완료_eri hwp
|
|
- 민식 야
- 5 years ago
- Views:
Transcription
1 Ecology and Resilient Infrastructure (2015) 2(1): Online ISSN: ORIGINAL ARTICLE 외래식물에의한대학교정생태계의교란 Disturbance of Campus Ecosystems by Alien Plants 김세은 1 ㆍ이효혜미 2 ㆍ차현철 3 * 1 극지연구소북극환경자원센터, 2 국립생태원위해생물연구부, 3 단국대학교생명과학부 Seeun Kim 1, Hyohyemi Lee 2 and Hyeon-Cheol Cha 3 * 1 Department of Arctic Research Center, Korea Polar Research Institute (KOPRI), Incheon , Korea 2 Department of Eco-safety Research, National Institute of Ecology, Seocheon , Korea 3 Department of Biological sciences, Dankook, Cheonan , Korea Received 4 March 2015, revised 11 March 2015, accepted 20 March 2015, published online 31 March 2015 ABSTRACT: Some of alien plants, which were introduced from foreign countries, have caused problems in Korea. Invasion of these alien plants in the ecosystem threatens the habitat of endemic species, reducing biodiversity, and causing a disturbance in the ecological system. In urbanized areas of campus universities, a diverse range of organisms were found and a comparison between the sites, near roads or housing sites were made because the campuses provided a large biotope. Although the campus had been exposed to interferences like gardening, it was also a place for most organisms to live in an active floating population due to free access. This research investigated the flora of alien plants that appeared in Beakseok, Sangmyung, Hoseo and Dankook, and relationship between the distribution of alien plants and the campus and green areas and distance from the highway. The total number of plant species and naturalized species found in the four universities was 189 and 43 species. Those of Dankook were 136 and 35 species, Hoseo 108 and 25 species, Sangmyung 103 and 31 species, and Baekseok 97 and 26 species, respectively. The abundance of natural plants for each respective university tended to be higher as it became closer to the highway. Also, the closer the walking distance to the university, the greater the tendency for the degree of similarity to be higher. As a result, we may conclude that the distribution of alien plants and anthropogenic activities may be closely related. KEYWORDS: Alien species, Campus, Disturbance, Naturalized plant 요약 : 귀화식물은외국으로부터들어와야생에서자라는외래식물로서대부분번식력이뛰어나우리생태계에서서식지를확대하며토종식물들을위협하여문제가되고있다. 본연구는유동인구가많고, 비교적큰규모의생물서식공간을제공하는대학교캠퍼스에자연생태계로유입되어귀화된외래종이얼마나많이서식하고, 어떠한물리적환경요인이귀화식물의분포에가장많은영향을미치는지를밝히기위하여연구되었다. 캠퍼스는천안시소재의단국대학교, 백석대학교, 상명대학교, 호서대학교를대상으로각교정에출현하는귀화된외래종 ( 원예종제외 ) 및고유종을조사하고, 교지와녹지면적, 각학교사이의거리및고속도로와거리를조사하였다. 발견된총식물종과외래종수는각각 189 종과 43 종이었고, 단국대 136 종과 35 종, 호서대 108 종과 25종, 상명대 103 종과 31종, 백석대 97 종과 26종이출현하였다. 각대학교정에서외래종의풍부도는고속도로와가까울수록높았다. 또한대학간의도보거리가가까울수록출현외래종식물상의유사도가높아지는경향을보였다. 이상의결과로보아대학교정에서외래종에의한생태계교란이심화되고있으며, 특히인간활동이외래종의분포와밀접한연관성을가짐을알수있었다. 핵심어 : 외래종, 교정, 교란, 귀화식물 *Corresponding author: hccha@dankook.ac.kr c Korean Society of Ecology and Infrastructure Engineering. All rights reserved. This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 80
2 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): 서론일반적으로외래식물 (alien plant), 특히귀화식물 (naturalized plant) 이란비자생종으로외국으로부터의도적, 또는비의도적으로도입되어인간의도움없이야생에서자라는식물을말한다 (Kim et al. 2000). 최근해외교류가증가함에따라우리나라생태계에적응해살아가는외래식물의분포지가계속증가하는추세이다 (Yoon et al. 2012, Sung et al. 2014). 귀화식물의생태적특징은대부분다년생보다는일년생과같이생활사가짧은식물이많고, 빠른속도로성장하여많은종자를생산한다 (Kim et al. 2000). 이들은환경적응력이빠르고번식력이뛰어나불안정한환경이나교란지에서쉽게관찰된다. 2009년까지발표된우리나라에귀화된외래식물은총 321종으로 1년생이 158종 (49%) 으로가장많았으며, 최근 10년사이에 100여종이이입된것으로보고되었다 (Park 2009). 원산지로는유럽 (134종, 42%), 북미 (75 종, 23%), 유라시아 (28종, 9%), 열대아메리카 (27종, 8%) 순이었으며, 현대로올수록점차원산지가다양해지는경향을보이고있다 (Kim et al. 2000). 이들의주요분포지역은항구, 쓰레기매립지, 공항인근등의귀화센터를비롯하여, 이와연결된도로, 공사지, 개발지등으로빠르게확산되어분포영역을넓혀가는것으로알려져있다 (Kim et al. 2000). 일반적으로귀화식물은대부분유해하다고알려져있으나, 삼, 어저귀, 큰김의털과같이의약품이용이나빠른토양안정화에기여하기도한다 (Lee 2003b). 그러나, 국제자연보전연연맹 (IUCN) 이지적한바와같이외래종의도입이토착생물을위협하여해당지역의생물다양성감소에심각한영향을주기때문에외래식물의도입은매우신중히결정해야한다 (Chapin III et al. 2000, Didham et al. 2005, Pimentel et al. 2005). 실제로귀화식물은우리생태계에서점차서식지를확대하여토종식물을위협하며산림생태계를교란시키고있으며 (Luken and Thiert 1996, Lowe et al. 2000), 돼지풀같은몇몇종은꽃가루에알레르기유발물질을함유하여그피해가더욱심각한상황이다 (Kim and Oh 2009). 그러므로생태계내에서외래종의존재는이미무시할수없는상태이므로외래종에대한철저한관리및연구가매우절실하다. 본연구의조사대상지인대학캠퍼스는유동인구가높으며, 도심에위치하여공원과같은녹지공간이부족한도시지역에서다양한생물이살수있는서식공간을제공하지만, 해당기관의잡초제거와같은지속적인관리의대상이되기도하며, 항상개발에노출이되어있는공간이기도하다 (Lee 2008). 따라서본연구의목적은, 1) 대학교캠퍼스에생육하는외래종의식물상을알아보고, 2) 출현한외래종의식물특성에따라분류하며, 3) 물리적환경요인이외래식물의분포에미치는영향을밝히고, 4) 대학교교정생태계에서생물다양성보전을위한외래식물관리방안을모색하는데있다. 2. 연구방법 2.1 조사지개황연구대상지는우리나라중부권에속하는충남천안시동남구에위치한 4개의대학캠퍼스인단국대학교, 백석대학교, 상명대학교및호서대학교이다 (Fig. 1). 각대학의교정은경부고속도로를중심으로서쪽에단국대학교, 동쪽에백석대, 상명대, 호서대가위치하였다. 또한 4개대학모든캠퍼스가산지와인접하여있기때문에캠퍼스의식물조사영역은교정에서산지와의경계까지로제한하였다. 이들대학의설립연도는단국대와호서대가 1978년에가장먼저지어졌고, 이어서 1985년에상명대, 1994년에백석대순으로교정이조성되었다 (Table 1). 대학교의전체면적은단국대 > 백석대 > 상명대 > 호서대의순이었고, 녹지면적은백석대 > 단국대 > 호서대 > 상명대로나타났다 (Table 1). 대학교지총면적에대한녹지면적의비율은호서대가 32% 로가장높았으며, 백석대가 20%, 단국대와상명대가각각 16% 와 15% 이었다. 2.2 캠퍼스특성및환경요인분석어떤환경요인이외래식물의도입에가장큰영향을미치는가를알아보기위하여, 첫째, 각대학총면적과녹지면적을위성자료를이용하여측정하였고, 둘째, 각대학별홈페이지의정보를이용하여설립
3 82 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Fig. 1. Aerial photographs showing the study sites. The red line outlines the investigated sites (A: Dankook, B: Sangmyung, C: Hoseo, D: Baekseok ). Table 1. Characteristics of the campuses at the investigated universities in Cheonan, Korea. Year of establishment Total area (m 2 ) Green area (m 2 ) (percentage) Dankook , ,195 (16%) Sangmyung ,309 38,922 (15%) Hoseo ,809 66,315 (32%) Beakseok , ,051 (20%) 연도를알아보았으며, 셋째, 위성자료를토대로고속도로와캠퍼스간의거리를측정하였고마지막으로대학간거리를위성영상에서측정하였다. 대학간거리에따른외래식물종조성의유사도를분석하기위하여위성자료를기반으로각대학간의최단거리, 평균거리및도보거리를산출하였다. 최단거리는두대학에서가장가까운건물사이의거리를측정하였으며, 평균거리는각대학의학생회관사이의거리를측정하였다. 호서대와백석대에서는학생회관이없었기때문에캠퍼스의중심부에위치한건물을선택하였는데, 호서대는종합정보관이, 백석대는본부동이이에해당되어이곳까지의거리를측정하였다. 마지막으로도보거리는각대학의최단거리를잰건물을도보로갈수있는길을따라위성자료에서거리를측정하였다. 의교정에서시행하였다. 식물조사는교정에서생육하는식물중식재된원예종을제외하였고, 비의도적으로도입된현화식물중초본류를조사대상으로한정하였다. 채집한식물은 Lee (1996) 와 Lee (2003a) 의도감을이용하여동정하였으며, 학명과국명은국가표준식물목록 (KNA 2015) 에의거하였고, 귀화식물의동정은 Park (2009) 과 Lee et al. (2011) 을참고하였다. 조사된외래식물식물상에서 4개대학모두에서출현하는공통종과하나의대학에서출현하는희귀종으로구분하였다. 출현한외래식물은다양한특성에의하여구분하였는데, 이들의원산지, 도입시기 (1기: 개항이후 ~1921년, 2기 : 1922~1963 및 3기 : 1964~ 현재 ), 생활사 (1년생, 2년생및다년생 ), 종자의분류체계 (Kim et al. 2011) 와크기 (An 2009) 에따라서외래식물을분류하였다. 2.3 식물상특성조사 식물상조사는 2013 년 4 월부터 8 월까지 4 개대학 2.4 자료분석 출현귀화식물종에따른캠퍼스간의유사성을비
4 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): 교하기위하여 Sorenson 유사도지수를계산하였다 (Hopfensperger 2007). Sorenson 유사도지수는간단하게두지역간의출현종의유사성을계산할수있기때문에가장많이이용되고있는분석방법중하나이다 (Grandin and Rydin 1998, Stromberg et al. 2009, Stroh et al. 2012). 유사도 = (1) A = A 대학의외래종수 B = B 대학의외래종수 C = A 와 B 대학의공통출현외래종수 초, 달맞이꽃, 망초, 미국자리공, 붉은씨서양민들레, 서양민들레, 소리쟁이, 애기땅빈대, 애기수영, 왕포아풀, 유럽점나도나물, 좀명아주, 주걱개망초, 주홍서나물, 큰김의털, 털별꽃아재비, 토끼풀로서총 17종이었다. 반면에한대학의교정에서만출현한희귀한외래종은단국대 4종, 상명대 2종, 호서대 2종, 백석대 3종이있었다 (Table 2). 3.2 식물특성에따른외래식물특성천안시소재 4개대학교정에서출현한외래식물종을생활사에따라서분류하면, 총출현종수에대한 1년생종수가상명대 52%, 백석대 50%, 단국대 43% 및호서대 36% 이었다 (Fig. 2). 또한외래종을종자 3. 결과 3.1 외래식물분포현황 천안시에서서로가까이위치한 4개대학의교정에서발견된초본식물의총종수는 189종이었으며이중외래식물은총 43종이확인되었다 (Appendix 1). 출현초본식물종수는단국대가 136종으로가장많았고, 가장최근에지어진백석대가 97종으로가장적었다 (Appendix 1, Table 2). 학교별출현외래식물종수는단국대 35종, 상명대 31종, 호서대 26종, 백석대가 25종으로나타나, 총초본식물종수의 24-30% 를차지하였다 (Table 2). 4개조사대학에서모든교정에서출현한외래식물인공통외래종은개망 Fig. 2. The number of alien plant species according to their life histories on the university campuses in Cheonan, Korea (A: annual, B: biennial, P: perennial). Table 2. Floral characteristics on the campuses of investigated universities in Cheonan, Korea. Property Dankook Univ. Sangmyung Univ. Hoseo Univ. Beakseok Univ. Number of total species Number of alien species 35 (25.7%) 31 (29.7%) 25 (24.3%) 26 (26.8%) Common alien species (17 species) Unique alien species Cerastium glomeratum, Chenopodium ficifolium, Conyza canadensis, Crassocephalum crepidioides, Erigeron annuus, Erigeron strigosus, Euphorbia supina, Festuca arundinacea, Galinsoga ciliata, Oenothera biennis, Phytolacca americana, Poa pratensis, Rumex acetosella, Rumex crispus, Taraxacum laevigatum, Taraxacum officinale, Trifolium repens Ailanthus altissima for. Altissima, Amorpha fruticosa, Cuscuta pentagona, Lolium multiflorum var. multiflorum, (4 speces) Ipomoea hederacea var. hederacea, Mollugo verticillata (2 speces) Ipomoea hederacea var. integriuscula, Medicago lupulina (2 speces) Aster subulatus var. sandwicensis, Panicum dichotomiflorum., Silene armeria (3 speces)
5 84 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Fig. 3. The number of alien plant species according to their seed types on the university campuses in Cheonan, Korea. Fig. 4. Classification of alien plant species according to their introduction time on the university campuses in Cheonan, Korea. 의분류학적종류에따라서분류하면, 출현외래식물의종자는수과 > 삭과 > 곡립등의순으로서, 대표적인수과식물인서양민들레, 개망초등이어느교정에서나가장많이발견되었으며, 반면에시과식물이가장드물게발견되었다 (Fig. 3). 천안소재 4대대학에서발견된외래식물의도입시기분류에서 1기 ( 개항이후 ~1921년 ) 에들어온외래종수가제일많았으며그다음이 3기 (1964년 ~ 현재 ) 이었고 2기 (1922년 ~1963년 ) 순이었다 (Fig. 4). 또한이들외래식물을원산지에따라서분류하면, 유럽에서가장많이유래하였으며, 그다음으로북미, 유라시아의순이었다 (Fig. 5). 3.3 환경조건에외래식물의분포특성대학설립된후경과한시간과총식물종수또는외래식물종수사이에는통계적으로유의하지는않지만양의상관관계의경향을보여주었다 (Fig. 6). 또한조사대상대학의교지면적또는녹지면적과총식물종수또는외래종수사이에는유의한상관관계가나타나지않았다. 그러나고속도로로부터학교까지거리는분포외래식물종수와유의한음의상관관계를나타내었다 (r 2 = 0.86, p=0.0485) (Fig. 6). 대학간의공간적거리와외래식물식물상의관계를살펴보면, 도보거리가서로가장가까운단국대- 상명대의공통외래종수가 28종으로제일많았고, 거리가먼백석대 -호서대의공통외래종수는 17종밖에되지않았다 (Table 3). 두대학간도보거리에따른외래종식물상의유사도는단국대 -상명대가 85% 로가장높았으며백석대- 호서대가 67% 로서낮았다 (Table 3). 대학간최단, 평균및도보거리와출현외래식물상의유사도사이의상관관계를살펴보면특히도보거리가서로가까울수록유사도가높아지는경향이었다 (r 2 =0.67, p=0.028) (Fig. 7). 4. 고찰및결론 Fig. 5. Classification of alien plant species according to their origins on the university campuses, in Cheonan, Korea (AF: Africa, AS: Asia, EU: Europe, NA: North America, SA: South America, TA: Tropical America). 대학교정에분포하는식물종수는교지면적에비례할것으로생각되었으나, 본연구에서는조사대상 4개대학중에서녹지면적이가장넓은백석대가넓은면적에비하여출현종이다양하지않았다. 이러한
6 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): (a) (b) (c) Fig. 6. Relationships between numbers of plant species and years from establishment (a) (2 points on 19 years), campus area (b), green area (c), and distance from highway (d) on the university campuses in Cheonan, Korea. Table 3. The distances, numbers of common alien plant species, and similarity indices between the universities in Cheonan, Korea. Property Sangmyung Baekseok Hoseo Dankook The shortest distance (m) The mean distance (m) 1,000 1,400 1,600 The walking distance (m) No. of common alien species Index of similarity (%) Sangmyung The shortest distance (m) The mean distance (m) The walking distance (m) - 1, No. of common alien species Index of similarity (%) Baekseok The shortest distance (m) The mean distance (m) - - 1,300 The walking distance (m) - - 2,070 No. of common alien species Index of similarity (%) (d)
7 86 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Fig. 7. Relationship between walking distances and the Sorenson index of similarity between the university campuses in Cheonan, Korea. 이유는백석대교정에서녹지의인위적관리가심하게이루지고있고녹지대부분에원예종이식재되어있기때문이었다. 결과적으로공공오픈스페이스인대학교정에서식물생물다양성은원예종식재, 녹지관리방법과강도에따라서크게영향을받는것으로생각된다. 교정식물의분포는도입이가능한기간과밀접한관계가있기때문에대학설립연도를기준으로식물종수를살펴본결과, 가장이른 1978년에설립된단국대와호서대에생육하는식물종수가가장많았다. 같은해에설립된두학교중에서단국대의식물종수가더많은이유는단국대의교지및녹지면적이넓기때문이라고생각된다. 또한외래식물종수도설립후기간이오랜된대학교교정에서많았다. 대학에분포하는외래식물종의원산지로는유럽원산이가장많았는데, 특히유럽에서도입된외래식물은 1년생보다다년생식물이더많은비중을차지하였다. 이는우리나라의귀화식물이 1년생이가장높은비중을차지한다는 Park (2009) 의연구결과와는차이가있었다. 식물의종자는종의산포에가장큰역할을하는데, 교정에분포한외래식물의종자는 1립당무게가 0.001~1 mg 인작은크기의종자가많고종류로는수과의비중이제일높았다. 대표적으로수과의종자를가진식물중하나인서양민들레는종자의무게가 1 mg 내외로가볍다. 1970년대이후귀화한것으로알려진털별꽃아재비, 붉은씨서양민들레, 미국나팔 꽃, 둥근잎미국나팔꽃, 미국쑥부쟁이, 주홍서나물, 주걱개망초, 큰비짜루국화, 유럽점나도나물, 털까마중중에서주걱개망초과유럽점나도나물의경우, 종자무게가 mg 정도로가볍기때문에조사한 4개의학교교정모두에서발견되었고, 미국나팔꽃과둥근잎미국나팔꽃은종자무게가약 49 mg 으로무거워서한학교에서만나타나는낮은빈도를보였다. 따라서종자의무게가가벼울수록여러곳에분포하고, 무거울수록분포가제한적임을알수있었다. 조사대학간최단, 평균및도보거리와출현외래종식물상의유사도분석에서최단거리와평균거리와의유의한상관관계가나타나지않았으나도보거리와는유의한음의상관이나타났다. 그러므로대학간의외래식물이전파되는정도는물리적인공간거리보다는실제로사람과물류가이동하는거리가중요함을알수있었다. 그러나상명대- 호서대간의거리가가장짧은데도불구하고단국대- 상명대의유사도지수가더큰이유는단국대학생이상명대쪽에서더많이생활하고있으며, 이두대학이고속도로와가장인접하게위치하여있고, 이들대학의중간에자리잡은천호지가이두학교간의외래종의구성을유사하게하는데기여하는것으로생각된다. 이러한결과는도시에서외래식물의분포는인구와상관이높다는연구결과 (Sullivan et al. 2004) 와일치하였다. 대학교정은인적이동이빈번한곳으로외래식물을주변지역으로확산시키는저장원 (sink) 과공급원 (source) 이될수있으므로, 주변지역으로외래식물이유입되는것을차단및관리하기위하여각별히주의해야한다. 또한본연구에서조사한대학의교정에는자연생태계에서정착한외래식물외에샤스타데이지, 다알리아, 숙근아스터와같은원예종이식재되어있었다. 이들은모두원예종으로알려져있기때문에조사대상외래식물에는포함하지않았으나, 식재장소이외의화단과나지에서도발견되는것으로보아이들원예종에대한확산연구도필요한것으로사료된다. 감사의글자료처리, 논문작성및원고교정에도움을주신인하대학교조강현교수에게감사드린다.
8 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): References An, W.S The Encyclopedia of Korean Crop Land-Race. Seoul, Korea. (in Korean) Chapin III, F.S., Zavaleta, E.S, Eviner, V.T., Naylor, R.L., Vitousek, P.M., Reynolds, H.L., Hooper, D.U., Lavorel, S., Sala, O.E., and Hobbie S.E Consequences of changing biodiversity. Nature 405: Didham, R.K., Tylianakis, J.M., Hutchison, M.A., Ewers, R.M., and Gemmell. N.J Are invasive species the drivers of ecological change? Trends in Ecology & Evolution 20: Grandin, U. and Rydin, H Attributes of the seed bank after a century of primary succession on islands in Lake Hjälmaren, Sweden. Journal of Ecology 86: Hopfensperger, K.N A review of similarity between seed bank and standing vegetation across ecosystems. Oikos 116: Kim, J.H., Lee, J.G., and Park, S.H Seeds Atlas of Korean Plants. Academic Books, Seoul, Korea. (in Korean) Kim, J.M., Lim, Y.J., and Jeon, E.S Naturalized Plants of Korea. Science Books, Seoul, Korea. (in Korean) Kim, Y.H. and Oh, C.H The dispersal and plant community characteristics of Magnolia obovata - focused on case of Korea UNESCO Peace Center area in Gyeonggi-do." Korean Journal of Environment and Ecology 23: (in Korean) KNA The Korean Plant Names Index. Korea National Arboretum. Accessed 10 January (in Korean) Lee, W.T Standard Illustrations of Korean Plants. Academy Press, Seoul, Korea. (in Korean) Lee, T.B. 2003a. Coloured Flora of Korea. Hyangmonsa, Seoul, Korea. (in Korean) Lee, M.Y. 2003b. Distribution of the Naturalized Plants in the Wetlands of Gyeongsangnamdo-Province in Korea. Master Disseration, Gyeongsang Graduate School of Education, Jinju, Korea. (in Korean) Lee, H.C., Han, J.S., Lee, W.C., and Yoo, K.O Flora and Vegetation of Southwest Chuncheon Area. Korean Journal of Environment and Ecology 22: (in Korean) Lee, Y.M., Park, S.h., Jung, S.Y., Oh, S.H., and Yang, J.C Study on the current status of naturalized plants in South Korea. Korean Journal of Plant Taxonomy 41: (in Korean) Lowe, S., Browne, M., Boudjelas, S., and Poorter, M.De of the World's Worst Invasive Alien Species: a Selection from the Global Invasive Species Database. Invasive Species Specialist Group, Auckland, New Zealand. Luken, J.O. and Thiert, J.W Assessment and Management of Plant Invasion. Springer, New York, USA. Park, S.H New Illustrations and Photographs of Naturalized Plants of Korea. Ilchokak, Seoul, Korea. (in Korean) Pimentel, D., Zuniga, R., and Morrison, D Update on the environmental and economic costs associated with alien-invasive species in the United States. Ecological Economics 52: Stroh, P.A., Hughes, F.M.R., Sparks, T.H., and Mountford, J.O The influence of time on the soil seed bank and vegetation across a landscape-scale wetland restoration project. Restoration Ecology 20: Stromberg, J., Hazelton, A., White, M., White, J., and Fischer, R Ephemeral wetlands along a spatially intermittent river: Temporal patterns of vegetation development. Wetlands 29: Sullivan, J.J., Williams, P.A., Cameron, E.K., and Susan M.T People and time explain the distribution of naturalized plants in New Zealand. Weed Technology 18: Sung, J.W., Kim, Y.J., Kwon, J.W., and Kim, K.H Analysis of characteristics of naturalized plants in reservoirs of Gyongsan-si. Journal of Agriculture and Life Science 48: (in Korean) Yoon, J.W., Shin, H.T., Yi, M.H., Kim, G.S., Sung, J.W., Park, K.H., Lee, C.H., and Kim, Y.S Status and management proposal of naturalized plants species within the cultural treasury area in Gyeongju National Park, Korea. Journal of Environment and Ecology 26: (in Korean)
9 88 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Appendix 1. List of plants species found on the university campuses in Cheonan, Korea. Korean name Scientific name Dankook Hoseo Sangmyung Baekseok 가는잎왕고들빼기 Lactuca indica for. indivisa 가막사리 Bidens tripartita 가시상추 Lactuca scariola 가죽나무 * Ailanthus altissima for. altissima 갈대 Phragmites australis 갈퀴꼭두서니 Rubia cordifolia var. pratensis 갈풀 Phalaris arundinacea 강아지풀 Setaria viridis var. viridis 개망초 * Erigeron annuus 개미자리 Sagina japonica 개밀 Agropyron tsukushiense var. transiens 개쑥갓 * Senecio vulgaris 고들빼기 Crepidiastrum sonchifolium 곰취 Ligularia fischeri 괭이밥 Oxalis corniculata 괭이사초 Carex neurocarpa 금방동사니 Cyperus microiria 긴병꽃풀 Glechoma grandis. 길골풀 Juncus tenuis 김의털 Festuca ovina var. ovina 까마중 Solanum nigrum var. nigrum 까치수염 Lysimachia barystachys 깨풀 Acalypha australis 꼬리풀 Veronica linariifolia for. linariifolia 꼭두서니 Rubia akane 꽃마리 Trigonotis peduncularis 꽃받이 Bothriospermum tenellum 꽃황새냉이 Cardamine amaraeformis 꿩의밥 Luzula capitata 끈끈이대나물 * Silene armeria 나도개피 Eriochloa villosa 나팔꽃 Pharbitis nil 눈괴불주머니 Corydalis ochotensis 다닥냉이 Lepidium apetalum 달맞이꽃 * Oenothera biennis 닭의장풀 Commelina communis 담쟁이덩굴 Parthenocissus tricuspidata 도깨비바늘 Bidens bipinnata 도라지 Platycodon grandiflorum 돌나물 Sedum sarmentosum 돌소리쟁이 * Rumex obtusifolius
10 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): Appendix 1. Continued. Korean name Scientific name Dankook Hoseo Sangmyung Baekseok 돌콩 Glycine soja 돌피 Echinochloa crusgalli var. crusgalli 돼지풀 * Ambrosia artemisiifolia 둥근마 Dioscorea bulbifera 둥근매듭풀 Kummerowia stipulacea 둥근잎미국나팔꽃 * Ipomoea hederacea var. integriuscula 들깨풀 Mosla punctulata 들묵새 * Festuca myuros 떡쑥 Gnaphalium affine 뚝새풀 Alopecurus aequalis 마 Dioscorea batatus 마디풀 Polygonum aviculare 말똥비름 Sedum bulbiferum 망초 * Conyza canadensis 매듭풀 Kummerowia striata 머루 Vitis coignetiae 멍석딸기 Rubus parvifolius for. parvifolius 메꽃 Calystegia sepium var. japonicum 며느리밑씻개 Persicaria senticosa var. senticosa 며느리배꼽 Persicaria perfoliata 명아주 Chenopodium album var. centrorubrum 모시물통이 Pilea mongolica 물골풀 Juncus gracillimus 물억새 Miscanthus sacchariflorus 미국가막사리 * Bidens frondosa 미국개기장 * Panicum dichotomiflorum. 미국나팔꽃 * Ipomoea hederacea var. hederacea 미국담쟁이덩굴 Parthenocissus quinquefolia 미국실새삼 * Cuscuta pentagona 미국쑥부쟁이 * Aster pilosus 미국자리공 * Phytolacca americana 민들레 Taraxacum platycarpum 바랭이 Digitaria ciliaris 바위취 Saxifraga stolonifera 박주가리 Metaplexis japonica 방가지똥 * Sonchus oleraceus 방동사니 Cyperus amuricus 배풍등 Solanum lyratum 뱀딸기 Duchesnea indica 벌씀바귀 Ixeris polycephala 벼룩나물 Stellaria alsine var. undulata
11 90 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Appendix 1. Continued. Korean name Scientific name Dankook Hoseo Sangmyung Baekseok 벼룩이자리 Arenaria serpyllifolia 봄맞이 Androsace umbellata 붉은씨서양민들레 * Taraxacum laevigatum 비노리 Eragrostis multicaulis 비수리 Lespedeza cuneata 뽀리뱅이 Youngia japonica 뽕모시풀 Fatoua villosa 사데풀 Sonchus brachyotus 사위질빵 Clematis apiifolia 산딸기 Rubus crataegifolius 산물통이 Pilea japonica 산박하 Isodon inflexus 산조풀 Calamagrostis epigeios 새완두 Vicia hirsuta 새팥 Vigna angularis var. nipponensis 서양민들레 * Taraxacum officinale 석류풀 Mollugo pentaphylla 선개불알풀 * Veronica arvensis 선씀바귀 Ixeris strigosa 선포아풀 Poa nemoralis 선피막이 Hydrocotyle maritima 섬기린초 Sedum takesimense 소리쟁이 * Rumex crispus 속속이풀 Rorippa palustris 속털개밀 Agropyron ciliare 솔나물 Galium verum var. asiaticum 쇠뜨기 Equisetum arvense 쇠무릎 Achyranthes japonica 쇠별꽃 Stellaria aquatica 쇠비름 Portulaca oleracea 쇠치기풀 Hemarthria sibirica 쑥 Artemisia princeps 쑥부쟁이 Aster yomena 씀바귀 Ixeridium dentatum 애기땅빈대 * Euphorbia supina 애기똥풀 Chelidonium majus var. asiaticum 애기메꽃 Calystegia hederacea 애기부들 Typha angustifolia 애기수영 * Rumex acetosella 얇은명아주 Chenopodium hybridum 양지꽃 Potentilla fragarioides var. major
12 S. Kim et al. / Ecol. Resil. Infrastruct. (2015) 2(1): Appendix 1. Continued. Korean name Scientific name Dankook Hoseo Sangmyung Baekseok 양지꽃 Potentilla fragarioides var. major 억새 Miscanthus sinensis var. purpurascens 엉겅퀴 Cirsium japonicum var. maackii 여뀌 Persicaria hydropiper var. hydropiper 여우주머니 Phyllanthus ussuriensis 오리새 * Dactylis glomerata 왕고들빼기 Lactuca indica 왕바랭이 Eleusine indica 왕씀배 Prenanthes ochroleuca 왕질경이 Plantago major var. japonica 왕포아풀 * Poa pratensis 유럽점나도나물 * Cerastium glomeratum 이고들빼기 Crepidiastrum denticulatum 이삭여뀌 Persicaria filiformis 인동덩굴 Lonicera japonica 자귀풀 Aeschynomene indica 잔개자리 * Medicago lupulina 잔디 Zoysia japonica 잔털제비꽃 Viola keiskei 제비꽃 Viola mandshurica 조개풀 Arthraxon hispidus 조록싸리 Lespedeza maximowiczii 조밥나물 Hieracium umbellatum 조뱅이 Breea segeta for. segeta 족제비싸리 * Amorpha fruticosa 좀명아주 * Chenopodium ficifolium 주걱개망초 * Erigeron strigosus 주름잎 Mazus pumilus 주름조개풀 Oplismenus undulatifolius var. undulatifolius 주홍서나물 * Crassocephalum crepidioides 중대가리풀 Centipeda minima 쥐보리 * Lolium multiflorum var. multiflorum 지면패랭이꽃 Phlox subulata 지치 Lithospermum erythrorhizon 지칭개 Hemistepa lyrata 진퍼리까치수염 Lysimachia fortunei 질경이 Plantago asiatica 차풀 Chamaecrista nomame 참새귀리 Bromus japonicus 참새피 Paspalum thunbergii 참쑥 Artemisia dubia
13 92 S. Kim et al. / Ecology and Resilient Infrastructure (2015) 2(1): Appendix 1. Continued. Korean name Scientific name Dankook Hoseo Sangmyung Baekseok 참억새 Miscanthus sinensis var. sinensis 창질경이 * Plantago lanceolata 청가시덩굴 Smilax sieboldii for. sieboldii 청미래덩굴 Smilax china 칡 Pueraria lobata 콩다닥냉이 * Lepidium virginicum 큰김의털 * Festuca arundinacea 큰방가지똥 * Sonchus asper 큰비짜루국화 * Aster subulatus var. sandwicensis 큰석류풀 * Mollugo verticillata 큰잎부들 Typha latifolia 큰피막이 Hydrocotyle ramiflora 털까마중 * Solanum sarrachoides 털도깨비바늘 Bidens biternata 털별꽃아재비 * Galinsoga ciliata 토끼풀 * Trifolium repens 패랭이꽃 Dianthus chinensis var. chinensis 포아풀 Poa sphondylodes 피 Echinochloa utilis 피막이 Hydrocotyle sibthorpioides 호밀풀 * Lolium perenne 환삼덩굴 Humulus japonicus 황새냉이 Cardamine flexuosa 흰명아주 * Chenopodium album 흰씀바귀 Ixeridium dentatum for. albiflora 흰여뀌 Persicaria lapathifolia var. lapathifolia Total No. species * Naturalized alien species
02(이인용)p fm
Weed Turf. Sci. 4(2):85~94 http://dx.doi.org/10.5660/wts.2015.4.2.85 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information03 .이인용( ).fm
Weed Turf. Sci. 5(3):126~135 http://dx.doi.org/10.5660/wts.2016.5.3.126 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both
More information04(오영주)p fm
Weed Turf. Sci. 3(4):276~283 http://dx.doi.org/10.5660/wts.2014.3.4.276 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information담양군 도래수마을의 식물상 조사 분석
담양군도래수마을의식물상조사분석 박미정 1, 최진아 1* 2 1, 이상화, 김은자, 전보배, 유준완 1 1 1. 국립농업과학원 2. 녹색마당 Vegetation Survey and Analysis in Damyang-gun Doraesoo Village Park Meejeong 1, Choi Jin-a 1*, Lee Sanghwa 2, Kim Eunja 1,
More information04. 이채영(71-81).fm
Weed Turf. Sci. 5(2):71~81 http://dx.doi.org/10.5660/wts.2016.5.2.71 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information03. 이인용2(65-70).fm
Weed Turf. Sci. 5(2):65~70 http://dx.doi.org/10.5660/wts.2016.5.2.65 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was red from both formerly
More information05(김창석)p fm
Weed Turf. Sci. 3(4):284~291 http://dx.doi.org/10.5660/wts.2014.3.4.284 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information차례
차례 표차례 優占度階級 群度階級 그림차례 - 1 - - 2 - - 3 - 표 2. 優占度階級 (Braun-Blanquet, 1964) 5 : 표본구면적의 3/4이상을덮고, 개체수는임의 4 : 1/2-3/4을덮고, 3 : 1/4-1/2을덮고, 2 : 개체수는많으나被度가낮다혹은산재하나被度는높다 ( 단1/10이다 ). + : 被度는낮고散在 r : 고립하여출현하고被度는극히낮다.
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information도감본문(수정)~10p
두번째이야기 덩굴나무 두번째이야기덩굴나무 6 00 Pinus densiflora Siebold & Zucc. 4 5 6 6 5 4 7 8 9 P. densiflora P. densiflora for. multicaulis P. densiflora for. erecta 0 6 산에서자주만나는큰키나무 덩굴나무 8 산에서자주만나는큰키나무 덩굴나무 덩굴나무차례 9
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information2(2): 87~97, JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN Flora around Gudeok Campsite, Busan Metropolitan City, Korea Yo
2(2): 87~97, 2016. 12. JOURNAL OF THE KOREAN INSTITUTE OF GARDEN DESIGN ISSN 2465-8146 Flora around Gudeok Campsite, Busan Metropolitan City, Korea You, Ju-Han ABSTRACT 국문초록 Corresponding author: You,
More informationArctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo Kyung Lee, Gyu Lee, Eun Ju Lee 다산과학기지 주변에서 볼 수 있는 북극 식물 Arctic Plants living in N
다산과학기지 주변에서 볼 수 있는북극 식물 Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard 북극식물-본문p001-019(0409).indd 1 2012-04-10 오후 4:36: Arctic Plants living in Ny-Ålesund and Longyearbyen, Svalbard by Yoo
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information<30322E20BABBB9AEC0FCC3BC2E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2014;33(2):86-102. Korean Online ISSN: 2233-4173 Published online 2014 June 17. http://dx.doi.org/10.5338/kjea.2014.33.2.86 Print ISSN:
More information이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park
이상훈 심재국 Vegetation of Mt. Yeonin Provincial Park Department of Life Science, Chung-Ang University The forest vegetation of Mt. Yeonin Provincial Park was surveyed from August 2016 to October 2016. The
More information(86-108).fm
Turf. Sci. 6(2):86~108 http://dx.doi.org/10.5660/wts.2017.6.2.86 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article & Turfgrass Science & Turfgrass Science was renamed from both formerly Korean
More information7(3)-03.fm
w» wz, 7«3y(2005) Korean Journal of Agricultural and Forest Meteorology, Vol. 7, No. 3, (2005), pp. 201~210 ½ 1 Á v 2 Á 2 Á 1 Á Ÿ 1 Á½ y 2 1 w ù, 2 w w (2005 2 15 ; 2005 8 19 ) The Vegetation Structure
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information인문사회과학기술융합학회
Asia-pacific Journal of Multimedia Services Convergent with Art, Humanities, and Sociology Vol.6, No.2, February (2016), pp. 325-332 http://dx.doi.org/10.14257/ajmahs.2016.09 한국의 대학운영제도 변화를 위한 K-MOOC 활용방안에
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information<30322D31312DB1E8B8EDC7F BFCFB7E1295F E31C4AEB6F328BFCF292E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric. 2015;34(2):77-90. Korean Online ISSN: 2233-4173 Published online 2015 March 23. http://dx.doi.org/10.5338/kjea.2015.34.2.11 Print ISSN:
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More informationfm
Vascular plant diversity and vegetation of Yokjido Island 97 Appendix 1. List of vascular plants investigated on Yokjido Island. Taxa / Collection number Selaginellaceae 부처손과 1. Selaginella rossii (Baker)
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 이두범 - 경주 목명과명출현종경주 (359014) 도엽특이사항영문한글영문한글학명국명 E7 Selaginellales 부처손목 Selaginellaceae 부처손과 Selaginella tamariscina 부처손 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More information................-......
International Workshop on Biodiversity Conservation and Sustainable Development in North-East Asia with emphasis on the Role of Gangwon Province 2014. 6. 18-20 International Workshop on Biodiveristy Conservation
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province S
류새한 박시룡 * 강상준 ** Riparian Vegetation and Bird Biotope of Urban Stream with Special Reference to Mushimcheon-River of Cheonju City, Chungbuk Province School of Science Education, College of Education, Chungbuk
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information< FC7D0C8B8BCF6C1A45FC7D1B1B9C7D1B0E6B3F3C7D0C8B D335F5F5FC7E3C1A4BFED20C4C3B7AFBFE4C3BB5F5F5F5F5FC0E5B9AEC0CD20C3D6C1BEBABB20B1E8C0E7BFB5C7D1C5D720B9DFBCDBBFE4B8C12E687770>
Korean Journal of Environmental Agriculture Korean J Environ Agric (2013) Online ISSN: 2233-4173 Vol. 32, No. 3, pp. 185-192 http://dx.doi.org/10.5338/kjea.2013.32.3.185 Print ISSN: 1225-3537 Research
More information특허청구의 범위 청구항 1 수세미오이, 라벤더, 양파, 천마, 야콘, 곰보배추, 꾸지뽕, 작약, 바질, 사위질빵, 엄나무, 쑥부쟁이, 두릅, 싸리나무, 왕고들빼기, 자리공, 쇠뜨기, 산초나무, 참취, 닭의장풀, 돌나물, 피마자, 적치커리, 고수, 비트 및 레몬밤의 산야
(19) 대한민국특허청(KR) (12) 공개특허공보(A) (51) 국제특허분류(Int. Cl.) C12N 9/00 (2006.01) C12P 21/04 (2006.01) A23L 1/305 (2006.01) (21) 출원번호 10-2013-0027290 (22) 출원일자 2013년03월14일 심사청구일자 전체 청구항 수 : 총 5 항 2013년03월14일 (11)
More information< FBDC4B9B05FC1BEB8F1B7CF2E786C73>
도엽별출현종 _ 통계 - 2012 년전국자연환경조사 - 식물 - 유기억 - 영월 목명과명출현종영월 (378142) 도엽특이사항영문한글영문한글학명국명 E6 Equisetales 속새목 Equisetaceae 속새과 Equisetum arvense 쇠뜨기 Filicales 고사리목 Dennstaedtiaceae 잔고사리과 Dennstaedtia wilfordii
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
More information50-5대지05장후은.indd
대한지리학회지 제50권 제5호 2015(515~526)? 인문사회계열의 산학협력과 지역발전: 일본 사례를 중심으로 장후은* 이종호** 허선영*** University-Industry Collaboration of Humanities and Social Sciences Majors and Regional Development: The Case of Japan
More information03¹ü¼±±Ô
Relevancy between Aliases of Eight Provinces and Topographical Features during the Chosun Dynasty Seon-Gyu Beom* Abstract : In Korea, aside from their official administrative names, aliases of each province
More information84 Journal of Agriculture & Life Science 47(5) Cheonbu-ri Buk-myeon, while there was the least number of 10 individuals(0.4%) in the newly found habit
농업생명과학연구 47(5) pp.83-94 Journal of Agriculture & Life Science 47(5) pp.83-94 울릉도섬현삼의새로운자생지보고및현지내 외보전전략 김수승 1 강기호 2 강신구 1 신현탁 3 조경호 2 김윤영 2 이명섭 2 양병훈 1* 1 산림청, 2 기청산식물원, 3 국립수목원 접수일 (2013 년 7 월 8 일 ), 수정일
More information<30362E20C6EDC1FD2DB0EDBFB5B4EBB4D420BCF6C1A42E687770>
327 Journal of The Korea Institute of Information Security & Cryptology ISSN 1598-3986(Print) VOL.24, NO.2, Apr. 2014 ISSN 2288-2715(Online) http://dx.doi.org/10.13089/jkiisc.2014.24.2.327 개인정보 DB 암호화
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information2 - [ 궁내중학교방문 (2008 년 6 월 13 일 ) ] [ 궁내중학교화단 ] [ 수리산 (2008 년 6 월 14 일 ) ] [ 수리산탐사 ] [ 덕계묘지입구 ] [ 산북동묘지관리소 ]
1 - 들꽃사랑동호회활동결과산출물 1. 탐사활동들꽃으로교정의화단이잘조성되어있는평촌의궁내중학교를 6월 14일방문하여현장학습을하고, 식물이학교교육에미치는영향에대하여심도있게토론을하였다. 궁내중학교의교장선생님이본연구회회원인탓도있지만, 뒷산이바로꽃이많은수리산이기때문에다음날은수리산생태탐사를계획하고 1박 2일로일정을추진하였다. 6월은꽃이뜸한계절이어서많은꽃을볼수는없었지만,
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information<31362DB3EDB5CF20BDC4BBFDC0C720BDC4B9B05F28B0ADBAB4C8AD2EBFC0BFB5C1D BFCFB7E1292E687770>
한국환경농학회지제27권제4 호 (2008) Korean Journal of Environmental Agriculture Vol. 27, No. 4, pp. 413-420 연구보문 논둑식생의식물사회학적군락분류 오영주 1) 손수인 2) 김창석 1) 김병우 3) 강병화 4)* 1) 국립농업과학원유기농업과, 2) 국립농업과학원생물안전성과, 3) 상지대학교생명과학과,
More information01이정훈(113~127)ok
The Role of Historical Relativity in International Exchange of Culture and Tourism at the Regional Level: A Case of Gyeonggi and Shandong Province Jung-hoon Lee** Kyung-Eun Choi*** Eun-Ja Lee****,.,,.,,.,,.,.,.,,,
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More information04±èºÎ¼º
Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept
More informationμ μ μ matk_193f trnk_670f matk_520r matk_1246r rbcl accd matk matk trnk (5 ) trnk (3 ) trnk_670f CTGTATCGCACTATGTATC matk_193f GTTATTCGAATGTATCAACAG matk_520r CTCATGCTTGCATTTATTACG matk_1246r CTTTCTCATTATTACAGCGG
More information2040 2010 6 11 - - - - - - 03 - -,,, - 08 8 15 < > - - -,, - / 04 2040 100,, -, 05 - -- - - KOREA 2040, 06 - - - - - - - 69(2010) 88(2040) - 2.56 2.10, 65 7.6% 14.2% 18% 15%, 65 16% 25% - -,, 56.7(2010)
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )
Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information<BFACBCBCC0C7BBE7C7D02831302031203139292E687770>
延 世 醫 史 學 제12권 제2호: 29-40, 2009년 12월 Yonsei J Med Hist 12(2): 29-40, 2009 특집논문 3 한국사회의 낙태에 대한 인식변화 이 현 숙 이화여대 한국문화연구원 1. 들어가며 1998년 내가 나이 마흔에 예기치 않은 임신을 하게 되었을 때, 내 주변 사람들은 모두 들 너무나도 쉽게 나에게 임신중절을 권하였다.
More information발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를 찾기 힘들 정도로 그 중요성과 가치가 큽
울주 대곡리 반구대 암각화 발굴조사보고서 BANGUDAE PETROGLYPH IN DAEGOK-RI, ULJOO EXCAVATION 발간사 반구대 암각화는 고래잡이 배와 어부, 사냥하는 광경, 다양한 수륙동물 등 약 300여점의 그림이 바위면에 새겨져 있는 세계적 암각화입니다. 오랜 기간 새겨진 그림들 가운데 고래를 잡는 배와 어부모습은 전 세계적으로 유례를
More information_ _ Reading and Research in Archaeology. _ Reading and Research in Korean Historical Texts,,,,,. _Reading and Research in Historical Materials from Ko
4. _ Culture of Korea: In the Present and the Past,.. _ Korean History and the Method of Psychoanalysis.,,. _ Politics and Ideas in Modern days Korea.,. _ Contemporary Korean History and International
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information204 205
-Road Traffic Crime and Emergency Evacuation - 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 Abstract Road Traffic Crime
More information. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )
. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Study on the Pe
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.405-425 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.405 * A Study on the Perceptions and Factors of Immigrant Background Youth
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information06(황선민)p fm
Weed Turf. Sci. 3(4):292~298 http://dx.doi.org/10.5660/wts.2014.3.4.292 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from both
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information401.fm
Journal of Korean Nature Vol. 3, No. 4 199-211, 2010 Classification Type of Vascular Plants in Yeohangsan, Muhaksan and Palyongsan, Masan Hyun-Kyung Oh 1 *, Hyun-Mi Kang 2 and Song-Hyun Choi 2 1 Department
More information27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
More information04(길지현)p fm
Weed Turf. Sci. 2(2):138~151, 2013 DOI:dx.doi.org/10.5660/WTS.2013.2.2.138 Print ISSN 2287-7924, Online ISSN 2288-3312 Research Article Open Access Weed & Turfgrass Science The Korean Society of Weed Science
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information, ( ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I ( ) *. ** ***
, 40 3 4 (2006 12 ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I. 1998. 2005 12 ( ) *. ** *** 2, 40 3 4 37.2%, 20 60%. 80%..,..,.,,, (SCB),,,.,..,, /,..
More information외떡잎식물 Monocotyledoneae
외떡잎식물 Monocotyledoneae 8 붓과 Iridaceae 등심붓 S E Sisyrinchium angustifolium Mill. Blue-eyed Grass 80 열매 높이 0~0cm 원산지 북아메리카 개화기 4~6월 결실기 5~7월 분포 제주도 다년생. 줄기는 모여나며 좁은 날개가 있다. 잎은 선형으 로 칼 모양이다. 은 지름 cm 내외이며 청자색이고
More information<303833315FC1A4BAB8B9FDC7D02031362D325FC3D6C1BEBABB2E687770>
개인정보보호법의 보호원칙에 대한 벌칙조항 연구 A Legal Study of Punishments in Terms of Principles of Private Informaion Protection Law 전동진(Jeon, Dong-Jin)*19) 정진홍(Jeong, Jin-Hong)**20) 목 차 Ⅰ. 들어가는 말 Ⅱ. OECD 개인정보 보호원칙과의 비교
More informationWeed Turf. Sci. 3(1):6~12 Print ISSN , Online ISSN Research Article Weed & Turfgrass Scien
Weed Turf. Sci. 3(1):6~12 http://dx.doi.org/10.5660/wts.2014.3.1.6 Print ISSN 22877924, Online ISSN 22883312 Research Article Weed & Turfgrass Science Weed & Turfgrass Science was renamed from formerly
More information