 참나물 Pimpinella brachycarpa (Kom.) Nakai JMC11621, JMC11998, JMC 누룩치 Pleurospermum camtschaticum Hoffm. JMC136 1 참반디 Sanicula chinensis Bunge JMC 붉은참반디 Sanicula rubriflora F.Schmidt ex Maxim. JMC 사상자 Torilis japonica (Houtt.) DC. JMC 두릅나무과 두릅나무 Aralia elata (Miq.) Seem. JMC Eleutherococcus divaricatus var. chiisanensis (Nakai) JMC1223, JMC12691, JMC13129, 지리산오갈피 C.H.Kim & B.Y.Sun JMC1338, JMC1306 오갈피나무 Eleutherococcus sessiliflorus (Rupr. & Maxim.) S.Y.Hu JMC 음나무 Kalopanax septemlobus (Thunb.) Koidz. JMC 국화과 톱풀 Achillea alpina L. JMC13017, JMC1306, JMC13198, JMC1330 멸가치 Adenocaulon himalaicum Edgew. JMC12287, JMC138 2 단풍취 Ainsliaea acerifolia Sch.Bip. JMC 더위지기 Artemisia gmelini Weber ex Stechm. JMC1172, JMC12176, JMC 제비쑥 Artemisia japonica Thunb. JMC12329, JMC 맑은대쑥 Artemisia keiskeana Miq. JMC 산쑥 Artemisia montana (Nakai) Pamp. JMC 덤불쑥 Artemisia rubripes Nakai JMC12309, JMC1231, JMC 넓은잎외잎쑥 Artemisia stolonifera (Maxim.) Kom. JMC11890, JMC 까실쑥부쟁이 Aster ageratoides Turcz. JMC1217, JMC12290, JMC130, JMC13288 개쑥부쟁이 Aster meyendorfii (Regel & Maack) Voss JMC1233, JMC 가는쑥부쟁이 Aster pekinensis (Hance) Chen JMC1211, JMC12201, JMC1310, JMC1371 미국쑥부쟁이 Aster pilosus Willd. JMC1239, JMC 참취 Aster scaber Thunb. JMC12170, JMC 개미취 Aster tataricus L.f. JMC12277, JMC12330, JMC 삽주 Atractylodes ovata (Thunb.) DC. JMC11967, JMC 미국가막사리 Bidens frondosa L. JMC1201, JMC1216, JMC1227, JMC13027, JMC1393 까치발 Bidens parviflora Willd. JMC136 1 지느러미엉겅퀴 Carduus crispus L. JMC 담배풀 Carpesium abrotanoides L. JMC 긴담배풀 Carpesium divaricatum Siebold & Zucc. JMC12173, JMC 여우오줌 Carpesium macrocephalum Franch. & Sav. JMC 두메담배풀 Carpesium triste Maxim. JMC 산구절초 Chrysanthemum zawadskii Herbich JMC 엉겅퀴 Cirsium japonicum var. maackii (Maxim.) Matsum. JMC11737, JMC 큰엉겅퀴 Cirsium pendulum Fisch. ex DC. JMC 도깨비엉겅퀴 Cirsium schantarense Trautv. & Mey. JMC 고려엉겅퀴 Cirsium setidens (Dunn) Nakai JMC1202, JMC12306, JMC 점봉산엉겅퀴 Cirsium zenii Nakai KWNA 부록 _ 9

37 점봉산시험림의관속식물및야생동물조사보고서 과명 국명 학 명 표본번호 표본수 망초 Conyza canadensis (L.) Cronquist JMC 까치고들빼기 Crepidiastrum chelidoniifolium (Makino) Pak & Kawano JMC11828, JMC1219, JMC 이고들빼기 Crepidiastrum denticulatum (Houtt.) Pak & Kawano JMC12179, JMC12267, JMC 산국 Dendranthema boreale (Makino) Ling ex Kitam. JMC 구절초 Dendranthema zawadskii var. latilobum (Maxim.) Kitam. JMC 개망초 Erigeron annuus (L.) Pers. JMC 등골나물 Eupatorium japonicum Thunb. JMC1170, JMC1193, JMC12363, JMC1312 뚱딴지 Helianthus tuberosus L. JMC 조밥나물 Hieracium umbellatum L. JMC12010, JMC13037, JMC13393, JMC1302 금불초 Inula britannica var. japonica (Thunb.) Franch. & Sav. JMC1228, JMC 두메고들빼기 Lactuca triangulata Maxim. JMC1190, JMC12286, JMC12310, JMC1329, JMC13367, JMC 솜나물 Leibnitzia anandria (L.) Turcz. JMC 곰취 Ligularia fischeri (Ledeb.) Turcz. JMC 나래박쥐나물 Parasenecio auriculata var. kamtschatica (Maxim.) H.Koyama JMC11781, JMC1182, JMC 박쥐나물 Parasenecio auriculata var. matsumurana Nakai JMC 병풍쌈 Parasenecio firmus (Kom.) Y.L.Chen JMC1178, JMC 쇠서나물 Picris hieracioides var. koreana Kitam. JMC12012, JMC 개씀배 Prenanthes tatarinowii Maxim. JMC 사창분취 Saussurea calcicola Nakai JMC 은분취 Saussurea gracilis Maxim. JMC1182, JMC11961, JMC 서덜취 Saussurea grandifolia Maxim. JMC11878, JMC1303, JMC13263, JMC13396 큰각시취 Saussurea japonica (Thunb.) DC. JMC 각시서덜취 Saussurea macrolepis (Nakai) Kitam. JMC117, JMC11777, JMC1179, JMC12168, JMC1227, JMC 각시취 Saussurea pulchella (Fisch.) Fisch. JMC 당분취 Saussurea tanakae Franch. & Sav. ex Maxim. JMC118, JMC 털진득찰 Sigesbeckia pubescens (Makino) Makino JMC12268, JMC131, JMC 미역취 Solidago virgaurea subsp. asiatica Kitam. ex Hara JMC12160, JMC12221, JMC12292, JMC13271 우산나물 Syneilesis palmata (Thunb.) Maxim. JMC1133, JMC11736, JMC 수리취 Synurus deltoides (Aiton) Nakai JMC1220, JMC 흰민들레 Taraxacum coreanum Nakai JMC 산민들레 Taraxacum ohwianum Kitam. JMC 초롱꽃과 도라지모시대 Adenophora grandiflora Nakai JMC11761, JMC 영아자 Asyneuma japonicum (Miq.) Briq. JMC11793, JMC 초롱꽃 Campanula punctata Lam. JMC118 1 더덕 Codonopsis lanceolata (Siebold & Zucc.) Trautv. JMC 만삼 Codonopsis pilosula (Franch.) Nannf. JMC12232, JMC13061, JMC 금강초롱꽃 Hanabusaya asiatica (Nakai) Nakai JMC1216, JMC 연복초과 연복초 Adoxa moschatellina L. JMC _ 국립수목원

38 점봉산시험림자생관속식물목록집 과명 국명 학 명 표본번호 표본수 인동과 댕댕이나무 Lonicera caerulea var. edulis Turcz. ex Herder JMC11611, JMC 각시괴불나무 Lonicera chrysantha Turcz. JMC 흰괴불나무 Lonicera tatarinowii var. leptantha (Rehder) Nakai JMC11790, JMC 지렁쿠나무 Sambucus sieboldiana var. miquelii (Nakai) Hara JMC11860, JMC1329, JMC 백당나무 Viburnum opulus var. calvescens (Rehder) Hara JMC11771, JMC11862, JMC126, JMC1307 JMC1177, JMC1186, JMC12002, 산가막살나무 Viburnum wrightii Miq. JMC1236, JMC12696, JMC13007, 7 JMC1337 붉은병꽃나무 Weigela florida (Bunge) A.DC. JMC11789, JMC11920, JMC13291, JMC138, JMC139, JMC1310, JMC 마타리과 돌마타리 Patrinia rupestris (Pall.) Juss. JMC 금마타리 Patrinia saniculaefolia Hemsl. JMC11776, JMC 마타리 Patrinia scabiosaefolia Fisch. ex Trevir. JMC12337, JMC13018, JMC13373, JMC13388, JMC137 뚝갈 Patrinia villosa (Thunb.) Juss. JMC 쥐오줌풀 Valeriana fauriei Briq. JMC1172, JMC119, JMC 부록 _ 1

39 Ranunculaceae Aconitum jaluense Kom. Ranunculaceae Aconitum pseudolaeve Nakai Polygonaceae Persicaria longiseta (Bruijn) Kitag. Polygonaceae Persicaria nepalensis (Meisn.) H.Gross Polygonaceae Persicaria posumbu var. laxiflora (Meisn.) H. Hara Polygonaceae Persicaria thunbergii (Siebold & Zucc.) H.Gross

40 Celastraceae Celastrus orbiculatus Thunb. Celastraceae Euonymus macropterus Rupr. Celastraceae Euonymus oxyphyllus Miq. Celastraceae Euonymus sachalinensis (F.Schmidt) Maxim. Celastraceae Tripterygium regelii Sprague & Takeda Cucurbitaceae Schizopepon bryoniifolius Maxim.

41 Fagaceae Quercus mongolica Fisch. ex Ledeb. Fagaceae Quercus serrata Murray Leguminosae Glycine soja Siebold & Zucc. Leguminosae Lespedeza bicolor Turcz. Leguminosae Lespedeza cyrtobotrya Miq. Leguminosae Lespedeza maximowiczii C.K.Schneid.

42 Leguminosae Vicia venosa var. cuspidata Maxim. Cannabinaceae Humulus japonicus Sieboid & Zucc. Urticaceae Laportea bulbifera (Siebold & Zucc.) Wedd. Rosaceae Sorbaria sorbifolia var. stellipila Maxim. Anacardiaceae Rhus javanica L. Anacardiaceae Rhus trichocarpa Miq.

43 Aceraceae Acer tataricum subsp. ginnala (Maxim.) Wesm. Cornaceae Cornus controversa Actinidiaceae Actinidia arguta (Siebold & Zucc.) Planch. ex Miq. Actinidiaceae Actinidia kolomikta (Maxim. & Rupr.) Maxim. Actinidiaceae Actinidia polygama (Siebold & Zucc.) Planch. ex Maxim. Balsaminaceae Impatiens noli-tangere L.

44 Balsaminaceae Impatiens textori Miq. Asclepiadaceae Metaplexis japonica (Thunb.) Makino Gentianaceae Gentiana triflora var. japonica (Kusn.) H. Hara Lamiaceae Agastache rugosa (Fisch. & Mey.) Kuntze Lamiaceae Elsholtzia ciliata (Thunb.) Hyl. Lamiaceae Elsholtzia splendens Nakai ex F.Maek.

45 Lamiaceae Mosla punctulata (J.F.Gmelin) Nakai Oleaceae Ligustrum obtusifolium Siebold & Zucc. Phrymaceae Phryma leptostachya var. asiatica H. Hara Scrophulariaceae Melampyrum roseum Maxim. Scrophulariaceae Melampyrum setaceum var. nakaianum (Tuyama) T.Yamaz. Convolvulaceae Cuscuta japonica Choisy

46 Umbelliferae Angelica gigas Nakai Umbelliferae Angelica amurensis Schischk. Umbelliferae Heracleum moellendorffii Hance Umbelliferae Sanicula chinensis Bunge Compositae Adenocaulon himalaicum Edgew. Compositae Ainsliaea acerifolia Sch.Bip.

47 Compositae Artemisia gmelinii Weber ex Stechm. Compositae Artemisia japonica Thunb. Compositae Artemisia stolonifera (Maxim.) Kom. Compositae Aster ageratoides Turcz. Compositae Aster meyendorfii (Regel & Maack) Voss Compositae Aster pilosus Willd.

48 Compositae Atractylodes ovata (Thunb.) DC. Compositae Dendranthema zawadskii (Herb.) Tzvelev Compositae Cirsium setidens (Dunn) Nakai Compositae Conyza canadensis (L.) Cronquist Compositae Crepidiastrum chelidoniifolium (Makino) Pak & Kawano Compositae Crepidiastrum denticulatum (Houtt.) Pak & Kawano

49 Compositae Dendranthema boreale (Makino) Ling ex Kitam. Compositae Saussurea macrolepis (Nakai) Kitam. Compositae Saussurea pulchella (Fisch.) Fisch. Compositae Sigesbeckia pubescens (Makino) Makino Compositae Solidago virgaurea subsp. asiatica Kitam. ex H. Hara Compositae Syneilesis palmata (Thunb.) Maxim.

도감본문(수정)~10p

도감본문(수정)~10p 두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9

More information

UM00003782.PDF

UM00003782.PDF 1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력

More information

13-ºÎ·Ï¸ðÀ½-0312

13-ºÎ·Ï¸ðÀ½-0312 Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba

More information

박선주.fm

박선주.fm 자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )

More information

2_11_24 김준수.hwp

2_11_24 김준수.hwp 농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년

More information

untitled

untitled 1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)

More information

untitled

untitled 11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS

More information

................-......

................-...... International Workshop on Biodiversity Conservation and Sustainable Development in North-East Asia with emphasis on the Role of Gangwon Province 2014. 6. 18-20 International Workshop on Biodiveristy Conservation

More information

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo

이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo 이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of

More information

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K

정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K 정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey

More information

fm

fm Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.

More information

358051_마상_식물상_종목록.xlsx

358051_마상_식물상_종목록.xlsx 2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무

More information

DMZ 의식물 155 마일

DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자

More information

000표지

000표지 04 Contents 1. Background 2. Outline 3. Schedule 4. Opening Ceremony (Sep.27(Tue)) 5. Sisterhood ceremony & Cultural performance (Sep.27(Tue)) 6. Movie- Jun-Ai / Banquet (Sep.27(Tue)) 7. Korea cultural

More information

조경식물학 - 활엽수 계열(2) -

조경식물학 - 활엽수 계열(2) - 조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum

More information

101.fm

101.fm Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest

More information

102.fm

102.fm Journal of Asia-Pacific Biodiversity Vol. 6, No. 1 31-81, 2013 http://dx.doi.org/10.7229/jkn.2013.6.1.031 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin

More information

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park

이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park 이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The

More information

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기

韓資植誌 Korean J. Plant Res. 24(5) : 549~556(2011) Chen, 2002; Walther et al., 2002; Lee et al., 2009). 기후변화에따른생물계절변화연구는장기간의모니터링을통해이루어지며, 계절변화연구는최근기후변화와기 연구논문韓資植誌 24(5) : 549~556(2011) Korean J. Plant Res. 한반도아고산지대내기후변화취약식물종의식물계절성변화연구 - 덕유산정상지역을중심으로 - 김혁진, 홍정기, 김상철, 오승환 1, 김주환 * 경원대학교생명과학과, 1 국립수목원 Plant Phenology of Threatened species for Climate change

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

조경식재학 - 식재재료(2) -

조경식재학 - 식재재료(2) - 조경식재설계 2 - 조경식물 ( 목본 )- 1. 자작나무 음양성 : 양수 건습성 : 건조 자작나무 Betula platyphylla var. japonica 번식 : 실생, 삽목 성상 : 낙엽활엽교목 수형 : 원추형 백색의수피, 황색단풍 강조, 유도, 차폐, 녹음식재 2. 서어나무 음양성 : 음수 생장속도 : 중간 건습성 : 건조 서어나무 Carpinus laxiflora

More information

R hwp

R hwp 목적기초연구 1 * Anticomplement Activities of Korean Indigeneous Plants No. Plant name Srientific name Family Activity(IC50) 98112 해변싸리 Lespedeza martrima 콩과 12.2 96019 지리산오갈피 Acanthopamax chiisanensis

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

< C1A4C8EFB6F42E687770>

< C1A4C8EFB6F42E687770> J. Ecol. Field Biol. 29 (3): 265 275, 2006 대구인접지역삼림식생의진행천이와잠재자연식생 정흥락 * 전영문 1 이호준 1, 1 Progressive Succession and Potential Natural Vegetation on the Forest Vegetation in and surrounding Daegu, Korea Choung,

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 김영동 - 태백 목명과명출현종태백 (378164) 도엽특이사항영문한글영문한글학명국명 E8 E9 Lycopodiales 석송문 Lycopodiaceae 석송과 Huperzia selago 좀다람쥐꼬리 식물구계학적등급 (Ⅳ) Lycopodiales 석송문 Lycopodiaceae 석송과 Lycopodium

More information

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>

<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770> 사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교

More information

유기억.fm

유기억.fm 54 Jong-Soo Kang, Jun-Soo Han, Kyeong-Sik Cheon, Kyung-Ah Kim,Yong-Ho ark and Ki-ug Yoo Appendix 1. List of vascular plants of t. Hanseok. Scientific name / Korean name / Voucher number Selaginellaceae

More information

조경식물학 - 활엽수 계열(3) -

조경식물학 - 활엽수 계열(3) - 조경식물학 - 활엽수계열 (2) - 1. 서부해당화 음양성 : 양수 서부해당화 Malus prunifolia 성상 : 낙엽활엽소교목 수형 : 구형 번식 : 실생 / 접목 적색의꽃, 적색열매가아름다움 기조, 강조식재 2. 마가목 음양성 : 음수 마가목 Sorbus commixta 수형 : 타원형 이식 : 어려움 전정 : 보통 번식 : 실생 / 접목 / 취목 흰색꽃과적색열매가아름다움

More information

11.hwp

11.hwp 23(3): 281 291, 2000 Korean J. Ecol. 금강송림의식생구조에관한정량적분석 윤충원 홍성천 적요 :,,,. 1) CCA,,,.,.,,. 2),,,,,.,. 3) 0.6622, 0.7,. 4), 0.6. 5).,. 검색어 :,, CCA,,,, 서론 1950 (classification) (ordination) (GreigSmith 1983),.

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense

More information

fm

fm Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)

More information

담양군 도래수마을의 식물상 조사 분석

담양군 도래수마을의 식물상 조사 분석 담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,

More information

<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>

<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770> ... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인

More information

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770> 수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는

More information

11¹Ú´ö±Ô

11¹Ú´ö±Ô A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -

More information

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N

Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N 다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

401.fm

401.fm Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department

More information

0321?몃씪-13?????붾낯臾?李?ps, page 1-40 @ Normalize

0321?몃씪-13?????붾낯臾?李?ps, page 1-40 @ Normalize 2012-13 District 3640, Rotary International 20133 www.rotary3640.org 2013. 3 Governors Monthly Letter 4 6 7 9 11 13 28 29 31 32 35 40 MAR 22-30 Week Event 22 Friday Arrive Cleveland airport-informal

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information

16회말하기

16회말하기 세종대왕 탄신 616주년 기념 The 16 th World Korean Language Speech Contest for Foreigners 야덥 부펜들 (인도, 제15회 세계 외국인 한국어 말하기 대회 대상 수상) 일시 장소 2013년 5월 15일(수) 14:00~16:30, 경희대학교 크라운관 후원 주최 College of Business Administration

More information

CDP_Korean-00

CDP_Korean-00 Carbon Disclosure Project Report 2008 Korea 50 On behalf of 385 investors with assets of $57 trillion Report written by CDP work Coordinated by MEMBER 2008 Carbon Disclosure Project 2008 Carbon Disclosure

More information

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo

2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo 2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

2011´ëÇпø2µµ 24p_0628

2011´ëÇпø2µµ 24p_0628 2011 Guide for U.S. Graduate School Admissions Table of Contents 02 03 04 05 06 08 09 10 11 13 15 21 LEADERS UHAK INTERNATIONAL STUDENTS SERVICE www.leadersuhak.com Leaders Uhak International Students

More information

04-다시_고속철도61~80p

04-다시_고속철도61~80p Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and

More information

Korean J. Plant Res. 29(2): (2016) Print ISSN Online ISSN Original Research Art

Korean J. Plant Res. 29(2): (2016)   Print ISSN Online ISSN Original Research Art Korean J. Plant Res. 29(2):241-263(2016) http://dx.doi.org/10.7732/kjpr.2016.29.2.241 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 석회암지대석병산일대의관속식물상 송재모 1, 손호준 2, 김영설 3, 김세창 3, 이다현

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,

More information

[00]_목차.hwp

[00]_목차.hwp Korean J. lant Res. 27(4):293-308(2014) http://dx.doi.org/10.7732/kjpr.2014.27.4.293 rint ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 국립 DZ 자생식물원조성부지의관속식물상 신현탁 1, 이명훈 2, 이창현 2, 성정원 2,

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum

More information

Passenger Terminal 1F Limousine Bus Taxi 1. LIMOUSINE BUS (NO.6001, NO.6015) Limousine Bus is the most convenient way to travel from Int l to the Lott

Passenger Terminal 1F Limousine Bus Taxi 1. LIMOUSINE BUS (NO.6001, NO.6015) Limousine Bus is the most convenient way to travel from Int l to the Lott TRANSPORTATION Most international passengers use (ICN) to enter Korea. Some passengers from China or Japan may use Gimpo (GMP). Passengers arriving at ICN or GMP will need to take a limousine bus or taxi

More information

7(3)-03.fm

7(3)-03.fm w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure

More information

274 한국문화 73

274 한국문화 73 - 273 - 274 한국문화 73 17~18 세기통제영의방어체제와병력운영 275 276 한국문화 73 17~18 세기통제영의방어체제와병력운영 277 278 한국문화 73 17~18 세기통제영의방어체제와병력운영 279 280 한국문화 73 17~18 세기통제영의방어체제와병력운영 281 282 한국문화 73 17~18 세기통제영의방어체제와병력운영 283 284

More information

<3136C1FD31C8A320C5EBC7D52E687770>

<3136C1FD31C8A320C5EBC7D52E687770> 고속도로건설에 따른 지역간 접근성 변화분석 A study on the impact of new highway construction on regional accessibility The purpose of this is to analyse the interregional accessibility changes due to highway construction.

More information

¹ýÁ¶ 12¿ù ¼öÁ¤.PDF

¹ýÁ¶ 12¿ù ¼öÁ¤.PDF 논문요약 146 [ 주제어 ] 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 abstract Recent Development in the Law of DPRK on the

More information

<B1E2C8B9BEC828BFCFBCBAC1F7C0FC29322E687770>

<B1E2C8B9BEC828BFCFBCBAC1F7C0FC29322E687770> 맛있는 한국으로의 초대 - 중화권 음식에서 한국 음식의 관광 상품화 모색하기 - 소속학교 : 한국외국어대학교 지도교수 : 오승렬 교수님 ( 중국어과) 팀 이 름 : 飮 食 男 女 ( 음식남녀) 팀 원 : 이승덕 ( 중국어과 4) 정진우 ( 중국어과 4) 조정훈 ( 중국어과 4) 이민정 ( 중국어과 3) 탐방목적 1. 한국 음식이 가지고 있는 장점과 경제적 가치에도

More information

서울대 뉴스레터 1018

서울대 뉴스레터 1018 Contents 01 국제학술회의 베를린자유대학과 공동 학술 세미나 개최 - 독일 베를린 자유대학과 학술교류 협약 체결 서울대 통일평화연구원과 베를린 자유대학의 공동세미나 참석자들 지난 5월 5일 통일평화연구원은 독일에서 베를린 자유 서울대와 베를린자유대는 지난 3월 베를린자유대 부총 대학과 공동세미나를 개최하였다. 공동세미나에서 통일평화 장 일행이 서울대를

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최

제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최 제출문 농림축산식품부장관귀하 이보고서를 허브산업기반활용뷰티산업소재 제품개발및특화산업육성기획 과제의 보고서로제출합니다. 2017 년 5 월 16 일 주관연구기관명 :( 주 ) 하이솔 주관연구책임자 : 김광상 세부연구책임자 : 김광상 연 구 원 : 박이경 연 구 원 : 최담선 연 구 원 : 김민숙 연 구 원 : 김민지 협동연구기관명 : ( 재 ) 남원시화장품산업지원센터

More information

BSC Discussion 1

BSC Discussion 1 Copyright 2006 by Human Consulting Group INC. All Rights Reserved. No Part of This Publication May Be Reproduced, Stored in a Retrieval System, or Transmitted in Any Form or by Any Means Electronic, Mechanical,

More information

신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화

신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화 신바이오작물보호제생물검정표준화및관리체계구축 작물보호생리활성물질소재탐색및 화 국명 학명 과명 가래 가래과 고추 가지과 흰독말풀 가지과 독말풀 가지과 사리풀 가지과 구기자나무지골피 가지과 담배 가지과 페츄니아 가지과 꽈리 가지과 미치광이 가지과 배풍등백모등 가지과 가지 가지과 까마중 가지과 토마토 가지과 페츄니아 가지과 갈매나무 갈매나무과 털갈매나무 갈매나무과

More information

<342EB1E8BCBAB9CE2D2E666D>

<342EB1E8BCBAB9CE2D2E666D> 韓藥作誌 (Korean J. Medicinal Crop Sci.) 2(4) : 268 275 (203) ISSN(Print) 225-9306 ISSN(Online) 2288-086 http://www.medicinalcrop.org http://dx.doi.org/0.7783/kjmcs.203.2.4.268 봉화군청옥산에분포하는대한민국약전수재약용식물의분포특성

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii

More information

_KF_Bulletin webcopy

_KF_Bulletin webcopy 1/6 1/13 1/20 1/27 -, /,, /,, /, Pursuing Truth Responding in Worship Marked by Love Living the Gospel 20 20 Bible In A Year: Creation & God s Characters : Genesis 1:1-31 Pastor Ken Wytsma [ ] Discussion

More information

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI: 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 *

Journal of Climate Change Research 2017, Vol. 8, No. 3, pp DOI:   지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 * Journal of Climate Change Research 2017, Vol. 8, No. 3, pp. 201 211 DOI: http://dx.doi.org/10.15531/ksccr.2017.8.3.201 지리산국립공원세석지역의아고산관속식물상 노일 * 정재민 ** 조민기 *** 김태운 **** 문현식 **** * 국립공원관리공단내장산사무소, ** 국립수목원산림자원보존과,

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

untitled

untitled I 요약본 - 평화와 공동번영의 新동북아 시대를 위하여 - Ⅰ. 동북아 지역협력: 평화공동체의 비전과 가능성 1. 동아시아 평화공동체 가능한가? 2. 동아시아 평화공동체를 위한 노력 Ⅱ. 동북아시아 경제공동체의 가능성 모색: 한 일 중 3국 경제통합의 과제와 전망 1. 2. 3. 4. 5. 한 중 일 FTA 실현을 위한 각국의 입장 3국의 경제 교류 현황:

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

<B3EDB9AEC1FD5F3235C1FD2E687770>

<B3EDB9AEC1FD5F3235C1FD2E687770> 오용록의 작품세계 윤 혜 진 1) * 이 논문은 생전( 生 前 )에 학자로 주로 활동하였던 오용록(1955~2012)이 작곡한 작품들을 살펴보고 그의 작품세계를 파악하고자 하는 것이다. 한국음악이론이 원 래 작곡과 이론을 포함하였던 초기 작곡이론전공의 형태를 염두에 둔다면 그의 연 구에서 기존연구의 방법론을 넘어서 창의적인 분석 개념과 체계를 적용하려는

More information

에너지최종-수정(색변화)

에너지최종-수정(색변화) International Conference on Green House Gas Reduction & Energy Management 2011 November 23, 2011 Harmony Ballroom, InterContinental Seoul Coex Hosted by_ Ministry of Knowledge Economy Organized by_ Korea

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 손현덕 - 완도 목명과명출현종완도 (346114) 도엽특이사항영문한글영문한글학명국명 E2 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium ternatum 고사리삼 Filicales 고사리목 Osmundaceae 고비과 Osmunda japonica

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

¹Ìµå¹Ì3Â÷Àμâ

¹Ìµå¹Ì3Â÷Àμâ MIDME LOGISTICS Trusted Solutions for 02 CEO MESSAGE MIDME LOGISTICS CO., LTD. 01 Ceo Message We, MIDME LOGISTICS CO., LTD. has established to create aduance logistics service. Try to give confidence to

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽

발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽 울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를

More information

2 佛敎學報 第 48 輯 서도 이 목적을 준수하였다. 즉 석문의범 에는 승가의 일상의례 보다는 각종의 재 의식에 역점을 두었다. 재의식은 승가와 재가가 함께 호흡하는 공동의 場이므로 포 교와 대중화에 무엇보다 중요한 역할을 수행할 수 있다는 믿음을 지니고 있었다. 둘째

2 佛敎學報 第 48 輯 서도 이 목적을 준수하였다. 즉 석문의범 에는 승가의 일상의례 보다는 각종의 재 의식에 역점을 두었다. 재의식은 승가와 재가가 함께 호흡하는 공동의 場이므로 포 교와 대중화에 무엇보다 중요한 역할을 수행할 수 있다는 믿음을 지니고 있었다. 둘째 한국 근대불교의 대중화와 석문의범* 29)韓 相 吉 ** 차 례 Ⅰ. 머리말 1. 불자필람 의 구성 Ⅱ. 석문의범의 간행 배경 2. 석문의범 의 구성과 내용 1. 조선후기 의례집의 성행 Ⅳ. 근대불교 대중화와 석문의범 2. 근대불교 개혁론과 의례 Ⅲ. 석문의범의 체재와 내용 간행의 의미 Ⅴ. 맺음말 한글요약 釋門儀範 은 조선시대에 편찬된 각종 의례서와 의식집을

More information

09구자용(489~500)

09구자용(489~500) The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal

More information

Method Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood

More information

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770>

< D FBDC3C7E8BFACB1B8BAB8B0EDBCAD E687770> 어젠다코드 1-7 - 22 구 분 세부완결 기술분야코드 V1 기술유형코드 S04 작목구분코드 PG-03-PG31 과제종류 기관고유 세세부사업 - 연구과제및세부과제 수행기간 과제책임자및세부책임자 자생식물자원화기반구축 09~ 13 농식품연구소 김희연 식물기원추출물은행및생리활성 library 작성 09~ 13 농식품연구소 김희연 색인용어 자원식물, 추출물 ABSTRACT

More information

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado

Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: (LiD) - - * Way to

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI:   (LiD) - - * Way to Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.353-376 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.353 (LiD) -- * Way to Integrate Curriculum-Lesson-Evaluation using Learning-in-Depth

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의

韓資植誌 Korean J. Plant Res. 28(4) : 511~525(2015) 소, 기암 10개소, 계곡 4개소, 해변 1개소등 26개소의경관자원이있으며, 공원깃대종은소나무와원앙이다 (Korea National Park Service, 2013). 경주국립공원의 Korean J. Plant Res. 28(4):511-525(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.511 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 경주국립공원구미산지구에분포하는관속식물상 유주한 1 *, 권순영 2 1 동국대학교경주캠퍼스조경학과,

More information

04±èºÎ¼º

04±èºÎ¼º Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010

한실정이며, 초화류생육및식재후관리에관한연구또한옥상녹화, 실내조경등인공토양환경에서의연구가주를이루고있다. 외부공간에서의초화류생육에관한연구로는아파트단지내식재된지피식물의생육환경및관리현황 (Lee, 2006) 과상록성지피식물의이용확대를위한환경조건에따른생육비교 (Kim, 2010 J. Korean Soc. People Plants Environ. Vol. 18 No. 4: 257-263, August 2015 http://dx.doi.org/10.11628/ksppe.2015.18.4.257 ISSN 1226-9778(Print) ISSN 2287-8238(Online) 박은희 정명일 한승원 정나라 김재순 * 국립원예특작과학원원예작물부도시농업연구팀

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

μ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG

More information

소비형태보고서.PDF

소비형태보고서.PDF A0063-65610-57-0109 A Study on the Consumption Pattern and Pricing Structure of Major Oriental Medicines in Korea 2001. 5 : . 2001. 5. : : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : ( ) : (

More information

< FBDC4B9B05FC1BEB8F1B7CF2E786C73>

< FBDC4B9B05FC1BEB8F1B7CF2E786C73> 도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 안진갑 - 진도 목명과명출현종진도 (346101) 도엽특이사항영문한글영문한글학명국명 E2 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Ophioglossales 고사리삼목 Ophioglossaceae 고사리삼과 Botrychium

More information

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability 27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

옥천 일대의 지형

옥천  일대의  지형 1 임실 장수소권역일대의식생 임실 장수소권역일대의식생 - 내동산 - 성낙필 이윤택 하늘나무생태연구소 요약 1 본조사권역은관촌 (357061), 평장 (357062), 임실 (357063), 신창 (357064), 반암 (357073) 도엽의내동산 (887m) 평가단위로구성되며출현식물군락의유형은신갈나무군락 (Qm), 졸참나무군락 (Qs), 굴참나무군락 (Qv),

More information

7(4)-10.fm

7(4)-10.fm w» wz, 7«4y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 4, (2005), pp. 303~310 y 1 Á z 2 Á½ 1 1 w y w, 2 w w (2005 11 29 ; 2005 12 7 ) Vegetation Composition and Structure

More information