102.fm
|
|
- 진운 구
- 6 years ago
- Views:
Transcription
1 Journal of Asia-Pacific Biodiversity Vol. 6, No , The Vascular Plant Species in the Korean Demilitarized zone (DMZ) Chang Hyeon Lee 1, Hyun Tak Shin 2, Yeong Han Kwon 2, Myung Hoon Yi 1, Jung Won Yoon 1, Gi Song Kim 1, Gi Hwan Park 1 and Jung Won Sung 1 * 1 Department of landscape Architecture, Yeungnam University, Gyeonsan , Korea 2 Korea National Arboretum, Pocheon , Korea Abstract: The vascular plants identified in DMZ areas consist of 2,382 taxa: 159 families, 739 genera, 1,985 species, 11 subspecies, 306 varieties, 77 forma, and 3 hybrids. A total of 251 taxa were found to be rare plants in eastern area (172 taxa), central area (71 taxa), and western area (50 taxa). A total of 177 taxa were observed to be endemic plants in eastern area (109 taxa), central area (65 taxa), and western area (34 taxa). A total of 565 taxa were identified to be the floristic special plants, which were divided into five classes: class I (173 taxa), class II (87 taxa), class III (153 taxa), class IV (121 taxa), and class V (31 taxa). The identified taxa surveyed in eastern, central, and western area were 450, 232, and 159 taxa respectively. A total of 134 naturalized plants were recorded, and the naturalization rate and urbanization rate were identified as 5.6% and 41.7% respectively. 80 taxa were observed in eastern area, of which naturalization rate was 6.8% and urbanization rate was 24.9%. 84 taxa were recorded in central area, of which naturalization rate was 6.8% and urbanization rate was 26.1%. Finally, 54 taxa were observed in western area, of which naturalization rate was 5.1% and urbanization rate was 16.8%. Keywords: Vascular Plants, Rare Plants, Naturalized Plants, Endemic Plants Introduction A look at the current status and deterioration of biodiversity of the world indicates that approximately 14,000,000 species of creatures exist on the Earth. However, the number of biospecies surveyed over the past 250 years has amounted to about 17,500,000 species. Of the total, the estimated number of species amount to 10,600,000 species of animal, 2,500,000 species of both bacteria and mould, 300,000 species of plants, and 600,000 species of both protozoa and birds. In South Korea, it is estimated that more than 100,000 species live all over the country. Of these, the observed number of biospecies is 33,253 species in total, which consist of 21,168 species of animals, 4,130 species of plants, 2,078 species of fungi, 4,657 species of protists, and 1,219 species of prokaryotes (Ministry of Environment, 2009). DMZ dividing the Korean peninsula into two areas has had unique ecosystems under strict control for the last 50 years. DMZ has had well-preserved ecosystem where varied biodiversity has been inhabiting. The interdepartments, such as Ministry of Environment, Ministry of Unification, and International Council on Monuments and Sites (ICOMOS), have put in a great deal of effort for developing *To whom correspondence should be addressed. Tel: onsulove2036@hanmail.net domestic and foreign conventions for the protection of DMZ, including Transboundary Protected Areas (TBPAs), designation of DMZ as a UNESCO World Heritage Site, DMZ Eco-Peace Vision Announcement, Eco-Peace Belt in Korean peninsula, etc. Besides DMZ, Civilian Control Zone (CCZ), an area extending 5~20 kilometers to the south of DMZ s southern limit line, has made the habitat of DMZ and adjacent areas well conserved. Based on the flora of Korean peninsula, the areas belong to the middle province (Lee and Yim, 1978, 2002). In terms of vegetation formation by temperature zone, they are considered to be central areas (Yim, 1977). Research on the flora of DMZ areas has reported 536 taxa at the reclaimed area in Kimpo (Kim and Jung, 1995), 265 taxa on natural mashes in Wondae-ri (Park et al., 2000), 173taxa in Pocheon-gun area (Paik and Chung, 2000), 354 taxa of Mt. Baekam-san, Mt. Jaean-san and Mt. Il-san areas (Kim et al., 2001), 231 taxa in Sinseonbong (1,204 m) areas (Chang et al., 2003), 63 taxa (Kim et al., 2005) and 226 taxa (Ryu and Kim, 2006) at high moor in Mt. Dae-Am areas, 142 taxa (Choi and Na, 2007) and 511 taxa (Kim et al., 2010) in Mt. Moonsu (376 m), 287 taxa in Simjeok-ri areas (Kim et al., 2010), and 413 taxa in Mt. Gahyeon (Kim et al., 2011). Although a large body of research on the flora of DMZ has been conducted, most of the researches have focused mainly on the mountain areas which are safe and near military facilities. This is because previous researches had
2 32 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Fig. 1. Study area of DMZ. difficulty in the direct survey due to the spatial limitation. Even such researches had limitations on their access to the research sites because of the buried mines and security matters. Referring to previous researches, this study thus aims to investigate the current status of plant distributions in DMZ areas and its pattern in central area of Korean peninsula. Furthermore, the study also seeks to provide the fundamental research data on the future conservation and utilization of natural resources and vegetation succession in DMZ area. Materials and Methods This study investigates the current status of plant species inhabiting DMZ and inter-korean military border region, based on previous research data and references (Park, et al., 2000; Cha, et al., 2000; Korea Forest Research Institute, 2000; National Institute of Environmental Research, 2001; Park, 2002; Kang, 2003; Cultural Heritage Administration, 2003; Ministry of Environment, 2003; Ministry of Environment, 2004; Cultural Heritage Administration, 2004; Cultural Heritage Administration, 2006; Cultural Heritage Administration, 2007; Ministry of Environment, 2008; Ministry of Environment, 2009; Wonju Regional Environmental Office, 2009; Ministry of Environment, 2010a; b). Also, based on climate characteristics and physiographic features of mountains, rivers, and ocean, DMZ and its adjacent areas are divided into three areas: eastern area (Goseong-gun, Yanggu-gun, Inje-gun), central area (Hwacheon-gun, Cheorwon-gun, Yeoncheon-gun, Pocheon-gun), and western area (Paju-si, Goyang-si, Gimpo-si, Ganghwa-gun) (Fig. 1). The orders of flora is listed by Engler (Melchior, 1964) classification system. Genus and species in each family are arranged in alphabetical order. The list of scientific names are listed by Korean plant name index ( 2012). Rare plants are listed by Korea Forest Service and Korea National Arboretum (2008), and endemic plants are listed by Korea National Arboretum (2008). Specific plant species by floral region are classified by Kim (2000), and naturalized plants are classified by Lee et al. (2011). The urbanization index (Yim and Jeon, 1980) and the naturalization rate (Nemata, 1975) are calculated. Rare, endemic, and naturalized plants are classified and listed by areas (Appendix 1). Results The flora of vascular plants According to the findings from previous researches including eastern area (Park, et al., 2000; National Institute of Environmental Research, 2001; Cultural Heritage Administration, 2003; Cultural Heritage Administration, 2004; Cultural Heritage Administration, 2007; Wonju Regional Environmental Office, 2009), central area (Kang, 2003; Ministry of Environment, 2010a; b), western area (Cultural Heritage Administration, 2006), and other seven references, the vascular plants existing over DMZ areas include as follows: 125 taxa of pteridophyta (15 families, 41 genera, 118 species, 6 varieties, and 1 forma), 34 taxa of gymnosperms (6 families, 14 genera, 29 species, 3 varieties, and 2 forma), 2,223 taxa of angiosperms (138
3 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 33 Table 1. The number of vascular plants distributed in DMZ Taxa/system Fam Gen Sp. Subsp. Var. For. Hybr. Total Eastern Area Central Area Western Area DMZ Area (Total) families, 684 genera, 1,838 species, 11 subspecies, 297 varieties, 74 forma, and 3hybrids). A total of 2,382 taxa were identified, consisting of 159 families, 739 genera, 1,985 species, 11 subspecies, 306 varieties, 77 forma, and 3 hybrids (Table 1). This accounts for 48.8% of 4,881 taxa of vascular plants in total in Korean peninsula (Korea National Arboretum and The Plant Taxonomic Society of Korea, 2007). With regard to identification of families, Compositae was the largest (229 taxa) which represents 32% of the total plants, followed by Gramineae (172 taxa), Cyperaceae (139 taxa), Rosaceae (134 taxa), and Leguminosae (92 taxa). The flora of vascular plants by areas indicates that 1,861taxa were identified in the eastern area consisting of a total of 139 families, 612 genera, 1,573 species, 10 subspecies, 234 varieties, 42 forma, and 2 hybrids. 1,234 taxa were observed in the central area, consisting of a total of 120 families, 625 genera, 1064 species, 9 subspecies, 127 varieties, 33 forma, and 1 hybrids. Finally, 1,067 taxa were identified in the western area, consisting of a total of 131 families, 516 genera, 942 species, 7 subspecies, 105 varieties, and 13 forma. The finding from this research indicates that the observed number of taxa (2,382) was more than that of taxa from previous researches on flora in DMZ area: 1,597 taxa (Ministry of Environment, 2004) and 1,220 taxa (Yoo, 2010) (Appendix 1). The difference might result from the fact that quite a number of species had been excluded from the previous researches which surveyed plant species in DMZ areas without information about research period and section. Rare plants Rare plant is a group of biospecies inhabiting only certain restricted areas in terms of the geographical distribution of plants. Endangered plant is a group of plants which are vulnerable to endangerment of distribution from certain areas in the near future (Cultural Heritage Administration, 2004). Referred to Korea Forest Service and Korea National Arboretum (2008), the rare plants in DMZ areas were recorded to be a total of 251 taxa 71 families, 165 genera, 224 species, 4 subspecies, 22 varieties, and 1 forma (Table 2). With regard to plant species by category, Critically Endangered (CR) species were Lycopodium complanatum L., Asplenium trichomanes L. and Crypsinus veitchii (Baker) Copel (45 taxa). Endangered (EN) species were Paeonia lactiflora var. trichocarpa (Bunge) Stern, Rosa koreana Kom. and Daphne pseudomezereum var. koreana (Nakai) Hamaya (45 taxa). Vulnerable (VU) species were Thelypteris quelpaertensis (H.Christ) Ching, Polypodium vulgare L. and Ranunculus kazusensis Makino (62 taxa). Least Concerned (LC) species were Monotropa uniflora L., Utricularia racemosa Wall. and Campanula takesimana Nakai (54 taxa). Data Deficient (DD) species were Colysis elliptica (Thunb.) Ching, Rumex longifolius DC. and Ranunculus ternatus Thunb (48 taxa). This accounted for 23.7% of the total plants (2,382 taxa) surveyed in the research sites (Appendix 1). By area, a total of 172 taxa were identified in the eastern area consisting of 53 families, 124 genera, 156 species, 2 subspecies, 13 varieties, and 1 forma. A total of 71 taxa were observed in central area, consisting of 37 families, 59 genera, 63 species, 1 subspecies, and 7 varieties. Finally, in western area, a total of 50 taxa were identified, consisting of 32 families, 47 genera, 45 species, 1 subspecies, and 4 varieties. 19 common species were observed, including Gymnocarpium dryopteris (L.) Newman, Aristolochia contorta Bunge, Epimedium koreanum Nakai, etc. Moreover, the species observed only in eastern, central, and western areas were 109 species, 25 species, and 11 species, respectively. This indicated that rare plants were distributed the most largely in eastern area (Appendix 1). Fig. 2. Some important taxa in DMZ. (A: Arctous ruber (Rehder & E.H.Wilson) Nakai B: Aconitum coreanum (H.Lev.) Rapaics C: Cicuta virosa L D: Leontice microrhyncha S.Moore)
4 34 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Table 2. The list of rare plants investigated in DMZ Taxa/system Fam Gen Sp. Subsp. Var. For. Hybr. Total Eastern Area Central Area Western Area DMZ Area (Total) Endemic plants According to the vascular plants endemic to Korean peninsula (Oh et al., 2005), endemic plants inhabit uniquely a defined area. Since the endemic plant is the one having reached an evolutionary climax through evolution and adaptation under given environment, it becomes valuable data which can explain the defined area. Referring to the list of endemic plants in DMZ area (Korea National Arboretum, 2008), this study identified a total of 177 taxa, consisting of 49 families, 104 genera, 115 species, 41 varieties, and 21 forma (Table 3). This takes up 38% of endemic plants in South Korea. By area, a total of 109 taxa were observed in eastern area: 38 families, 71 genera, 77 species, 26 varieties, and 6 forma, including Clematis fusca var. coreana (H.Lev.&Vaniot) Nakai, Thalictrum actaefolium var. brevistylum Nakai, Sedum latiovalifolium Y.N.Lee, etc. In central area, a total of 65 taxa were found: 27 families, 49 genera, 48 species, 12 varieties, and 5 forma, including Vicia anguste-pinnata Nakai, Viola diamantiaca Nakai, Thalictrum rochebrunianum var. grandisepalum (H.Lev.) Nakai, etc. Finally, a total of 34 taxa were observed in western area: 20 families, 28 genera, 30 species, and 4 varieties. 13 common species were found, including Populus tomentiglandulosa T.B.Lee, Salix koriyanagi Kimura, Aconitum pseudolaeve Nakai, Clematis trichotoma Nakai, etc. Moreover, the numbers of species observed only in eastern, central, and western area were 64 species, 27 species, and 7 species, respectively. This indicated that endemic plants were distributed the most largely in eastern area (Appendix 1). The floristic special plants The floristic special plant refers to taxa, which makes a distinction between the different environments but explains the similar environments in a similar way (Kim et al., 2010). The classification of floral region according to plant distribution is based on Kim s (2000) five classes from class I (lowest conservation value) to V (highest conservation value). The special plants observed in DMZ area indicated that class I had 173 taxa including Calanthe discolor Lindl., Euphorbia pekinensis Rupr., and Dictamnus dasycarpus Turcz., class II had 87 taxa including Weigela florida (Bunge) A.DC., Iris ensata var. spontanea (Makino) Nakai, and Lilium distichum Nakai ex Kamib., class III had 153 taxa including Aristolochia manshuriensis Kom., Rhododendron brachycarpum D. Don ex G. Don, and Amsonia elliptica (Thunb.) Roem. & Schult., class IV had 121 taxa including Cimicifuga heracleifolia Kom., Sedum middendorffianum Maxim. and Sedum latiovalifolium Y.N.Lee, and class V had 31 taxa including Crypsinus hastatus (Thunb.) Copel., Paeonia obovata Maxim. and Pedicularis verticillata L., so the total was 565 taxa. They showed 23.7% appearance ratio compared with 2,382 taxa, the total plants appearing in the research sites (Appendix 1). The identified taxa surveyed in eastern, central, and western area were 450, 232, and 159 taxa respectively (Table 4). Naturalized plants The distribution of naturalized plants directly reflects the relative influence of ecosystem resulting from human disturbances. It also indicates the composition of existing flora and the competition relationship with wild plants (Kim, 2006). The number of naturalized plants in DMZ area were a total of 134 taxa: 27 families, 87 genera, 128 species, 3 varieties, and 3 forma, including Phytolacca americana L., Chenopodium album L., Rumex crispus L., Table 3. The list of the Korean endemic plants investigated in DMZ Taxa/system Fam Gen Sp. Subsp. Var. For. Hybr. Total Eastern Area Central Area Western Area DMZ Area(Total) Table 4. The list of specialized plant in DMZ Taxa/system Fam Gen Sp. Subsp. Var. For. I II III IV V Total Eastern Area Central Area Western Area DMZ Area (Total)
5 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 35 Table 5. The list of naturalized plants investigated in DMZ Taxa/system Fam Gen Sp. Subsp. Var. For. Hybr. Total Eastern Area Central Area Western Area DMZ Area Conyza canadensis (L.) Cronquist, and Coreopsis tinctoria Nutt.. The naturalization rate was 5.6% of the total taxa and the urbanization index was 41.7%. 29 common species were found including Trifolium pratense L., Euphorbia supina Raf., Oenothera biennis L. and Ambrosia artemisiifolia L.. Moreover, the numbers of species observed only in eastern, central, and western area were 3 species, 43 species, and 7 species, respectively. This indicated that naturalized plants were distributed the most largely in central area. With regard to identification of families, Compositae was the largest (38 taxa), followed by Gramineae (26 taxa), and Leguminosae (10 taxa). By area, a total of 80 taxa were observed in eastern area, consisting of 25 families, 58 genera, 78 species, and 2 varieties. The naturalization rate was 4.3% and urbanization index was 24.9%. In central area, a total of 84 taxa were identified, consisting of 16 families, 63 genera, 80 species, 1 varieties, and 3 forma. The naturalization rate was 6.8% and the urbanization index was 26.1%. Finally, a total of 54 taxa were observed in western area, consisting of 19 families, 45 genera, 53 species, and 1 varieties. The naturalization rate was 5.1%, and the urbanization index was 16.8% (Table 5). The findings indicate that the naturalization and urbanization rate might increase in the future because the DMZ areas have been used for military roads and military training camps. Furthermore, invasive alien plants (Ministry of Environment, 2009), including Rumex acetosella L., Aster pilosus Willd., Ambrosia artemisiifolia L. and Ambrosia trifida L., have been widely distributed around certain military facilities, so the relevant countermeasures are required. Discussion Summary Since previous researches and references had a number of missing data of research period and had limited research sites, it has been difficult to survey the whole plant species. Hence, this study aims to investigate the plants species in DMZ area, based on 17 references. The vascular plants identified in DMZ areas consist of 2,382 taxa: 159 families, 739 genera, 1,985 species, 11 subspecies, 306 varieties, 77 forma, and 3 hybrids. A total of 251 taxa were found to be rare plants. 19 common species were observed, including Gymnocarpium dryopteris (L.) Newman, Aristolochiacontorta Bunge, Epimedium koreanum Nakai, etc. Moreover, the species observed only in eastern, central, and western areas were 109 species, 25 species, and 11 species, respectively. A total of 177 taxa were observed to be endemic plants in eastern area (109 taxa), central area (65 taxa), and western area (34 taxa). 13 common species were found, including Populus tomentiglandulosa T.B.Lee, Salix koriyanagi Kimura, Aconitum pseudolaeve Nakai, Clematis trichotoma Nakai, etc. Moreover, the numbers of species observed only in eastern, central, and western area were 64 species, 27 species, and 7 species, respectively. Overall, more plant species were observed in eastern area than those in central and western area. This might result from the plant distribution of mountainous terrain area is larger than that of western and central area. Also, it is considered to be significantly affecting the distribution of vegetation due to thick topsoil, deep snowfall, and high humidity. A total of 565 taxa were identified to be the floristic special plants, which were divided into five classes: class I (173 taxa), class II (87 taxa), class III (153 taxa), class IV (121 taxa), and class V (31 taxa). By area, the identified taxa surveyed in eastern, central, and western area were 450, 232, and 159 taxa respectively. The number of naturalized plants in DMZ area were a total of 134 taxa: 27 families, 87 genera, 128 species, 3 varieties, and 3 forma. The naturalization rate was 5.6%. This shows contrasting results, compared to existing references. Recently, the naturalized plants in South Korea have been reported to be 286 taxa (Park, 2009) or 321 taxa (Lee et al., 2011). This indicates that the naturalized plants have increased consistently. By area, 80 taxa were observed in eastern area, of which naturalization rate was 6.8% and urbanization rate was 24.9%. 84 taxa were recorded in central area, of which naturalization rate was 5.1% and urbanization rate was 26.1%. Finally, 54 taxa were observed in western area, of which naturalization rate was 5.1% and urbanization rate was 16.8%. Suggestion The vegetation and the distribution of plants benefit from limited civilian access to the DMZ and its adjacent areas. Nevertheless, if they are interrupted by naturalized plants and lose its naturalness, the disconnection of the ecosystem may be expected. If this phenomenon continues, the succession of southern and northern plants can be problematic. Thus, reasonable measures are required to address these potential problems. Due to the recent drastic urbanization in progress, naturalized plants, such as Ambrosia artemisiifolia L.,
6 36 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Ambrosia trifida L., Asterpilosus Willd., have drastically increased. Asaresult, wild plants have decreased more and more and the distribution area of naturalized plants has been expanding. Therefore, the development of DMZ area needs to be minimized, and also we should put every effort into maintaining its current state through the natural restoration of vegetation and succession process. Acknowledgments This research was supported by a research grant for the development of exploration, collection, and conservation of DMZ and northern plants. References Cha, J.H., B.W. Kim and S.H. Je, 2000, plant ecology of DMZ, yemundang Publishing Co, Seoul, Korea, 550 pp (in Korean). Chang, K.S., C.S. Chang., H. Kim and U. Kang, 2003, Flora of Mt. Sin-sun-bong of Gangwon Province, Bull. of Seoul Nat l Univ. Arboretum 23: (in Korean). Choi, H.K and H.R. Na, 2007, The flora of Tongjin (Mt. Munsu). 3rd National Natural Environment Survey. Ministry of Environment, 5 pp (in Korean). Cultural Heritage Administration, 2003, A report on Daeamsan and Daewoosan Natural Reserve, Korea, 297 pp. Cultural Heritage Administration, 2004, A report on Hyangrobong and Geonbongsan Natural Reserve, Korea, 245 pp. Cultural Heritage Administration, 2006, A report on natural heritage foundation resource in border region of South and North Korea (Western region), 463 pp. Cultural Heritage Administration, 2007, A report on natural heritage foundation resource in border region of South and North Korea (Eestern region), 378 pp. Kang, D.S. 2003, Flora of northern region in Gyeonggi-Province, daejin Univ., Gyeonggi-do, Korea (in Korean). Kim, J.W and Y.K. Jung, 1995, Floral analysis in the Kimpo landfills and its peripheral region. Korea J. Ecol. 18(1): (in Korean). Kim, C.H., 2000, Assessment of natural environment - I, selection of plant taxa -. J. Korea. Environ. Biol. 18(1): (in Korean). Kim, D.K., J.H. Do, H.L. Kim and J.H. Kim, 2001, A study on the flora of Mt. Baekam-san, Mt. Jaean-san and Mt. Il-san. Natural Science (Daejeon University) 12(2): (in Korean). Kim, B.W., J.S. Lee and Y.J. Oh, 2005, A Study on the Flora in the Mt. Daeam high moor. Journal of Environmental Science. 11(1): 1-18 (in Korean). Kim, H.S, 2006, Ecological Studies on the Changes of Community of Naturalized Plants in Limja Island, Shinan Gun, Korea. J. Plant Res. 19(5): (in Korean). Kim, J.H., J.R. Park, S.H. Kim and C.Y. Yoon, 2011, The vascular plants in Mt. Gahyeon (Gyeonggi-do, Gimpo). Korean J. Plant Res. 24(5): (in Korean). Kim, J.H., G.H. Nam, C.Y. Yoon and B. Y. Lee The vascular plants in Mt. Munsu (Gyeonggi-do). Journal of the Environmental Sciences 19(4): (in Korean). Kim. J.H., J.Y. Lee, B.Y. Lee., C.Y. Yoon and M.H. Kim, 2010, The vascular plants in Mt. Gaji (Gyeongsangnam-do). J. Kor. Plant Res. 23(4): (in Korean). Kim, N.J., N.Y. Kim., Y.S. Kim., H.B Lee., Y.S. Kim and W.K. Park, 2011, Flora study of Simjeok swamp in Sohwa-myon, Inje-gun. Korean Forest Society pp (in Korean). Korea Forest Research Institute, 2000, A forest ecosystem survey report of the DMZ and neighboring region, 625 pp (in Korean). Korea National Arboretum and The Plant Taxonomic Society of Korea, 2007, A Synonymic list of vascular plantsbin Korea. Korea National Arboretum, Pocheon, 534 pp. Korea Forest Service and Korea National Arboretum, 2008, Rare plants data book in Korea. Geobook, Pocheon, 332 pp. Korea National Arboretum, 2008, Endemic Vascular Plants in the Korean Peninsula. 205 pp. Korea National Arboretum, 2009, Rare plants data book of Korea, Geobook Publishing Co., Seoul, Korea. 332 pp. Korean Plant Names Index, 2012, Lee, Y.N., S.H. Park, S.Y. Jing, S.H. Oh and J.C. Yang, 2011, Study on the current status of naturalized plants in South Korea. Korean J. Pl. Taxon. 41(1): (in Korean). Lee, W.T and Y.J. Yim, 1978, Studies on the distribution of vascular plants in the Korea Peninsula. Korean J. Pl. Taxon. 8 (Appendix). pp (in Korean). Lee, W.T and Y.J. Yim, 2002, Plant Geography with special reference to Korea. Kangwon National University Press, Chuncheon, 412 pp (in Korean). Melchior, H. 1964, An Engler Syllabus der pflanzenfamilien. Band Ⅱ. Gebruder Borntraeger, Berlin, 666 pp. Ministry of Environment, 2003, An ecological survey report of DMZ area, 256 pp. Ministry of Environment, 2004, Ecosystem approach for the investigation, analysis and impact assessment of demilitarized zone of Korea, 603 pp. Ministry of Environment, 2008, Korean nationwide survey on natural environments 318 pp. Ministry of Environment, 2009, Ecosystem disturbance wild animals and plants package. pp Ministry of Environment, 2009, A study on establishing the protected area managerial boundary of the DMZ area, 170 pp. Ministry of Environment, 2010, A report on the survey state of ecosystem in middle area of DMZ, 286 pp. National Institute of Environmental Research, 2001, DMZ neighboring region (Goseong-gun) nature ecosystem survey report, 145 pp. Nemata, M. 1975, Naturalized plants. Dainippon-tosho, 160 pp. Oh, B.U., D.G. Jo., K.S. Kim and C.G. Jang, 2005, Endemic vascular plants in the Korea peninsula, Korean National Arboretum, Pocheon, 205 pp. (in Korean) Paik, W.K and Y.J. Chung, 2000, The flora of Pocheon Stream. daejin Univ., Gyeonggi-do, Korea (in Korean). Park, K.S, 2002, A study on the flora and vegetation in civilian control line area (Hyangro-Bong, Chiljeol-Bong, Mt. Mae- Bong in Inje-gun, Kangwon-do), Kangwon Univ., Kangwondo, Korea (in Korean). Park, W.G., S.I. Yoo and K.S. Park, 2000, Flora of natural mashes in Wondae-ri (Inje-gun, Kangwon-do), J. For. Sci., Kangwon Nat l Univ., No. 16: (in Korean). Park, S.H, 2009, New illustration and photoshop of naturalizes plants of Korea. Ilchokak, 575 pp (in Korean). Ryu, S.H and S.D. Kim, 2006, The Flora of Yong-Neup and Vegetation distribution of high moor in Mt. Daeamsan. Kor. J. Env. Eco pp (in Korean). Wonju Regional Environmental Office, 2009, The flora and founa of Yongnup, Daeamsan, 297 pp. Yim, Y.J, 1977, Distribution of forest vegetation and climate in Korean peninsula. IV. Zonal distribution of forest vegetation
7 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 37 in relation to thermal climate. Japanse. J. Ecol. 27(3): (in Korean). Yim, Y.J. and E.S. Jeon, 1980, Distribution of naturalized plants in the Korean peninsula. Korea Jour. Botany 23: Yoo, G.E, 2010, Plant resources of de-militarized zone area in Korea, The Korean Association of International Studies, 2010(8): (in Korean). Received: 3. Feb Revised: 28. Feb / 12. Mar Accepted: 13. Mar. 2013
8 38 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Appendix 1. The list of vascular plants in DMZ 석송과 Lycopodiaceae Lycopodium annotinum L. 개석송 4 Lycopodium chinense H.Christ 다람쥐꼬리 2 Lycopodium clavatum L. 석송 Lycopodium complanatum L. 비늘석송 CR 3 Lycopodium cryptomerinum Maxim. 왕다람쥐꼬리 EN 3 Lycopodium obscurum L. 만년석송 2 Lycopodium selago L. 좀다람쥐꼬리 EN 4 Lycopodium serratum Thunb. 뱀톱 부처손과 Selaginellaceae Selaginella involvens (Sw.) Spring 바위손 Selaginella rossii (Baker) Warb. 구실사리 Selaginella tamariscina (P.Beauv.) Spring 부처손 속새과 Equisetaceae Equisetum arvense L. 쇠뜨기 Equisetum hyemale L. 속새 1 Equisetum palustre L. 개쇠뜨기 3 Equisetum pratense Ehrh. 물쇠뜨기 3 Equisetum ramosissimum Desf. 개속새 고사리삼과 Ophioglossaceae Botrychium strictum Underw. 긴꽃고사리삼 Botrychium virginianum (L.) Sw. 늦고사리삼 LC 1 Sceptridium japonicum (Prantl) Lyon 산꽃고사리삼 Sceptridium ternatum (Thunb.) Lyon 고사리삼 고비과 Osmundaceae Osmunda cinnamomea var. forkiensis Copel. 꿩고비 Osmunda claytoniana L. 음양고비 3 Osmunda japonica Thunb. 고비 처녀이끼과 Hymenophyllaceae Crepidomanes insigne (Bosch) Fu. 괴불이끼 4 Crepidomanes minutum (Blume) K.Iwats. 부채괴불이끼 2 고사리과 Pteridaceae Cheilanthes argentea (Gmel.) G.Kunze 부싯깃고사리 Coniogramme intermedia Hieron. 고비고사리 Coniogramme japonica (Thunb.) Diels 가지고비고사리 Cystopteris sudetica A. Braun & Milde 바람고사리 lypodium virginianum L. 좀미역고사리 잔고사리과 Dennstaedtiaceae Dennstaedtia hirsuta (Sw.) Mett. ex Miq. 잔고사리 Dennstaedtia wilfordii (T.Moore) H.Christ 황고사리 Deparia conilii (Franch. & Sav.) M.Kato 좀진고사리 Deparia coreana (H.Christ) M.Kato 곱새고사리 Deparia japonica (Thunb.) M.Kato 진고사리 Deparia pterorachis (H.Christ) M.Kato 왕고사리 Deparia pycnosora (H.Christ) M.Kato 털고사리 Deparia viridifrons (Makino) M.Kato 푸른개고사리 Gymnocarpium dryopteris (L.) Newman 토끼고사리 DD 2 Lepisorus onoei (Franch. & Sav.) Ching 애기일엽초 Lepisorus thunbergianus (Kaulf.) Ching 일엽초 Lepisorus ussuriensis (Regel & Maack) Ching 산일엽초 Microlepia marginata (Panz.) C.Chr. 돌잔고사리 4 넉줄고사리과 Davalliaceae Davallia mariesii T.Moore ex Baker 넉줄고사리 Thelypteris acuminata (Houtt.) C.V.Morton 별고사리 1 Thelypteris decursivepinnata (H.C.Hall) Ching 설설고사리 Thelypteris glanduligera (Kunze) Ching 사다리고사리 1 Thelypteris japonica (Baker) Ching 지네고사리 Thelypteris laxa (Franch. & Sav.) Ching 드문고사리 1 Thelypteris nipponica (Franch. & Sav.) Copel. 키다리처녀고사리 3
9 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 39 Thelypteris palustris (Salisb.) Schott 처녀고사리 Thelypteris phegopteris (L.) Sloss. 가래고사리 2 Thelypteris quelpaertensis (H.Christ) Ching 큰처녀고사리 VU Thelypteris torresiana var. calvata (Baker) K.Iwats. 각시고사리 2 Woodsia ilvensis (L.) R.Br. 두메우드풀 4 Woodsia macrochlaena Mett. ex Kuhn 참우드풀 Woodsia manchuriensis Hook. 만주우드풀 Woodsia polystichoides D.C.Eaton 우드풀 Woodsia subcordata Turcz. 산우드풀 비고사리과 Lindsaeaceae Adiantum pedatum L. 공작고사리 VU 2 Pleurosoriopsis makinoi (Maxim. ex Makino) Fomin 좀고사리 2 Sphenomeris chinensis (L.) Maxon 바위고사리 1 꼬리고사리과 Aspleniaceae Asplenium incisum Thunb. 꼬리고사리 Asplenium ruprechtii Sa.Kurata 거미고사리 1 Asplenium sarelii Hook. 돌담고사리 1 Asplenium trichomanes L. 차꼬리고사리 CR Asplenium varians Wall. ex Hook. & Grev. 애기꼬리고사리 Athyrium acutipinnulum Kodama ex Nakai 섬고사리 Athyrium brevifrons Kodama ex Nakai 참새발고사리 Athyrium concinnum Nakai 광릉개고사리 Athyrium distentifolium Tausch ex Opiz 산고사리 Athyrium fauriei Makino 산뱀고사리 Athyrium iseanum Rosenst. 가는잎개고사리 Athyrium koryoense Tagawa 그늘개고사리 Athyrium melanolepis (Franch. & Sav.) Christ 북새발고사리 Athyrium nakaii Tagawa 강원고사리 Athyrium niponicum (Mett.) Hance 개고사리 Athyrium spinulosum (Maxim.) Milde 두메개고사리 VU Athyrium vidalii (Franch. & Sav.) Nakai 산개고사리 Athyrium yokoscense (Franch. & Sav.) H.Christ 뱀고사리 Diplazium mesosorum (Makino) Koidz. 큰개고사리 DD 3 Diplazium sibiricum (Turcz. ex Kunze) Rupr. 두메고사리 3 Pteridium aquilinum var. latiusculum (Desv.) Underw. ex Hell. 고사리 Pteris multifida Poir. 봉의꼬리 1 면마과 Dryopteridaceae Arachniodes borealis Seriz. 왁살고사리 Arachniodes rhomboidea (Wall.) Tindale 쇠고사리 1 Dryopteris chinensis (Baker) Koidz. 가는잎족제비고사리 Dryopteris crassirhizoma Nakai 관중 Dryopteris cycadina (Franch. & Sav.) C.Chr. 톱지네고사리 EN 4 Dryopteris expansa (C.Presl) Fraser-Jenk. & Jermy 퍼진고사리 2 Dryopteris fragrans var. remotiuscula (Kom.) Fomin 주저리고사리 Dryopteris gymophylla (Baker) C.Chr. 금족제비고사리 3 Dryopteris hikonensis (H.Ito) Nakaike 큰족제비고사리 Dryopteris lacera (Thunb.) Kuntze 비늘고사리 Dryopteris laeta (Kom.) C.Chr. 바위틈고사리 VU Dryopteris maximowiczii (Baker) Kuntze 진저리고사리 3 Dryopteris monticola (Makino) C.Chr. 왕지네고사리 Dryopteris polylepis (Franch. & Sav.) C.Chr. 산비늘고사리 4 Dryopteris sacrosanta Koidz. 애기족제비고사리 Dryopteris saxifraga H.Ito 바위족제비고사리 Dryopteris tokyoensis (Matsum. ex Makino) C.Chr. 느리미고사리 VU 3 Dryopteris uniformis (Makino) Makino 곰비늘고사리 Dryopteris varia (L.) Kuntze 족제비고사리 Matteuccia struthiopteris (L.) Tod. 청나래고사리 1 Onoclea orientalis (Hook.) Hook. 개면마 Onoclea sensibilis var. interrupta Maxim. 야산고비
10 40 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung 고란초과 Polypodiaceae Colysis elliptica (Thunb.) Ching 손고비 DD 3 Cornopteris crenulatoserrulata (Makino) Nakai 응달고사리 Crypsinus hastatus (Thunb.) Copel. 고란초 LC 5 Crypsinus veitchii (Baker) Copel. 층층고란초 CR 4 Cyrtomium falcatum (L.f.) C.Presl 도깨비쇠고비 Cyrtomium fortunei J.Sm. 쇠고비 1 Polypodium vulgare L. 미역고사리 VU 3 Polystichum braunii (Spenn.) Fee 좀나도히초미 Polystichum craspedosorum (Maxim.) Diels 낚시고사리 2 Polystichum ovatopaleaceum var. coraiense (H.Christ) Sa.Kurata 참나도히초미 1 Polystichum polyblepharum (Roem. ex Kunze) C.Presl 나도히초미 Polystichum tripteron (Kunze) C.Presl 십자고사리 Polystichum tripteron for. subpinnatum H.Ito 큰십자고사리 Pyrrosia linearifolia (Hook.) Ching 우단일엽 Pyrrosia petiolosa (H.Christ & Baroni) Ching 애기석위 3 네가래과 Marsileaceae Marsilea quadrifolia L. 네가래 생이가래과 Salviniaceae Azolla imbricata (Roxb.) Nakai 물개구리밥 Azolla japonica Franch. & Sav. 큰물 개구리밥 Salvinia natans (L.) All. 생이가래 은행나무과 Ginkgoaceae Ginkgo biloba L. 은행나무 소나무과 Pinaceae Abies holophylla Maxim. 전나무 1 Abies koreana Wilson 구상나무 LC 3 Abies nephrolepis (Trautv.) Maxim. 분비나무 3 Cedrus deodara (Roxb.) Loudon 개잎갈나무 Larix kaempferi (Lamb.) Carriere 일본잎갈나무 Picea abies (L.) H.Karst. 독일가문비 Picea jezoensis (Siebold & Zucc.) Carriere 가문비나무 VU 3 Pinus densiflora for. erecta Uyeki 금강소나무 Pinus densiflora for. multicaulis Uyeki 반송 Pinus densiflora Siebold & Zucc. 소나무 Pinus koraiensis Siebold & Zucc. 잣나무 1 Pinus parviflora Siebold & Zucc. 섬잣나무 4 Pinus pumila (Pall.) Regel 눈잣나무 CR 4 Pinus rigida Mill. 리기다소나무 Pinus strobus L. 스트로브잣나무 Pinus taeda L. 테에다소나무 Pinus thunbergii Parl. 곰솔 낙우송과 Taxodiaceae Metasequoia glyptostroboides Hu & Cheng 메타세콰이아 Taxodium distichum (L.) Rich. 낙우송 측백나무과 Cupressaceae Chamaecyparis pisifera (Siebold & Zucc.) Endl. 화백 Juniperus chinensis Globosa 둥근향나무 Juniperus chinensis L. 향나무 3 Juniperus chinensis var. procumbens (Siebold) Endl. 섬향나무 Juniperus chinensis var. sargentii Henry 눈향나무 EN 2 Juniperus rigida Siebold & Zucc. 노간주나무 Thuja koraiensis Nakai 눈측백 VU 4 Thuja occidentalis Aurea Group 황금서양측백 Thuja occidentalis L. 서양측백나무 Thuja orientalis L. 측백나무 LC 4 개비자나무과 Cephalotaxaceae Cephalotaxus koreana Nakai 개비자나무 1
11 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 41 주목과 Taxaceae Taxus baccata var. latifolia Nakai 회솔나무 VU Taxus cuspidata Siebold & Zucc. 주목 VU 2 Torreya nucifera (L.) Siebold & Zucc. 비자나무 1 가래나무과 Juglandaceae Juglans mandshurica Maxim. 가래나무 1 Juglans regia Dode 호두나무 Platycarya strobilacea Siebold & Zucc. 굴피나무 Pterocarya stenoptera DC. 중국굴피나무 버드나무과 Salicaceae Populus alba L. 은백양 Populus davidiana Dode 사시나무 1 Populus deltoides Marsh. 미루나무 Populus glandulosa Uyeki 수원사시나무 Populus koreana Rehder 물황철나무 Populus maximowiczii A.Henry 황철나무 4 Populus nigra var. italica Koehne 양버들 Populus simonii Carriere 당버들 Populus tomentiglandulosa T.B.Lee 은사시나무 Salix babylonica L. 수양버들 Salix blinii H. Lev. 제주산버들 CR 4 Salix caprea L. 호랑버들 Salix chaenomeloides Kimura 왕버들 1 Salix dependens Nakai 개수양버들 Salix divaricata var. metaformosa (Nakai) Kitag. 눈산버들 Salix gilgiana Seem. 내버들 Salix graciliglans Nakai 눈갯버들 Salix gracilistyla Miq. 갯버들 Salix hallaisanensis H.Lev. 떡버들 Salix hallaisanensis var. longifolia Nakai 긴잎떡버들 Salix integra Thunb. 개키버들 Salix koreensis Andersson 버드나무 Salix koriyanagi Kimura 키버들 Salix matsudana for. tortuosa Rehder 용버들 Salix maximowiczii Kom. 쪽버들 4 Salix pentandra L. 반짝버들 Salix pseudolasiogyne H. Lev. 능수버들 Salix purpurea var. smithiana Trautv. 당키버들 3 Salix rorida Laksch. 분버들 3 Salix rorida var. roridaeformis (Nakai) Ohwi 좀분버들 Salix sericeocinerea Nakai 큰산버들 Salix siuzevii Seem. 참오굴잎버들 3 Salix subfragilis Andersson 선버들 Salix xerophila Flod. 여우버들 3 Salix xerophila for. glabra (Nakai) Kitag. 유가래나무 자작나무과 Betulaceae Alnus borealis Koidz. 떡오리나무 Alnus firma Siebold & Zucc. 사방오리 Alnus japonica (Thunb.) Steud. 오리나무 Alnus japonica var. koreana Callier 털오리나무 Alnus mandshurica (Callier) Hand.-Mazz. 덤불오리나무 4 Alnus maximowiczii Callier 두메오리나무 4 Alnus pendula Matsum. 좀사방오리 Alnus sibirica Fisch. ex Turcz. 물오리나무 Betula chinensis Maxim. 개박달나무 3 Betula costata Trautv. 거제수나무 3 Betula davurica Pall. 물박달나무 3 Betula ermanii Cham. 사스래나무 2 Betula fruticosa Pall. 좀자작나무
12 42 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Betula platyphylla var. japonica (Miq.) Hara 자작나무 Betula schmidtii Regel 박달나무 1 Carpinus cordata Blume 까치박달 Carpinus laxiflora (Siebold & Zucc.) Blume 서어나무 Carpinus laxiflora var. longispica Uyeki 긴서어나무 Carpinus tschonoskii Maxim. 개서어나무 Carpinus turczaninovii Hance 소사나무 Carpinus turczaninovii var. arguta Uyeki 좀산서어나무 Corylus hallaisanensis Nakai 병개암나무 Corylus heterophylla Fisch. ex Trautv. 개암나무 Corylus sieboldiana Blume 참개암나무 Corylus sieboldiana var. mandshurica (Maxim. & Rupr.) C.K.Schneid. 물개암나무 참나무과 Fagaceae Castanea crenata Siebold & Zucc. 밤나무 Castanea crenata var. kusakuri (Blume) Nakai 산밤나무 Quercus dentatomongolica Nakai 떡신갈나무 Quercus mccormickii Carruth. 떡갈참나무 Quercus acuta Thunb. ex Murray 붉가시나무 1 Quercus acutissima Carruth. 상수리나무 Quercus aliena Blume 갈참나무 Quercus aliena var. acuteserrata Maxim. 졸갈참나무 Quercus aliena var. pellucida Blume 청갈참나무 Quercus dentata Thunb. ex Murray 떡갈나무 Quercus dentata var. fallax Nakai 청떡갈나무 Quercus mongolica Fisch. ex Ledeb. 신갈나무 Quercus mongolica var. crispula (Blume) H.Ohashi 물참나무 Quercus mongolica var. liatungensis (Koidz.) Nakai 깃참나무 Quercus serrata Thunb. ex Murray 졸참나무 Quercus variabilis Blume 굴참나무 1 Quercus xurticaefolia Blume 갈졸참나무 느릅나무과 Ulmaceae Aphananthe aspera (Thunb.) Planch. 푸조나무 1 Celtis aurantiaca Nakai 산팽나무 3 Celtis biondii Pamp. 폭나무 1 Celtis bungeana Blume 좀풍게나무 3 Celtis choseniana Nakai 검팽나무 LC Celtis edulis Nakai 노랑팽나무 DD Celtis jessoensis Koidz. 풍게나무 Celtis koraiensis Nakai 왕팽나무 Celtis sinensis Pers. 팽나무 Hemiptelea davidii (Hance) Planch. 시무나무 1 Ulmus davidiana Planch. 당느릅나무 3 Ulmus davidiana var. japonica (Rehder) Nakai 느릅나무 Ulmus laciniata (Trautv.) Mayr 난티나무 2 Ulmus macrocarpa Hance 왕느릅나무 4 Ulmus parvifolia Jacq. 참느릅나무 1 Ulmus pumila L. 비술나무 4 Zelkova serrata (Thunb.) Makino 느티나무 뽕나무과 Moraceae Broussonetia kazinoki Siebold 닥나무 Broussonetia papyrifera (L.) L'Her. ex Vent. 꾸지나무 Cudrania tricuspidata (Carr.) Bureau ex Lavallee 꾸지뽕나무 Fatoua villosa (Thunb.) Nakai 뽕모시풀 Ficus carica L. 무화과나무 Morus alba L. 뽕나무 Morus bombycis for. dissecta Nakai ex Mori 가새뽕나무 Morus bombycis Koidz. 산뽕나무 Morus bombycis var. maritima Koidz. 섬뽕나무 Morus mongolica (Bureau) C.K.Schneid. 몽고뽕나무
13 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 43 물 삼과 Cannabaceae Cannabis sativa L. 삼 Humulus japonicus Sieboid & Zucc. 환삼덩굴 쐐기풀과 Urticaceae Boehmeria longispica Steud. 왜모시풀 Boehmeria nivea (L.) Gaudich. 모시풀 Boehmeria pannosa Nakai & Satake 왕모시풀 Boehmeria platanifolia Franch. & Sav. 개모시풀 Boehmeria sieboldiana Blume 긴잎모시풀 Boehmeria spicata (Thunb.) Thunb. 좀깨잎나무 Boehmeria tricuspis (Hance) Makino 거북꼬리 Boehmeria tricuspis var. unicuspis Makino 풀거북꼬리 Girardinia cuspidata Wedd. 큰쐐기풀 3 Laportea bulbifera (Siebold & Zucc.) Wedd. 혹쐐기풀 Parietaria micrantha Ledeb. 개물 통이 Pilea hamaoi Makino 큰물 통이 Pilea japonica (Maxim.) Hand.-Mazz. 산물 통이 Pilea mongolica Wedd. 모시물 통이 Pilea peploides (Gaudich.) Hook. & Arn. 통이 Urtica angustifolia Fisch. ex Hornem. 가는잎쐐기풀 1 Urtica laetevirens Maxim. 애기쐐기풀 Urtica thunbergiana Siebold & Zucc. 쐐기풀 단향과 Santalaceae Thesium chinense Turcz. 제비꿀 Thesium refractum C.A.Mey. 긴제비꿀 3 겨우살이과 Loranthaceae Loranthus tanakae Franch. & Sav. 꼬리겨우살이 EN 2 Taxillus yadoriki (Siebold ex Maxim.) Danser 참나무겨우살이 CR Viscum album var. coloratum (Kom.) Ohwi 겨우살이 마디풀과 Polygonaceae Aconogonon alpinum (All.) Schur 싱아 Aconogonon divaricatum (L.) Nakai 왜개싱아 Aconogonon microcarpum (Kitag.) H. Hara 참개싱아 4 Aconogonon mollifolium (Kitag.) H. Hara 얇은개싱아 Bistorta manshuriensis (Petrov ex Kom.) Kom. 범꼬리 1 Bistorta pacifica (Petrov ex Kom.) Kom. 참범꼬리 Bistorta vivipara for. roessleri (G.B.Mannageta) Kitag. 털씨범꼬리 Botrychium virginianum (L.) Sw. 명아자여뀌 Fagopyrum esculentum Moench 메밀 Fallopia ciliinervis (Nakai) Hammer 나도하수오 Fallopia convolvulus (L.) A.Love 나도닭의덩굴 Fallopia dentatoalata (F.Schmidt) Holub 큰닭의덩굴 Fallopia dumetorum (L.) Holub 닭의덩굴 Fallopia japonica (Houtt.) RonseDecr. 호장근 Fallopia multiflora (Thunb.) Haraldson 하수오 Persicaria breviochreata (Makino) Ohwi 긴화살여뀌 Persicaria bungeana (Turcz.) Nakai 바늘여뀌 Persicaria conspicua (Nakai) Nakai 꽃여뀌 Persicaria debilis (Meisn.) H.Gross 세뿔여뀌 Persicaria dissitiflora (Hemsl.) H.Gross 가시여뀌 Persicaria erectominor var. koreensis (Nakai) I.Ito 대동여뀌 Persicaria filiformis (Thunb.) Nakai 이삭여뀌 Persicaria hastatosagittata (Makino) Nakai ex Mori 긴미꾸리낚시 Persicaria hydropiper (L.) Spach 여뀌 Persicaria japonica (Meisn.) H.Gross 흰꽃여뀌 Persicaria lapathifolia (L.) Gray 흰여뀌 Persicaria lapathifolia var. salicifolia Miyabe 솜흰여뀌 Persicaria longiseta (Bruijn) Kitag. 개여뀌 Persicaria maackiana (Regel) Nakai 나도미꾸리낚시
14 44 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Persicaria muricata (Meisn.) Nemoto 넓은잎미꾸리낚시 Persicaria nepalensis (Meisn.) H.Gross 산여뀌 Persicaria orientalis (L.) Spach 털여뀌 Persicaria perfoliata (L.) H.Gross 며느리배꼽 Persicaria posumbu var. laxiflora (Meisn.) H. Hara 장대여뀌 Persicaria praetermissa (Hook.f.) Hara 좁은잎미꾸리낚시 Persicaria pubescens (Blume) H.Hara 바보여뀌 Persicaria sagittata (L.) H.Gross ex Nakai 미꾸리낚시 Persicaria senticosa (Meisn.) H.Gross 며느리밑씻개 Persicaria sieboldii var. aestiva Ohki 민미꾸리낚시 Persicaria thunbergii (Siebold & Zucc.) H.Gross ex Nakai 고마리 Persicaria trigonocarpa (Makino) Nakai 가는개여뀌 Persicaria viscofera (Makino) Nakai 끈끈이여뀌 Persicaria viscofera var. robusta (Makino) Hiyama 큰끈끈이여뀌 Persicaria viscosa (Hamilt. ex D.Don) H.Gross ex D.Don 기생여뀌 Persicaria vulgaris Webb & Moq. 봄여뀌 Polygonum aviculare L. 마디풀 Rheum rhabarbarum L. 대황 Rumex acetosa L. 수영 Rumex acetosella L. 애기수영 Rumex aquaticus L. 토대황 Rumex conglomeratus Murray 묵밭소리쟁이 Rumex crispus L. 소리쟁이 Rumex japonicus Houtt. 참소리쟁이 Rumex longifolius DC. 개대황 DD 1 Rumex maritimus L. 금소리쟁이 Rumex obtusifolius L. 돌소리쟁이 Rumex stenophyllus Ledeb. 가는잎소리쟁이 자리공과 Phytolaccaceae Phytolacca americana L. 미국자리공 Phytolacca esculenta VanHoutte 자리공 석류풀과 Molluginaceae Mollugo pentaphylla L. 석류풀 쇠비름과 Portulacaceae Portulaca oleracea L. 쇠비름 석죽과 Caryophyllaceae Arenaria serpyllifolia L. 벼룩이자리 Cerastium fischerianum Ser. 큰점나도나물 1 Cerastium glomeratum Thuill. 유럽점나도나물 Cerastium holosteoides Fries 북점나도나물 Cerastium holosteoides var. hallaisanense (Nakai) Mizush. 점나도나물 Cucubalus baccifer var. japonicus Miq. 덩굴별꽃 Dianthus barbatus var. asiaticus Nakai 수염패랭이꽃 Dianthus chinensis for. albiflora T.B.Lee 흰패랭이꽃 Dianthus chinensis L. 패랭이꽃 Dianthus longicalyx Miq. 술패랭이꽃 Gypsophila oldhamiana Miq. 대나물 Honkenya peploides var. major Hook. 갯별꽃 Lychnis cognata Maxim. 동자꽃 2 Lychnis fulgens Fisch. ex Spreng. 털동자꽃 3 Lychnis kiusiana Makino 가는동자꽃 4 Lychnis wilfordii (Regel) Maxim. 제비동자꽃 EN 4 Moehringia lateriflora (L.) Fenzl 개벼룩 LC 4 Pseudostellaria coreana (Nakai) Ohwi 참개별꽃 2 Pseudostellaria davidii (Franch.) Pax ex Pax & Hoffm. 덩굴개별꽃 1 Pseudostellaria heterophylla (Miq.) Pax ex Pax & Hoffm. 개별꽃 Pseudostellaria japonica Pax 긴개별꽃 CR Pseudostellaria palibiniana (Takeda) Ohwi 큰개별꽃 Pseudostellaria setulosa Ohwi 숲개별꽃
15 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 45 Sagina japonica (Sw.) Ohwi 개미자리 Sagina maxima A.Gray 큰개미자리 Silene aprica Turcz. ex Fisch. & C.A.Mey. 애기장구채 Silene aprica var. oldhamiana (Miq.) C.Y.Wu 갯장구채 1 Silene armeria L. 끈끈이대나물 Silene firma for. pubescens (Makino) Makino 털장구채 Silene firma Siebold & Zucc. 장구채 Silene jenisseensis Willd. 가는다리장구채 EN 4 Silene koreana Kom. 끈끈이장구채 CR 4 Silene oliganthella Nakai 흰장구채 Silene seoulensis Nakai 가는장구채 Spergularia marina (L.) Griseb. 갯개미자리 Stellaria alsine var. undulata (Thunb.) Ohwi 벼룩나물 Stellaria aquatica (L.) Scop. 쇠별꽃 Stellaria bungeana Fenzl 큰별꽃 Stellaria longifolia Muhl. ex Willd. 긴잎별꽃 DD Stellaria media (L.) Vill. 별꽃 Vaccaria vulgaris Host 말뱅이나물 명아주과 Chenopodiaceae Atriplex gmelinii C.A.Mey. 가는갯는쟁이 Atriplex subcordata Kitag. 갯는쟁이 Chenopodium acuminatum Willd. 둥근잎명아주 Chenopodium album L. 흰명아주 Chenopodium album var. centrorubrum Makino 명아주 Chenopodium album var. stenophyllum Makino 가는명아주 Chenopodium aristatum L. 바늘명아주 EN 4 Chenopodium bryoniaefolium Bunge 청명아주 Chenopodium ficifolium Smith 좀명아주 Chenopodium glaucum L. 취명아주 Chenopodium koraiense Nakai 참명아주 Corispermum stauntonii Moq. 호모초 Kochia scoparia (L.) Schrad. 댑싸리 Kochia scoparia var. littorea Makino 갯댑싸리 Salicornia europaea L. 퉁퉁마디 Salsola collina Pall. 솔장다리 3 Salsola komarovii Iljin 수송나물 Suaeda glauca (Bunge) Bunge 나문재 Suaeda japonica Makino 칠면초 Suaeda maritima (L.) Dumort. 해홍나물 비름과 Amaranthaceae Achyranthes japonica (Miq.) Nakai 쇠무릎 Amaranthus deflexus L. 눈비름 Amaranthus lividus L. 개비름 Amaranthus mangostanus L. 비름 Amaranthus retroflexus L. 털비름 Amaranthus viridis L. 청비름 Celosia cristata L. 맨드라미 목련과 Magnoliaceae Liriodendron tulipifera L. 튜울립나무 Magnolia denudata Desr. 백목련 Magnolia kobus DC. 목련 CR 4 Magnolia liliiflora Desr. 자목련 Magnolia obovata Thunb. 일본목련 Magnolia sieboldii K.Koch 함박꽃나무 오미자과 Schisandraceae Schisandra chinensis (Turcz.) Baill. 오미자 녹나무과 Lauraceae Cinnamomum camphora (L.) J.Presl 녹나무 LC 4 Lindera erythrocarpa Makino 비목나무
16 46 Chang Hyeon Lee, Hyun Tak Shin, Yeong Han Kwon, Myung Hoon Yi, Jung Won Yoon, Gi Song Kim, Gi Hwan Park and Jung Won Sung Lindera glauca (Siebold & Zucc.) Blume 감태나무 Lindera glauca var. salicifolia (Nakai) T.B.Lee 뇌성목 Lindera obtusiloba Blume 생강나무 Lindera obtusiloba for. ovata T.B.Lee 둥근잎생강나무 Lindera obtusiloba for. villosum Nakai 털생강나무 Machilus thunbergii Siebold & Zucc. 후박나무 1 계수나무과 Cercidiphyllaceae Cercidiphyllum japonicum Siebold & Zucc. 계수나무 미나리아재비과 Ranunculaceae Aconitum alboviolaceum Kom. 줄바꽃 Aconitum arcuatum Maxim. 키다리바꽃 Aconitum chiisanense Nakai 지리바꽃 DD Aconitum ciliare DC. 놋젓가락나물 Aconitum jaluense Kom. 투구꽃 1 Aconitum japonicum subsp. napiforme (H.Lev. & Vaniot) Kadota 한라돌쩌귀 LC 3 Aconitum koreanum R.Raymund 백부자 CR 4 Aconitum kusnezoffii Rchb. 이삭바꽃 DD Aconitum longecassidatum Nakai 흰진범 3 Aconitum macrorhynchum Turcz. 가는돌쩌귀 Aconitum pseudolaeve Nakai 진범 Aconitum triphyllum Nakai 세잎돌쩌귀 Aconitum umbrosum (Korsh.) Kom. 선투구꽃 EN Aconitum villosum Rchb. 참줄바꽃 Aconitum volubile Pall. 가는줄돌쩌귀 Actaea asiatica H.Hara 노루삼 Adonis amurensis Regel & Radde 복수초 Anemone amurensis (Korsh.) Kom. 들바람꽃 Anemone koraiensis Nakai 홀아비바람꽃 LC 4 Anemone narcissiflora L. 바람꽃 EN 4 Anemone nikoensis Maxim. 외대바람꽃 2 Anemone pseudoaltaica H.Hara 국화바람꽃 4 Anemone raddeana Regel 꿩의바람꽃 1 Anemone reflexa Steph. & Willd. 회리바람꽃 4 Anemone rossii S. Moore 쌍동바람꽃 Anemone umbrosa C. A. Mey. 숲바람꽃 Aquilegia Biedermeier Group 매발톱꽃 2 Aquilegia buergeriana var. oxysepala (Trautv. & Meyer) Kitam. 매발톱 Caltha palustris L. 동의나물 2 Cimicifuga biternata (Siebold & Zucc.) Miq. 개승마 3 Cimicifuga dahurica Maxim. 눈빛승마 Cimicifuga foetida L. 황새승마 2 Cimicifuga heracleifolia Kom. 승마 4 Cimicifuga japonica (Thunb.) Spreng. 왜승마 Cimicifuga simplex (DC.) Turcz. 촛대승마 1 Clematis alpina var. ochotensis (Pall.) Kuntze 자주종덩굴 Clematis apiifolia DC. 사위질빵 Clematis brachyura Maxim. 외대으아리 1 Clematis brevicaudata DC. 좀사위질빵 DD Clematis fusca Turcz. 검은종덩굴 Clematis fusca var. coreana (H.Lev. & Vaniot) Nakai 요강나물 Clematis fusca var. violacea Maxim. 종덩굴 Clematis heracleifolia DC. 병조희풀 Clematis heracleifolia var. davidiana Hemsl. 자주조희풀 Clematis koreana Kom. 세잎종덩굴 LC Clematis patens C.Morren & Decne. 큰꽃으아리 1 Clematis serratifolia Rehder 개버무리 3 Clematis terniflora DC. 참으아리 Clematis terniflora var. mandshurica (Rupr.) Ohwi 으아리 Clematis trichotoma Nakai 할미밀망
17 The Vascular Plant Species in the Korean Demilitarized zone (DMZ) 47 Delphinium maackianum Regel 큰제비고깔 4 Enemion raddeanum Regel 나도바람꽃 2 Eranthis stellata Maxim. 너도바람꽃 LC 3 Hepatica asiatica Nakai 노루귀 Hepatica insularis Nakai 새끼노루귀 Isopyrum manshuricum (Kom.) Kom. 만주바람꽃 EN 4 Megaleranthis saniculifolia Ohwi 모데미풀 EN 2 Pulsatilla dahurica (Fisch. ex DC.) Spreng. 분홍할미꽃 4 Pulsatilla koreana Nakai ex Mori 할미꽃 Pulsatilla koreana for. flava (Y.N.Lee) W.T.Lee 노랑할미꽃 Ranunculus acris var. monticola (Kitag.) Tamura 산미나리아재비 Ranunculus cantoniensis DC. 털개구리미나리 Ranunculus chinensis Bunge 젓가락나물 Ranunculus franchetii H.Boissieu 왜미나리아재비 3 Ranunculus japonicus Thunb. 미나리아재비 Ranunculus kazusensis Makino 매화마름 VU 5 Ranunculus quelpaertensis (H.Lev.) Nakai 왜젓가락나물 Ranunculus repens L. 기는미나리아재비 Ranunculus sceleratus L. 개구리자리 Ranunculus tachiroei Franch. & Sav. 개구리미나리 Ranunculus ternatus Thunb. 개구리갓 DD 1 Thalictrum actaefolium var. brevistylum Nakai 은꿩의다리 Thalictrum aquilegifolium var. sibiricum Regel & Tiling 꿩의다리 Thalictrum baicalense Turcz. 바이칼꿩의다리 DD Thalictrum coreanum H. Lev. 연잎꿩의다리 EN 5 Thalictrum filamentosum Maxim. 큰산꿩의다리 Thalictrum filamentosum var. tenerum Ohwi 산꿩의다리 Thalictrum kemense var. hypoleucum (Siebold & Zucc.) Kitag. 좀꿩의다리 Thalictrum rochebrunianum var. grandisepalum (H.Lev.) Nakai 금꿩의다리 1 Thalictrum simlex var. brevipes Hara 긴잎꿩의다리 EN 1 Thalictrum uchiyamai Nakai 자주꿩의다리 작약과 Paeoniaceae Paeonia japonica (Makino) Miyabe & Takeda 백작약 VU 2 Paeonia japonica var. pillosa Nakai 털백작약 Paeonia lactiflora for. pilosella Nakai 호작약 Paeonia lactiflora Pall. 작약 Paeonia lactiflora var. trichocarpa (Bunge) Stern 참작약 EN Paeonia obovata Maxim. 산작약 CR 5 Paeonia suffruticosa Andr. 모란 매자나무과 Berberidaceae Berberis amurensis Rupr. 매발톱나무 2 Berberis amurensis var. latifolia Nakai 왕매발톱나무 Berberis koreana Palib. 매자나무 3 Berberis koreana var. ellipsoides Nakai 연밥매자나무 Berberis poiretii C.K.Schneid. 당매자나무 Caulophyllum robustum Maxim. 꿩의다리아재비 1 Epimedium koreanum Nakai 삼지구엽초 VU 4 Jeffersonia dubia (Maxim.) Benth. & Hook. 깽깽이풀 EN 5 Leontice microrhyncha S.Moore 한계령풀 VU 5 으름덩굴과 Lardizabalaceae Akebia quinata (Thunb.) Decne. 으름덩굴 방기과 Menispermaceae Cocculus trilobus (Thunb.) DC. 댕댕이덩굴 Menispermum dauricum DC. 새모래덩굴 Sinomenium acutum (Thunb.) 방기 1 수련과 Nymphaeaceae Nelumbo nucifera Gaertn. 연꽃 Nymphaea tetragona Georgi 수련
도감본문(수정)~10p
두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9
More information13-ºÎ·Ï¸ðÀ½-0312
Pinus thunbergii Parlatore Abies holophylla Maximowicz Pinus densiflora Siebold et Zuccarini Juniperus chinesis Linnaeus Pinus densiflora for. erecta Uyeki Juglans mandshurica Maximowicz Ginkgo biloba
More informationμ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG
More informationUM00003782.PDF
1 북한 산림 생태계의 지속가능한 관리 방안에 관한 연구 강 호 상 (서울대 객원연구원) 목 차 요약문 3 1. 서 론 5 2. 북한의 자연자원 8 3. 북한의 산림자원 16 4. 북한의 산림황폐화 원인 및 현황 18 5. 훼손된 북한 산림생태계의 복원 25 6. 장기생태연구지 설정 및 연구 31 7. 동북아시아 국가간 산림 network 조성 및 교류 협력
More information이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park
이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The
More informationuntitled
1 2 3 4 5 006 009 020 024 028 032 036 040 044 050 056 064 070 086 090 188 192 195 199 202 205 209 212 214 219 102 110 224 6 7 6 008 9 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 19 파주 20 1)
More informationuntitled
11-1400119-000205-01 THE FOREST EDUCATION PROGRAM THE FOREST EDUCATION PROGRAM 93520 9 788997 450602 ISBN 978-89-97450-60-2 THE FOREST EDUCATION PROGRAM 20149 031-540-2000 415 aplan Tomorrow FOUR SEASONS
More information<BACF3FC1DF20C1A2B0E6C1F6BFAA20B0B3B9DFC7F6C8B220B9D720C8AFB0E6BBF3C5C220C1B6BBE72833C2F72928B0ADC5C3B1B8292E687770>
사업보고서 2013-07-02 북 중 접경지역 개발현황 및 환경상태 조사(3차) 강택구 외 편 연구진 연구책임자 참여연구진 강택구 (한국환경정책 평가연구원 부연구위원) 노태호 (한국환경정책 평가연구원 연구위원) 추장민 (한국환경정책 평가연구원 연구위원) 오일찬 (한국환경정책 평가연구원 부연구위원) 이호림 (중국 연변대학교 농학과 교수) 박인철 (중국 연변대학교
More informationDMZ 의식물 155 마일
DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. DMZ 의식물 155 마일 DMZ의식물 155마일 을엮은우리의노력이식물을앞세워현실의휴전선을지워나가는길이되었으면합니다. 남과북의경계없이피고지는비무장지대의식물처럼말입니다. 발행일 2016년 10월 15일발행처 국립수목원발행자
More information이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeo
이웅빈 A Flora of Mt. Umyeon Department of Biological Science, Yongin University Mt. Umyeon is located between Seocho-gu in Seoul and Gwacheon-si in Gyeonggi-do. The investigated vascular plants consist of
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The K
정규영 서정수 * 박명순 이선희 최하나 정수영 Flora of Vascular Plants on Mt. Kookmang(Chungju, Chungbuk) School of Bioresource Science, Andong National University *The Korean Association for Conservation of Nature This survey
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationArctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N
다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information박선주.fm
자연보존 173 : 22-33 ; 2016 년 5 월 운문산생태 경관보전지역의특정식물및귀화식물연구 1) 박선주 송임근 2) 영남대학교생명과학과 서론 운문산은가지산 (1,240 m), 천황산 (1,189 m), 재약산 (1,108 m) 등과더불어해발 1,000 m 이상의고봉에둘러싸여있고, 영남의 7산중의하나이며, 경상남 북도의경계를이루는성현산맥 ( 省峴山脈 )
More information7(3)-03.fm
w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information101.fm
Journal of Korean Nature Vol. 3, No. 1 1-10, 2010 Dispersion of Vascular Plant in Mt. Huiyangsan, Korea Hyun-Tak Shin 1, Sung-Tae Yoo 2, Byung-Do Kim 2, and Myung-Hoon YI 3 * 1 Gyeongsangnam-do Forest
More information<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>
수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo
2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,
More information358051_마상_식물상_종목록.xlsx
2014년전국자연환경조사-식물-고성철과명출현종영문한글학명국명 특이사항 도엽명 SOLANACEAE 가지과 Solanum nigrum var. nigrum L. 까마중 마상 (358051) RHAMNACEAE 갈매나무과 Rhamnus yoshinoi Makino 짝자래나무 마상 (358051) EBENACEAE 감나무과 Diospyros lotus L. 고욤나무
More information2_11_24 김준수.hwp
농업생명과학연구 45(3) pp.9-18 Journal of Agriculture & Life Science 45(3) pp.9-18 비룡산 신갈나무림의 식물 다양성 김준수 1 홍진기 1 김경수 1 조용찬 2 배관호 3* 1 경북대학교 과학기술대학원 산림환경자원학과, 2 국립수목원, 3 경북대학교 생태환경시스템학부 접수일(2011년 03월 04일), 수정일(2011년
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information01-Megascolex(dh)
Journal of Species Research 2(2):203-222, 2013 A floristic study of Donggeom-do (Isl.), Ganghwa-gun, Korea Sun-Yu Kim, Byoung Yoon Lee and Jung-Hyun Kim* Division of Plant Resources, National Institute
More informationPrograms The 201 EABCN symposium will be held on 13 October and two-day field trips will be arranged at October. A side event is also planned to
THE 201 EABCN SYMPOSIUM Program Book 9-1 October 201 Republic of Korea East Asia Biodiversity Conservation Network Published by Korea National Arboretum Programs The 201 EABCN symposium will be held on
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information<B3EDB9AEC1FD5F3235C1FD2E687770>
오용록의 작품세계 윤 혜 진 1) * 이 논문은 생전( 生 前 )에 학자로 주로 활동하였던 오용록(1955~2012)이 작곡한 작품들을 살펴보고 그의 작품세계를 파악하고자 하는 것이다. 한국음악이론이 원 래 작곡과 이론을 포함하였던 초기 작곡이론전공의 형태를 염두에 둔다면 그의 연 구에서 기존연구의 방법론을 넘어서 창의적인 분석 개념과 체계를 적용하려는
More information발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽
울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를
More information조경식물학 - 활엽수 계열(2) -
조경식물학 - 상록활엽수외 - 1. 녹나무 내한성 : 약함 음양성 : 중용수 녹나무 Cinnamomum camphora 성상 : 상록활엽교목 수형 : 타원형 분포 : 난온대지역 이식 : 어려움 번식 : 실생 / 삽목 대기정화능력우수, 환경정화수 기조, 녹음, 가로수, 방풍, 방화식재 2. 생달나무 내한성 : 약함 음양성 : 음수 생달나무 Cinnamomum
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More information¹ýÁ¶ 12¿ù ¼öÁ¤.PDF
논문요약 146 [ 주제어 ] 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 abstract Recent Development in the Law of DPRK on the
More informationfm
Floristic study of Jogyesan Mt. 339 Appendix 1. List of vascular plants distributed in Jogyesan Mt. Lycopodiaceae 석송과 Huperzia serrata (Thunb.) Trevis. 뱀톱 P 150635 Equisetaceae 속새과 Equisetum arvense L.
More information03¹ü¼±±Ô
Relevancy between Aliases of Eight Provinces and Topographical Features during the Chosun Dynasty Seon-Gyu Beom* Abstract : In Korea, aside from their official administrative names, aliases of each province
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information401.fm
Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department
More information272 石 堂 論 叢 49집 기꾼이 많이 확인된 결과라 할 수 있다. 그리고 이야기의 유형이 가족 담, 도깨비담, 동물담, 지명유래담 등으로 한정되어 있음도 확인하였 다. 전국적인 광포성을 보이는 이인담이나 저승담, 지혜담 등이 많이 조사되지 않은 점도 특징이다. 아울
271 부산지역 구비설화 이야기꾼의 현황과 특징 정 규 식* 1) - 목 차 - Ⅰ. 서론 Ⅱ. 부산지역 구비설화 이야기꾼의 전반적 현황 1. 이야기꾼의 여성 편중성 2. 구연 자료의 민요 편중성 3. 이야기꾼의 가변적 구연력 4. 이야기 유형의 제한성 5. 이야기꾼 출생지의 비부산권 강세 Ⅲ. 부산지역 구비설화 이야기꾼의 특징 Ⅳ. 결론 개 요 본고의 목적은
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information44-3대지.08류주현c
A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional
More information11¹ÚÇý·É
Journal of Fashion Business Vol. 6, No. 5, pp.125~135(2002) The Present State of E-Business according to the Establishment Year and the Sales Approach of Dongdaemun Clothing Market Park, Hea-Ryung* and
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information<C3D6C1BEBAB8B0EDBCAD5FC7A5C1F62E687770>
훼손된 자연생태계 복원기술 Restoration Technology of Damaged Ecosystem 도시녹지공간의 생태 corridor 설계기법 Development of Design Technology for the Eco-corridor in Urban Area 고려대학교 환 경 부 보고서 초록 연구과제명 코드번호 (국문) 도시녹지공간의 생태 corridor
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More informationfm
Korean J. Pl. Taxon. 46(2): 213 246 (2016) http://dx.doi.org/10.11110/kjpt.2016.46.2.213 pissn 1225-8318 eissn 2466-1546 Korean Journal of Plant Taxonomy Floristic study and conservation management strategies
More information민속지_이건욱T 최종
441 450 458 466 474 477 480 This book examines the research conducted on urban ethnography by the National Folk Museum of Korea. Although most people in Korea
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationMethod Country Vegetation type Reference AA Japan Quercus-mixed Kirita(1971) Japan Quercus-mixed Nakane(1975) CC China glassland Jia et al.(2006) Japan deciduous forest Hirano e tal.(2003) USA hardwood
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information... 수시연구 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 권혁구ㆍ서상범...
... 수시연구 2013-01.. 2010 국가물류비산정및추이분석 Korean Macroeconomic Logistics Costs in 2010... 권혁구ㆍ서상범... 서문 원장 김경철 목차 표목차 그림목차 xi 요약 xii xiii xiv xv xvi 1 제 1 장 서론 2 3 4 제 2 장 국가물류비산정방법 5 6 7 8 9 10 11 12 13
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information<C0CEBCE2BFEB5FBFACB1B85F323031342D32322D3528BAAFBCF6C1A4295F3135303431355FBCF6C1A42E687770>
연구보고서 2014-22-5 동아시아 국가의 다문화가족 현황 및 정책 비교연구 변수정 조성호 이상림 서희정 정준호 이윤석 책임연구자 변수정 한국보건사회연구원 부연구위원 주요저서 저출산 고령사회 대응 국민 인식 및 욕구 모니터링 시스템 운영 한국보건사회연구원, 2013(공저) 공동연구진 조성호 한국보건사회연구원 부연구위원 이상림 한국보건사회연구원 부연구위원 서희정
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More information<B9AEC8ADC4DCC5D9C3F7BFACB1B82D35C8A32833B1B3292E687770>
독서문화 생태계 조성의 주요 거점으로서, 지역 서점 활성화 방안 연구 - 국내 국외 성공 사례에 기초하여 오선경 * 국문초록 매체 환경이 디지털로 전환해가면서 종이책 독서인구도 감소하고 있다. 더불 어 오픈 마켓이나 대형 서점, 온라인 서점 등의 공격적 마케팅은 보다 편리하고, 보다 빨리, 보다 싸게 라는 책 소비 패턴에 변화를 가져왔다. 이는 곧 규모나 자본
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information03권동희(17-26)ok
Geographical Analysis of National Monument Topography* Kwon, Dong-Hi 1) Abstract : As of January 2010, 59 topography have been designated as national monuments. From the geographical point of view, these
More information[10_ 최종]JPR15-17(김현준_덕적도(옹진군) 및 인근 도서지역의).hwp
Korean J. Plant Res. 28(4):487-510(2015) http://dx.doi.org/10.7732/kjpr.2015.28.4.487 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 덕적도 ( 옹진군 ) 및인근도서지역의관속식물상 김현준, 지성진, 정수영, 박수현,
More informationProblem New Case RETRIEVE Learned Case Retrieved Cases New Case RETAIN Tested/ Repaired Case Case-Base REVISE Solved Case REUSE Aamodt, A. and Plaza, E. (1994). Case-based reasoning; Foundational
More information304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More information02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
More information182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연
越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그
More information원고스타일 정의
논문접수일 : 2015.01.05 심사일 : 2015.01.13 게재확정일 : 2015.01.26 유니컨셉 디자인을 활용한 보행환경 개선방안 연구 A Study on Improvement of Pedestrian Environment on to Uniconcept Design 주저자 : 김동호 디지털서울문화예술대학교 인테리어실용미술학과 교수 Kim dong-ho
More information2011´ëÇпø2µµ 24p_0628
2011 Guide for U.S. Graduate School Admissions Table of Contents 02 03 04 05 06 08 09 10 11 13 15 21 LEADERS UHAK INTERNATIONAL STUDENTS SERVICE www.leadersuhak.com Leaders Uhak International Students
More information01이정훈(113~127)ok
The Role of Historical Relativity in International Exchange of Culture and Tourism at the Regional Level: A Case of Gyeonggi and Shandong Province Jung-hoon Lee** Kyung-Eun Choi*** Eun-Ja Lee****,.,,.,,.,,.,.,.,,,
More information04±èºÎ¼º
Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept
More information11¹Ú´ö±Ô
A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -
More information<B8F1C2F72E666D>
Korean J. Pl. Taxon. 44(2): 136-163 (2014) http://dx.doi.org/10.11110/kjpt.2014.44.2.136 ISSN 1225-8318 Korean Journal of Plant Taxonomy Floristic study of Golji stream watershed in Gangwon province, Korea
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationStudy on the Vascular Plants Found in Nearby Island Regions of Ganghwado
Journal of Korean Nature Vol. 3, No. 2 83-101, 2010 Study on the Vascular Plants Found in Nearby Island Regions of Ganghwado You-Mi Lee, Su-Hyun Park, Su-Young Jung, and Jong-Cheol Yang Korea National
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information002-022~41-기술2-충적지반
Improvement cases of waterproofing and auxiliary construction methods in alluvium soil tunnel In the past, subway tunnel is mostly applied to rock tunnel in order to secure the safety. But, in recent years,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information<31372DB9CCB7A1C1F6C7E22E687770>
미래지향 고령친화 주거디자인을 위한 예비노인층의 라이프스타일 특성 Characteristics of Lifestyle of the Pre-Elderly for Future Elderly-friendly Housing Design 류 혜 지 청운대학교 인테리어디자인학과 교수 Ryu hye-ji Dept. of Interior Design, Chungwoon University
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationA Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea
Journal of Asia-Pacific Biodiversity Vol. 6, No. 2 281-310, 2013 http://dx.doi.org/10.7229/jkn.2013.6.2.281 A Study on the Flora of 15 Islands in the Western Sea of Jeollanamdo Province, Korea Hee-Suk
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012년전국자연환경조사 - 식물 - 심정기 - 도곡 목명과명출현종도곡 (377162) 도엽특이사항영문한글영문한글학명국명 E1 E2 E4 E5 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Aspleniaceae 꼬리고사리과 Athyrium iseanum
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )
Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)
More information27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
More information<B7CEC4C3B8AEC6BCC0CEB9AEC7D0322832303039B3E23130BFF9292E687770>
로컬리티 인문학 2, 2009. 10, 257~285쪽 좌절된 세계화와 로컬리티 - 1960년대 한국영화와 재외한인 양 인 실* 50) 국문초록 세계화 로컬리티는 특정장소나 경계를 지칭하는 것이 아니라 관계와 시대에 따 라 유동적으로 변화하는 개념이다. 1960년대 한국영화는 유례없는 변화를 맞이하고 있었다. 그 중 가장 특이할 만한 사실은 미국과 일본의 영화계에서
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information