저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

Transcription

1 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우, 이저작물에적용된이용허락조건을명확하게나타내어야합니다. 저작권자로부터별도의허가를받으면이러한조건들은적용되지않습니다. 저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다. 이것은이용허락규약 (Legal Code) 을이해하기쉽게요약한것입니다. Disclaimer

2 Development of a novel chimeric lysin (gchap-lysk) against Staphylococcus aureus Staphylococcus aureus (gchap-lysk) ()

3 Development of a novel chimeric lysin (gchap-lysk) against Staphylococcus aureus A Thesis Submitted to the Graduate School in Partial Fulfillment of the Requirements for the Degree of Master in Veterinary Microbiology College of Veterinary Medicine The Graduate School Seoul National University By Jin-Mi Park February, 2019

4 Abstract Development of a novel chimeric lysin (gchap-lysk) against Staphylococcus aureus Jin-Mi Park (Supervisor: Jae-Hong Kim, D.V.M., Ph.D.) College of Veterinary Medicine The Graduate School Seoul National University The increasing prevalence of antibiotic-resistant isolates of Staphylococcus aureus has led to develop alternative antibiotics to treat these drug-resistant pathogens. As alternative antibiotics the lytic enzymes (lysins) produced by bacteriophages weaken

5 the integrity of thick peptidoglycan layer in the cell wall and induce destruction of bacterial body. The bacteriophage lysins are composed of two modular domains that are catalytic domain and cell wall binding domain. To date various chimeric lysins with potent antibacterial efficacies have been generated by shuffling bacteriophage lysin modules from different origins. In the present study, two chimeric lysins were generated by exchanging peptidase or amidase module of ϕk lysin with that of genomic autolysin gene, SsaA homologe or atl, of S. aureus (gchap-lysk and gami-lysk). The antibacterial activity of chimeric lysins was screened by using Escherichia coli S30 extract-based in vitro transcription and translation (IVTC/TL) and colony reduction test. The result show that the CFU of the codop-lysk- and gami-lysk-treated PMB4 did not decrease, but the CFU of gchap-lysk show a steep decrease after 30 or 60 min of incubation. The gchap-lysk, which confirmed the antibacterial activity by screening, was expressed in E. coli and purified by Ni-NTA chromatography. Purified gchap-lysk also reduced turbidity to colony forming units and Staphylococcus aureus (PMB4, strains from bovine mastitis).

6 Thus, the IVTC/TL method can be used for rapid identification of antibacterial activity of candidate chimeric lysins, and the novel chimeric lysin, gchap-lysk may be useful as a candidate antibiotics against bovine mastitis S. aureus. Keyword: Staphylococcus aureus, bacteriophage lysins, chimeric lysin, in vitro transcription/translation, E. coli expression, alternative antibiotics Student number:

7 Contents Abstract i Contents iv List of figures vi List of tables viii List of abbreviations ix 1. Introduction 1 2. Materials and methods 2.1. Bacterial strains Synthesize the codop-lysk gene Construction of chimeric lysin Sequencing and Sequence analysis In vitro transcription and translation of codop-lysk, gchap-lysk and gami-lysk Screening for antibacterial activity of codop-lysk, gchap-lysk and gami-lysk Expression of gchap-lysk and gami-lysk in E.coli 22

8 2.8. Antimicrobial activity testing for proteins recombinant expressed in E. coli SDS-PAGE and Western blot analysis Statistical analysis Results 3.1. Construction of chimeric lysin Antibacterial activity of chimeric lysin produced by IVTC/TL Optimized expression of gchap-lysk in E. coli Characterization of purified gchap-lysk from soluble fraction of E. coli Discussion References 52 58

9 List of Figures Figure 1. Figure 2. The schematic view of construction of the codop-lysk using PTDS The PCR reaction and temperature conditions for PTDS of the full length codop-lysk gene Figure 3. Schematic view of gchap-lysk and gami-lysk gene synthesis by SOE- PCR Figure 4. The preparation of DNA templates for IVTC/TL of codop-lysk, gchap-lysk and gami-lysk Figure 5. Figure 6. Figure 7. Establishment a method for testing antibacterial activity Amplification of six fragments and full-length codop-lysk by PCR Construction of chimeric lysins, gchap-lysk and gami-lysk by SOE-PCR Figure 8 Comparison of amino acid sequences of gchap and gami with corresponding modules of LysK Figure 9. Figure 10. Antibacterial activity of chimeric lysins produced by IVTC/TL SDS-PAGE of soluble fractions of L-arabinose-induced BL21 (DE3) gchap-lysk Figure 11. SDS-PAGE and Western blotting of gchap-lysk expressed in optimal condition

10 Figure 12. Antibacterial activity of gchap-lysk produced by E. coli expression in optimized condition Figure 13. Turbidity reduction assays of gchap-lysk produced by E. coli expression in optimal condition

11 List of Tables Table 1. Table 2. Primer sets for the synthesis of the codon-optimized LysK gene Primers used for the construction and in vitro transcription and translation of the chimeric lysins, gchap-lysk and gami-lysk Table 3. Relative antibacterial efficacy of semi-purified LysK-gCHAP against Staphylococcus aureus (PMB4 from bovine mastitis)

12 Abbreviations Bacteriophage Phage CFU Colony forming units CHAP Cysteine-and histidine-dependent amidohydrolase/peptidase E.coli Escherichia coli G+ bacteria Gram-positive bacteria IVTC/TL In vitro transcription and translation LysK ϕk lysin MIC Minimal inhibitory concentration MRSA Methicillin-resistant Staphylococcus aureus PCR Polymerase chain reaction PGH Peptidoglycan hydrolase PTDS PCR-based two-step DNA synthesis S.aureus Staphylococcus aureus SOE-PCR Splicing by Overlap Extension PCR SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel RBS Ribosome binding site TSA Tryptic soy agar TSB Tryptic soy broth VRSA Vancomycin-resistant Staphylococcus aureus

13 1. Introduction Staphylococcus aureus causes food poisoning and nosocomial infections in humans and economic losses by mastitis and arthritis in cows and poultry, respectively (Le Loir et al., 2003; Mutalib et al., 1983; Sutra and Poutrel, 1994; Thompson et al., 1982). Since the first report of methicillin-resistant S. aureus (MRSA) in 1961 it became one of the fatal bacterial threats in the world (MP, 1961; Thompson et al., 1982). Vancomycin is an antibiotic against it, but in 1997, it increased multi-drug resistant phenotypes with the advent of the vancomycin-resistant S. aureus (VRSA) (Arias and Murray, 2009; Hiramatsu et al., 1999). The massive use of antibiotics has let to increase in emergence of resistance to multiple antimicrobial agents in pathogenic bacteria. That has become a serious threat to public and animal health (Grundmann et al., 2006; Le Loir et al., 2003; Mutalib et al., 1983; Oliver et al., 1997; Sutra and Poutrel, 1994). A wide variety of bacteria can be involved, but especially in Gram-positive (G+) bacteria, including Staphylococcus aureus, Streptococcus agalactiae, and Streptococcus uberis are major causative agents of bovine mastitis

14 (Oliver et al., 1997; Wilson et al., 1997). Among them S. aureus is the most important and prevalent in bovine mastitis and dairy product-related food poisoning, and causes serious economic loss in dairy industry (Hiramatsu et al., 1999). Bacteriophages (phages) are bacteria-specific viruses that was discovered by Twort in 1915 (Twort, 1915) and d'herelle in 1917 (D Herelle, 1917) independently, and had been applied to treat bacterial infections. Prophylactic and preventive use of bacteriophage has recently become popular and successful as alternatives of conventional chemotherapy, but pathogenic host bacteria are required to produce bacteriophages. Phage lysins (endolysins) are a peptidoglycan hydrolase (PGH), which is a major component of the cell wall of G+ bacteria, which play important roles in breaking down the cell wall (Donovan, 2012; Loessner et al., 2002; López et al., 1992; Young, 1992). Functionally they are classified into 3 enzymatic categories, glucosidase (cleaving N-acetyl muramic acid and N-acetyl glucosamine linkage), amidase (cleaving N-acetyl muramic acid and L-alanine), peptidase (cleaving peptide bonds between cross-linking peptides of peptidoglycan). Phage lysin genes are strictly controlled and expressed in the cytoplasm at the late stage of phage replication cycle.

15 Phage lysins cannot moved through the cytoplasmic membrane for themselves and need the help of holins which form channels for transportation of phage lysins to peptidoglycan (Loessner, 2005; Pastagia et al., 2013). Therefore, it has been reported that phage lysins can be used as antibiotics by treating outside to G + bacteria (Fischetti, 2006). Lysins are composed of two modular, functional domains, N- terminal catalytic and C-terminal cell wall binding domain (Diaz et al., 1990). The N- terminal domain contains the catalytic activity to weaken integrity of peptidoglycan by cleaving specific bonds between components of peptidoglycan (Fischetti, 2005; Young, 1992). The C-terminal cell wall binding domain play role in specific binding of phage lysins to peptidoglycan ligands (Loessner et al., 2002; López et al., 1992). ϕk is a very virulent lytic phage of S. aureus classified into Family Myoviridae and the lysin of ϕk (LysK) has been applied as alternative antibiotics in itself or donor of modules for construction of chimeric lysins against S. aureus infections (Becker et al., 2008; Horgan et al., 2009; O'flaherty et al., 2005). LysK has the catalytic domain composed of two catalytic modules, cysteine-and histidine-dependent amidohydrolase/peptidase (CHAP) and amidase-2 modules (N-acetylmuramoyl L-

16 alanine amidase), and the cell wall binding domain (SH3b) (O'flaherty et al., 2005). The SH3b domain enhances the activity of the CHAP domain, but is not essential for CHAP lytic activity (Becker et al., 2015). In the absence of other domains, the amidase-2 and SH3b domains appear to have no significant lytic activity, while the CHAP domain retains lytic activity when they are expressed alone or in combination with others (Horgan et al., 2009). Therefore, the CHAP domain is essential for cell lysis and degradation of peptidoglycan (Horgan et al., 2009). SsaA homologue and atl are genomic peptidoglycan hydrolases and atl involved in the cell separation of S. aureus. (Oshida et al., 1995). The SsaA homologe is staphylococcal secretory antigen (Lang et al., 2000) and the major autolysin atl is one of the well-known surface protein from S. aureus and S. epidermidis (Biswas et al., 2006) The atl belong to a group of PGH that play a role in the degradation of the bacteria cell wall (De Las Rivas et al., 2002). The expression of autolysins are strictly controlled and conserved among strains, and the modules of autolysins may be useful resources for development of chimeric lysins. In addition to natural phage lysins chimeric lysins which are artificially

17 constructed by combining catalytic and cell wall binding modules from different origins have been developed, however, for antibacterial activity screening multiple candidate lysin genes must be expressed in Escherichia coli (Yang et al., 2014a). In addition recombinant phage lysins expressed in E. coli are usually insoluble and require further purification and concentration (Becker et al., 2016; Manoharadas et al., 2009; Sass and Bierbaum, 2007) Therefore, two novel chimeric lysins were constructed by exchanging CHAP or amidase modules of LysK with the corresponding modules of genomic autolysin genes, SsaA (gchap-lysk) or atl (gami-lysk) of S.aureus. The antibacterial activity of chimeric lysins were tested by using in vitro transcription/translation (IVTC/TL) and colony reduction test. To verify the observed antibacterial activity, the chimeric lysin genes were expressed in and purified from E. coli. Finally, the antibacterial activity of in vitro-expressed gchap-lysk was verified by E. coli expression/purification.

18 2. Materials and Methods Bacterial strains S. aureus Rosenbach strain (ATCC25923) was purchased from KCCM (Seoul, Korea) and used for genomic DNA purification to amplify lysin modules. PMB4 was isolated from bovine mastitic raw milk in Korea and used for antimicrobial activity test of recombinant lysin and chimeric lysins. PMB4 was characterized in the previous study to be genotype RST22-1/mPPT1-2 and spa type t4050 (Ko et al., 2018). Synthesis of the codop-lysk gene Based on the nucleotide sequence (NC_005880) of S. aureus-specific LysK the 1,485bp codop-lysk gene was synthesized by PCR-based two-step DNA synthesis (PTDS) as described previously (Xiong et al., 2004). For efficient E. coli expression, all of the codons were replaced with the most frequent codons of E. coli and the GC content was increased by replacing some codons with higher

19 GC content codon coding same amino acid. The nucleotide-length primers covering all the codop-lysk gene were designed to overlap 20 nucleotides between neighboring forward and reverse primers (Table 1). Table1. Primer sets for the synthesis of the codon-optimized LysK gene Primer (location) phikl-f (1-20) phikl-r ( ) phikl-p1 (1-46) phikl-p2 (26-72) phikl-p3 (53-100) phikl-p4 (79-124) phikl-p5 ( ) phikl-p6 ( ) phikl-p7 ( ) phikl-p8 ( ) phikl-p9( ) phikl-p10 ( ) phikl-p11 ( ) phikl-p12 ( ) phikl-p13 ( ) phikl-p14 ( ) phikl-p15 ( ) Nucleotide sequence (5 to 3') ATGGCAAAGACTCAGGCAGA TTTGAAAACACCCCATGCAAC ATGGCAAAGACTCAGGCAGAAATCAACAAACGTCTGGACGCATATG ATACGGAGAGTCAACAGTACCCTTTGCATATGCGTCCAGACGTTTGT GTACTGTTGACTCTCCGTATCGTGTTAAGAAAGCAACTTCTTATGACC CTGCTTCCATAACACCGAAAGACGGGTCATAAGAAGTTGCTTTCTT CTTTCGGTGTTATGGAAGCAGGTGCAATCGACGCAGACGGTTATTAT GTGATCAGGTCCTGACACTGTGCATGATAATAACCGTCTGCGTCGA CAGTGTCAGGACCTGATCACTGACTATGTTCTGTGGCTGACTGACA TGCGTTACCCCAAGTACGAACTTTGTTGTCAGTCAGCCACAGAACA TTCGTACTTGGGGTAACGCAAAAGACCAGATCAAACAGTCTTATGG TGTTTTCATGGATTTTGAAACCAGTACCATAAGACTGTTTGATCTG CTGGTTTCAAAATCCATGAAAACAAACCGTCTACTGTTCCGAAGAA CAGAAGTGAAAACTGCGATCCAACCCTTCTTCGGAACAGTAGACGG GATCGCAGTTTTCACTTCTGGTTCTTATGAACAGTGGGGTCATATC GTGTTACCACCGTCATAAACGATACCGATATGACCCCACTGTTCAT GTTTATGACGGTGGTAACACTTCTACTTTCACTATCCTGGAACAGA

20 phikl-p16 ( ) phikl-p17 ( ) phikl-p18 ( ) phikl-p19 ( ) phikl-p20 ( ) phikl-p21 ( ) phikl-p22 ( ) phikl-p23 (561-46) phikl-p24 ( ) phikl-p25 ( ) phikl-p26 ( ) phikl-p27 ( ) phikl-p28 ( ) phikl-p29 ( ) phikl-p30 ( ) phikl-p31 ( ) phikl-p32 ( ) phikl-p33 ( ) phikl-p34 ( ) phikl-p35 ( ) phikl-p36 ( ) phikl-p37 ( ) phikl-p38 ( ) phikl-p39 ( ) TTCTTGTTTGCATAACCGTTCCAGTTCTGTTCCAGGATAGTGAAAG GGAACGGTTATGCAAACAAGAAGCCGACTAAACGTGTTGACAACTAT TTCGATGAAATGAGTCAGACCATAATAGTTGTCAACACGTTTAGTCG GGTCTGACTCATTTCATCGAAATCCCGGTTAAAGCAGGTACTACTGT CAGACTTCTTTGCAGTTTCCTTCTTAACAGTAGTACCTGCTTTAACC AGGAAACTGCAAAGAAGTCTGCATCTAAAACTCCGGCACCGAAGAA TCTTAGAAACTTTCAGAGTTGCCTTTTTCTTCGGTGCCGGAGTTTT GGCAACTCTGAAAGTTTCTAAGAACCACATCAACTATACTATGGACA ATACCTTCCGGTTTCTTACCACGTTTGTCCATAGTATAGTTGATGTG GGTAAGAAACCGGAAGGTATGGTTATCCATAACGACGCAGGTCGTT AGAGTTTTCATACTGCTGACCAGAAGAACGACCTGCGTCGTTATGG GGTCAGCAGTATGAAAACTCTCTGGCAAACGCAGGTTATGCACGTT CCATAATAATGTGCGATACCGTTTGCATAACGTGCATAACCTGCGTTT ACGGTATCGCACATTATTATGGTTCTGAAGGTTATGTTTGGGAAGCA ATGCGATCTGGTTCTTTGCGTCGATTGCTTCCCAAACATAACCTTC CGCAAAGAACCAGATCGCATGGCATACTGGTGACGGTACTGGTGCA ACCTGCGAAACGGAAGTTACCAGAGTTTGCACCAGTACCGTCACCA GTAACTTCCGTTTCGCAGGTATCGAAGTTTGTCAGTCTATGTCTGC CGTTCTTCAGGAACTGTGCGTCAGATGCAGACATAGACTGACAAAC CGCACAGTTCCTGAAGAACGAACAGGCAGTTTTCCAGTTCACTGCAG AGTCAGACCCCATTCCTTGAACTTTTCTGCAGTGAACTGGAAAACT TCAAGGAATGGGGTCTGACTCCGAACCGTAAGACTGTTCGTCTGCA GACATGCAGTCGGAACGAATTCCATATGCAGACGAACAGTCTTACG ATTCGTTCCGACTGCATGTCCGCATCGTTCTATGGTTCTGCATACT

21 phikl-p40 ( ) phikl-p41 ( ) phikl-p42 ( ) phikl-p43 ( ) phikl-p44 ( ) phikl-p45 ( ) phikl-p46 ( ) phikl-p47 ( ) phikl-p48 ( ) phikl-p49 ( ) phikl-p50 ( ) phikl-p51 ( ) phikl-p52 ( ) phikl-p53 ( ) phikl-p54 ( ) phikl-p55 ( ) phikl-p56 ( ) phikl-p57 ( ) GACCCTGAGTAACCGGGTTGAAACCAGTATGCAGAACCATAGAACG AACCCGGTTACTCAGGGTCGTCCGTCTCAGGCAATCATGAACAAAC GATCTGCTTGATGAAATAGTCCTTCAGTTTGTTCATGATTGCCTGAG GGACTATTTCATCAAGCAGATCAAGAACTACATGGACAAGGGTACTT TACCGTCTTTAACGACAGTAGAAGAAGAAGTACCCTTGTCCATGTAG CTACTGTCGTTAAAGACGGTAAAACTTCTTCTGCATCTACTCCGGCA CTTCCAAGAACCAGTAACCGGACGAGTTGCCGGAGTAGATGCAGAA CGGTTACTGGTTCTTGGAAGAAAAACCAGTACGGTACTTGGTATAA CCGTTAACGAAAGTTGCGTTTTCCGGTTTATACCAAGTACCGTACTGG AAACGCAACTTTCGTTAACGGTAACCAGCCGATCGTTACTCGTATC AACCGGTGCGTTCAGGAACGGAGAACCGATACGAGTAACGATCGGCT GTTCCTGAACGCACCGGTTGGTGGTAACCTGCCGGCAGGTGCAACTAT GCCTGGATACAAACTTCGTCATAAACGATAGTTGCACCTGCCGGCA GACGAAGTTTGTATCCAGGCAGGTCATATCTGGATCGGTTATAACGC GACAATAAACACGGTTACCGTTATATGCGTTATAACCGATCCAGATA ACGGTAACCGTGTTTATTGTCCGGTTCGTACTTGTCAGGGTGTTCC CATGCAACACCCGGGATCTGGTTCGGCGGAACACCCTGACAAGTAC AGATCCCGGGTGTTGCATGGGGTGTTTTCAAA For PTDS of the codop-lysk, the primers were divided into six groups (F1~F6) and each fragment was amplified by PCR (Figure 1A). The PCR mixture was composed of 5 μl of 10 reaction buffer, dntps (10 mm, 1 μl), Exprime Taq

22 DNA polymerase (5 U/μl; Genet Bio, Daejeon, Korea; 1 μl), each primer set (F1~F6) mix (0.5 pmol/μl, 10 μl of each), distilled water (33 μl). The mixture was incubated at 94 C for 1 min; 15 cycles at 94 C for 20 s; 54 C for 20 s; and 72 C for 20 sec with a final extension step at 72 C for 1min. To obtain five 275~282bp and one 193bp fragments, the forward and reverse primers of each fragment was added and additional 30 cycles of PCR (94 C for 20 sec and 72 C for 30 sec) was performed. (Figure 2A). The PCR amplicons of six fragments were purified using the MEGAquick-spin TM Total Fragment DNA Purification Kit (intron Bio. Co., Seongnam, Korea) and the purified six fragments were assembled by PCR (Fig. 1B).

23 Figure 1. The schematic view of construction of the codop-lysk using PTDS. The primers of 46~48-mer oligonucleotides are overlapped each other and covered all the length of codop-lysk. The codop-lysk was divided into 6 fragments (F1~F5, 275~282bp and F6, 193bp) and each fragment was amplified

24 independently (A). To obtain the full length 1,485bp codop-lysk gene, the purified 6 fragments and phikl-f/phikl-r primers were mixed and amplified using PCR (B). The PCR mixture was composed of 5 μl of 10 reaction buffer, dntps (10 mm, 1 μl), Exprime Taq DNA polymerase (5 U/μl; Genet Bio, Daejeon, Korea; 1 μl), fragment mix (F1~F6) (1μl for each fragment, 6 μl of fragment mix), distilled water (37 μl). The mixture was incubated under the same PCR1 condition. To obtain the full length 1,485bp codop-lysk gene, the phikl-f and phikl-r primer set were added and PCR2 was performed in further (Figure 2B).

25 Figure 2. The PCR reaction and temperature conditions for PTDS of the full length codop-lysk gene. (A) The synthesis and amplification of 6 fragments of codop-lysk. (B) The synthesis of the 1485bp full length codop-lysk gene.

26 Construction of chimeric lysins S. aureus Rosenbach strain was grown overnight in tryptic soy broth (TSB, BD Co., Sparks, MD) at 37 C and genomic DNA was extracted from 1ml of TSB culture using a G-spin TM For Bacteria Genomic DNA Extraction Kit (intron Bio. Co., Seongnam, Korea) according to the manufacturer s instruction. Two chimeric lysin genes, gchap-lysk and gami-lysk were generated using splicing by overlap Extension PCR (SOE-PCR) (Figure 3) as described previously (Horton et al., 1993). The 1,338bp gchap-lysk gene was constructed by fusion of the amplified CHAP domain of secretory antigen SsaA homologue (CHAP domain-containing protein, ) from Rosenbach strain gdna, and amidase/cell binding domain of codop-lysk ( ) by SOE- PCR (Figure 3A). The 1,344bp gami-lysk was constructed by fusion of amplified CHAP domain of codop-lysk (1-516), amidase domain of atl from S. aureus gdna ( ), and amidase/ cell wall binding domain of codop-lysk ( ) by SOE-PCR (Figure 3B).

27 Figure 3. Schematic view of gchap-lysk and gami-lysk gene synthesis by SOE-PCR. Two chimeric lysin genes, (A) gchap-lysk (1,338 bp) and (B) gami-lysk (1,344 bp), were generated by fusing the amplified CHAP domain of secretory antigen SsaA homologue (1-454) and amidase/ cell binding domain of codop-lysk ( ), and the CHAP domain of codop-lysk (1-516), amidase

28 domain of atl ( ), and cell wall binding domain of codop-lysk ( ) using SOE-PCR. The primers used to construct gchap-lysk and gami-lysk by SOE- PCR are shown in Table 2.

29 Table 2. Primers used for the construction and in vitro transcription and translation of the chimeric lysins, gchap-lysk and gami-lysk Primer Sequence (5 to 3 ) Usage CHAPATG-F ATGGCATCATCTTTTAATCACCAA gchap amplification gchap-lysk SOE-PCR CHAPKL-R TTCCTTCTTAACAGTAGTACCTGCATGG gchap amplification ATGAATGCATAGCTAGA KL-gCHAP-F GCAGGTACTACTGTTAAGAAGG LysK Ami-SH amplification phikl-r a b TTTGAAAACACCCCATGCAAC LysK Ami-SH amplification LysK SH amplification gchap-lysk SOE-PCR gami-lysk SOE-PCR RBSgCHAP-LysK-F GGGTTAACTTTAAGAAGGAGATATACA 1st IVTC/TL PCR for gchap- a TATGGCATCATCTTTTAATCACCAA LysK gamilink-f GCAGGTACTACTGTTAAGAAGGAACCT gami (atl) amplification AAATACGCATACCGTAAC gamilink-r AACGACAGTAGAAGAAGAAGTACCGTC gami (atl) amplification ATATAATTGATCATAACT phikl-f ATGGCAAAGACTCAGGCAGA LysK CHAP amplification gami-lysk SOE-PCR KLCHPA-R TTCCTTCTTAACAGTAGTACC LysK CHAP amplification KLSH3-F GGTACTTCTTCTTCTACTGTC LysK SH amplification RBSgAmi-LysK-F GGGTTAACTTTAAGAAGGAGATATACAT ATGGCAAAGACTCAGGCAGA 1st IVTC/TL PCR for gami- LysK T7-RBS-com-F b GGATCCTAATACGACTCACTATAGGGTTA ACTTTAAGAAGGAGATATAC 2 nd IVTC/TL PCR for both a 1st IVTC/TL PCR for both b 2 nd IVTC/TL PCR for both

30 The SOE-PCR mixture was composed of 5 μl of 10 reaction buffer, dntps (10 mm, 2.5 μl), Exprime Taq DNA polymerase (5 U/μl; Genet Bio, Daejeon, Korea; 0.5 μl), forward and reverse primers (10 pmol/μl, 1.25 μl of each), distilled water (38.5 μl), and template DNA (50 ng/μl, 1 μl). The mixture was incubated at 94 C for 5 min; 35 cycles at 94 C for 30 s; 54 C for 30 s; and 72 C for 2min with a final extension step at 72 C for 5 min. The PCR amplicons were purified using the MEGAquick-spin TM Total Fragment DNA Purification Kit (intron Bio. Co., Seongnam, Korea). The purifided gchap-lysk and gami- LysK genes were cloned into TOPO-TA cloning and transformed into RBC HIT DH-5a (RH617) competent cells as manufacturer s recommendation. Sequencing and Sequence analysis The cloned gchap-lysk and gami-lysk genes were sequenced with sequencing primers (CHAPATG-F/phiKL-R for gchap-lysk and phikl- F/phiKL-R for gami-lysk) using an ABI3711 automatic sequencer (Macrogen, Seoul, Korea). Nucleotide similarity, variable nucleotide comparisons, and

31 translation of nucleotide sequences were performed with Bioedit software version (Ibis Biosciences, Carlsbad, CA). The molecular weight and isoelectric point were predicted using Compute pi/mw program ( In vitro transcription and translation of codop-lysk, gchap- LysK and gami-lysk The template DNA of codop-lysk, gchap-lysk and gami-lysk for in vitro transcription and translation was prepared by amplification using the primer sets in Table 2. The T7 promoter and ribosome binding site (RBS) were inserted into the amplified template using standard PCR methods (Figure 4). In the 1 st PCR step to prepare the IVTC/TL template, RBS was attached to the original template using the RBS-gene specific primer. The amplicon with RBS was performed using RBSgCHAP-LysK-F or RBSgAmi-LysK-F, and phikl-r primers. In the 2 nd PCR step, the T7 promoter was attached in front of the RBS using T7-RBS-com-F and phikl-r primers. The final amplicons were purified

32 by using a gel extraction kit (intron Bio. Co., Seongnam, Korea) per the manufacturer s protocol. IVTC/TL was performed with E. coli S30 extract system for linear templates (Promega, Madison, WI, US) per the manufacturer s protocol. Briefly, 20 μl of S30 premix, 2.5 μl of amino acid mixture minus cysteine, 2.5 μl of amino acid mixture minus methionine, 15 μl S30 extract, template DNA of codop-lysk, gchap-lysk, or gami-lysk (>1 μg), and nuclease-free water were mixed to 50 μl final reaction volume, and incubated at 37 C for 2 hours and stop on ice for 5minutes. Figure 4. The preparation of DNA templates for IVTC/TL of codop-lysk, gchap-lysk and gami-lysk.

33 Screening for antibacterial activity of codop-lysk, gchap- LysK, and gami-lysk The overnight culture of PMB4 was diluted with TSB to about 1.5 x 10 2 colony forming units (CFU) of PMB4/90μl and mixed with the 10 μl of no DNA template reaction (negative control), codop-lysk, gchap-lysk or gami-lysk IVTC/TL products. After incubation for 0, 30 or 60 min at 37ºC each mixture was spreaded on three tryptic soy agar plates (TSA, BD Co.) and incubated overnight at 37 ºC (Figure 5). Then, CFU of each sample was counted and the average CFU was calculated. The experiments were independently repeated. Figure 5. The established method for testing antibacterial activity.

34 Expression of gchap-lysk and gami-lysk in E. coli To verify the observed antibacterial activities the gchap-lysk and gami-lysk genes were cloned into the pbad expression vector with C-terminal 6X His tag using the pbad TOPO TA cloning kit and transformed into One Shot TOP10 competent cells (Thermo Fisher Scientific Inc.,CA,USA). The insert sequences were confirmed by sequencing and the pbad vectors bearing chimeric lysins genes were transformed to E. coli BL21 (DE3) per the manufacturer s protocol expression (New England BiolabsEB, Ipswich, MA). Transformed BL21 (DE3) was grown aerobically in LB broth (Duchefa Biochemie, Netherlands) containing 100 μl/ml ampicillin (SIGMA-ALDRICH Co., USA) at 37ºC with shaking (200rpm). At mid-log phage (optical density at 600nm [OD600] of 0.5), protein expression was induced with L-arabinose. In order to determine the optimal expression conditions of soluble gchap-lysk, the concentrations of L-arabinose, 0.2%, 0.02%, 0.002%, %, % and 0% (negative condition) and temperature/incubation time were tested. L- arabinose-induced E. coli (100 ml) was harvested by centrifugation at 2,500 xg

35 for 30 min at 4ºC, and washed twice with 30 ml of sterilized distilled water. Then, the pellet was resuspended in 50 ml of lysis buffer (50 mm NaH2PO4, 300 mm NaCl, ph 8.0) with 1 tablet of protease cocktail (Roche, Basel, Switzerland), and sonicated. After centrifugation at 2,500 xg for 30 min at 4ºC, the soluble recombinant protein in the supernatant was purified using the ProBond Purification System kit (Thermo Fisher Scientific Inc., CA, USA) according to the manufacturer s protocol. The supernatant (8ml) of soluble recombinant protein was incubated with 2 ml of Ni-NTA resin for 1 hour. After washing 3 times with 8 ml native wash buffer (50 mm NaH2PO4, 300 mm NaCl, 20 mm imidazole, ph 8.0), the resin-bound recombinant proteins were eluted with native elution buffer (50 mm NaH2PO4, 300 mm NaCl, 250 mm imidazole, ph 8.0). Sixteen fractions (500 μl of each fraction) of eluted proteins were collected and the protein amount was measured by SMART TM Micro BCA protein assay kit (intron Bio. Co., Seongnam, Korea) as per the manufacturer s protocol.

36 Antimicrobial activity testing for recombinant proteins expressed in E. coli To test the antibacterial activity of purified gchap-lysk and gami- LysK, I selected 3 fractions of each sample (induced and uninduced gchap- LysK and induced gami-lysk) to pool (2 nd, 3 rd, and 4 th ) and fileted with 0.45 μm syringe filter. The purified recombinant proteins (50 μl) and diluted overnight culture of PMB4 in TSB (50 μl) were mixed and plated on TSA plate after incubation for 0, 30 or 60 min at 37ºC. After overnight incubation at 37ºC CFU was compared. As a negative control same volume of elution buffer was added. Turbidity assay was performed with PMB4 grown to mid-log phage in TSB at 37ºC with shaking. The purified recombinant protein (100 μl, induced and uninduced gchap-lysk) and 100 μl of PMB4 were mixed, and optical density (570nm) was measure at every 2 min for 60 min on a TECAN infinite200 pro machine (Tecan Benelux bv, Giessen, Netherlands).

37 SDS-PAGE and Western blot analysis Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed to estimate the molecular weight of recombinant protein and purity after purification. The purified recombinant protein (20 μl) and 5 μl of 5X sample buffer were mixed and boiled at 100ºC for 7min. Then, 20 μl of mixture was loaded at NuPAGE TM 4-12% Bis-Tris Protein Gel 1.0mm (Thermo Fisher Scientific Inc.,CA,USA.) and electrophoresed at 60V for 1h in mini Gel tank (Thermo Fisher Scientific Inc.,CA,USA.). To confirm the presence of gchap-lysk protein, western blotting was performed using an anti-histidine antibody (Thermo Fisher Scientific Inc., CA, USA). The protein were resolved by SDS-PAGE and transferred to an Immobilon-P membrane (Thermo Fisher Scientific Inc., CA, USA) for 7min. After blocking with 5 % (w/v) skimmed milk in TBS (milk/tbs), the membrane was incubated with 2000-fold diluted HRP-conjugated anti 6 histidine mouse monoclonal antibody in 1% skimmed milk in TBS for 1h at room temperature. After washing in TBS three times the blots were incubated with TMB solutions.

38 Statistical analysis The significance of gchap-lysk antibacterial activity was assessed by Student's t-test (IBM SPSS Statistics ver.23; IBM, USA, confidence interval of 95%).

39 3. Results Construction of chimeric lysins The 6 fragments to construct codop-lysk were successfully amplified and they were combined into codop-lysk (1,485bp) after PTDS (Figure 6). The GC content of codop-lysk was increased from 43% to 45% by replacing the codons, CAT196CAC, AAA360AAG, AAA365AAG, TAT370TAC, AAA373AAG and GTT380GTC. Figure 6. Amplification of six fragments and full-length codop-lysk by PCR.

40 According to nucleotide sequencing of cloned codop-lysk gene, the nucleotide and amino acid sequences of codop-lysk (54.7KDa, pi9.5) were correct as below. 1 ATG GCA AAG ACT CAG GCA GAA ATC AAC AAA CGT CTG GAC GCA TAT 45 1 Met Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr GCA AAG GGT ACT GTT GAC TCT CCG TAT CGT GTT AAG AAA GCA ACT Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Val Lys Lys Ala Thr TCT TAT GAC CCG TCT TTC GGT GTT ATG GAA GCA GGT GCA ATC GAC Ser Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp GCA GAC GGT TAT TAT CAT GCA CAG TGT CAG GAC CTG ATC ACT GAC Ala Asp Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp TAT GTT CTG TGG CTG ACT GAC AAC AAA GTT CGT ACT TGG GGT AAC Tyr Val Leu Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn GCA AAA GAC CAG ATC AAA CAG TCT TAT GGT ACT GGT TTC AAA ATC Ala Lys Asp Gln Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile CAT GAA AAC AAA CCG TCT ACT GTT CCG AAG AAG GGT TGG ATC GCA His Glu Asn Lys Pro Ser Thr Val Pro Lys Lys Gly Trp Ile Ala GTT TTC ACT TCT GGT TCT TAT GAA CAG TGG GGT CAT ATC GGT ATC Val Phe Thr Ser Gly Ser Tyr Glu Gln Trp Gly His Ile Gly Ile GTT TAT GAC GGT GGT AAC ACT TCT ACT TTC ACT ATC CTG GAA CAG Val Tyr Asp Gly Gly Asn Thr Ser Thr Phe Thr Ile Leu Glu Gln 135

41 406 AAC TGG AAC GGT TAT GCA AAC AAG AAG CCG ACT AAA CGT GTT GAC Asn Trp Asn Gly Tyr Ala Asn Lys Lys Pro Thr Lys Arg Val Asp AAC TAT TAT GGT CTG ACT CAT TTC ATC GAA ATC CCG GTT AAA GCA Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu Ile Pro Val Lys Ala GGT ACT ACT GTT AAG AAG GAA ACT GCA AAG AAG TCT GCA TCT AAA Gly Thr Thr Val Lys Lys Glu Thr Ala Lys Lys Ser Ala Ser Lys ACT CCG GCA CCG AAG AAA AAG GCA ACT CTG AAA GTT TCT AAG AAC Thr Pro Ala Pro Lys Lys Lys Ala Thr Leu Lys Val Ser Lys Asn CAC ATC AAC TAT ACT ATG GAC AAA CGT GGT AAG AAA CCG GAA GGT His Ile Asn Tyr Thr Met Asp Lys Arg Gly Lys Lys Pro Glu Gly ATG GTT ATC CAT AAC GAC GCA GGT CGT TCT TCT GGT CAG CAG TAT Met Val Ile His Asn Asp Ala Gly Arg Ser Ser Gly Gln Gln Tyr GAA AAC TCT CTG GCA AAC GCA GGT TAT GCA CGT TAT GCA AAC GGT Glu Asn Ser Leu Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn Gly ATC GCA CAT TAT TAT GGT TCT GAA GGT TAT GTT TGG GAA GCA ATC Ile Ala His Tyr Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile GAC GCA AAG AAC CAG ATC GCA TGG CAT ACT GGT GAC GGT ACT GGT Asp Ala Lys Asn Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly GCA AAC TCT GGT AAC TTC CGT TTC GCA GGT ATC GAA GTT TGT CAG Ala Asn Ser Gly Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln TCT ATG TCT GCA TCT GAC GCA CAG TTC CTG AAG AAC GAA CAG GCA Ser Met Ser Ala Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala 300

42 901 GTT TTC CAG TTC ACT GCA GAA AAG TTC AAG GAA TGG GGT CTG ACT Val Phe Gln Phe Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr CCG AAC CGT AAG ACT GTT CGT CTG CAT ATG GAA TTC GTT CCG ACT Pro Asn Arg Lys Thr Val Arg Leu His Met Glu Phe Val Pro Thr GCA TGT CCG CAT CGT TCT ATG GTT CTG CAT ACT GGT TTC AAC CCG Ala Cys Pro His Arg Ser Met Val Leu His Thr Gly Phe Asn Pro GTT ACT CAG GGT CGT CCG TCT CAG GCA ATC ATG AAC AAA CTG AAG Val Thr Gln Gly Arg Pro Ser Gln Ala Ile Met Asn Lys Leu Lys GAC TAT TTC ATC AAG CAG ATC AAG AAC TAC ATG GAC AAG GGT ACT Asp Tyr Phe Ile Lys Gln Ile Lys Asn Tyr Met Asp Lys Gly Thr TCT TCT TCT ACT GTC GTT AAA GAC GGT AAA ACT TCT TCT GCA TCT Ser Ser Ser Thr Val Val Lys Asp Gly Lys Thr Ser Ser Ala Ser ACT CCG GCA ACT CGT CCG GTT ACT GGT TCT TGG AAG AAA AAC CAG Thr Pro Ala Thr Arg Pro Val Thr Gly Ser Trp Lys Lys Asn Gln TAC GGT ACT TGG TAT AAA CCG GAA AAC GCA ACT TTC GTT AAC GGT Tyr Gly Thr Trp Tyr Lys Pro Glu Asn Ala Thr Phe Val Asn Gly AAC CAG CCG ATC GTT ACT CGT ATC GGT TCT CCG TTC CTG AAC GCA Asn Gln Pro Ile Val Thr Arg Ile Gly Ser Pro Phe Leu Asn Ala CCG GTT GGT GGT AAC CTG CCG GCA GGT GCA ACT ATC GTT TAT GAC Pro Val Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile Val Tyr Asp GAA GTT TGT ATC CAG GCG GGT CAT ATC TGG ATC GGT TAT AAC GCA Glu Val Cys Ile Gln Ala Gly His Ile Trp Ile Gly Tyr Asn Ala 465

43 1396 TAT AAC GGT AAC CGT GTT TAT TGT CCG GTT CGT ACT TGT CAG GGT Tyr Asn Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys Gln Gly GTT CCG CCG AAC CAG ATC CCG GGT GTT GCA TGG GGT GTT TTC AAA Val Pro Pro Asn Gln Ile Pro Gly Val Ala Trp Gly Val Phe Lys 495

44 The chimeric lysins, gchap-lysk (1,338bp) and gami-lysk (1,344bp) were successfully amplified by SOE-PCR and their nucleotide and amino acid sequences were confirmed (Figure 7). The expected molecular weight and isoelectric point of gchap-lysk and gami-lysk were 49.0KDa/9.5 and 49.6KDa/8.4, respectively. Figure 7. Construction of chimeric lysins, gchap-lysk and gami-lysk by SOE-PCR. Lanes 1: codop-lysk (1,485bp), M: molecular weight marker (1kb), 2: gchap-lysk (1,388bp), 3: gami-lysk (1,344bp).

45 According to nucleotide sequencing of amplified gchap-lysk (1,388bp) gene, the nucleotide and amino acid sequences of the gchap-lysk (49.0KDa, pi 9.5) were correct as below. 1 ATG GCA TCA TCT TTT AAT CAC CAA AAT TTA TAC ACT GCT GGT CAA 45 1 Met Ala Ser Ser Phe Asn His Gln Asn Leu Tyr Thr Ala Gly Gln TGT ACA TGG TAC GTA TTT GAC CGT CGT GCT CAA GCT GGT AGT CCA Cys Thr Trp Tyr Val Phe Asp Arg Arg Ala Gln Ala Gly Ser Pro ATT AGC ACA TAT TGG TCA GAC GCT AAG TAT TGG GCT GGT AAC GCA Ile Ser Thr Tyr Trp Ser Asp Ala Lys Tyr Trp Ala Gly Asn Ala GCT AAT GAT GGT TAC CAA GTA AAC AAC ACA CCA TCA GTT GGT TCA Ala Asn Asp Gly Tyr Gln Val Asn Asn Thr Pro Ser Val Gly Ser ATT ATG CAA AGC ACA CCT GGT CCA TAT GGT CAT GTT GCT TAT GTT Ile Met Gln Ser Thr Pro Gly Pro Tyr Gly His Val Ala Tyr Val GAA CGT GTC AAT GGT GAT GGT AGT ATC TTG ATT TCT GAA ATG AAT Glu Arg Val Asn Gly Asp Gly Ser Ile Leu Ile Ser Glu Met Asn TAC ACA TAT GGT CCA TAC AAT ATG AAC TAC CGT ACA ATT CCA GCT Tyr Thr Tyr Gly Pro Tyr Asn Met Asn Tyr Arg Thr Ile Pro Ala TCA GAA GTT TCT AGC TAT GCA TTC ATC CAT GCA GGT ACT ACT GTT Ser Glu Val Ser Ser Tyr Ala Phe Ile His Ala Gly Thr Thr Val AAG AAG GAA ACT GCA AAG AAG TCT GCA TCT AAA ACT CCG GCA CCG Lys Lys Glu Thr Ala Lys Lys Ser Ala Ser Lys Thr Pro Ala Pro 135

46 406 AAG AAA AAG GCA ACT CTG AAA GTT TCT AAG AAC CAC ATC AAC TAT Lys Lys Lys Ala Thr Leu Lys Val Ser Lys Asn His Ile Asn Tyr ACT ATG GAC AAA CGT GGT AAG AAA CCG GAA GGT ATG GTT ATC CAT Thr Met Asp Lys Arg Gly Lys Lys Pro Glu Gly Met Val Ile His AAC GAC GCA GGT CGT TCT TCT GGT CAG CAG TAT GAA AAC TCT CTG Asn Asp Ala Gly Arg Ser Ser Gly Gln Gln Tyr Glu Asn Ser Leu GCA AAC GCA GGT TAT GCA CGT TAT GCA AAC GGT ATC GCA CAT TAT Ala Asn Ala Gly Tyr Ala Arg Tyr Ala Asn Gly Ile Ala His Tyr TAT GGT TCT GAA GGT TAT GTT TGG GAA GCA ATC GAC GCA AAG AAC Tyr Gly Ser Glu Gly Tyr Val Trp Glu Ala Ile Asp Ala Lys Asn CAG ATC GCA TGG CAT ACT GGT GAC GGT ACT GGT GCA AAC TCT GGT Gln Ile Ala Trp His Thr Gly Asp Gly Thr Gly Ala Asn Ser Gly AAC TTC CGT TTC GCA GGT ATC GAA GTT TGT CAG TCT ATG TCT GCA Asn Phe Arg Phe Ala Gly Ile Glu Val Cys Gln Ser Met Ser Ala TCT GAC GCA CAG TTC CTG AAG AAC GAA CAG GCA GTT TTC CAG TTC Ser Asp Ala Gln Phe Leu Lys Asn Glu Gln Ala Val Phe Gln Phe ACT GCA GAA AAG TTC AAG GAA TGG GGT CTG ACT CCG AAC CGT AAG Thr Ala Glu Lys Phe Lys Glu Trp Gly Leu Thr Pro Asn Arg Lys ACT GTT CGT CTG CAT ATG GAA TTC GTT CCG ACT GCA TGT CCG CAT Thr Val Arg Leu His Met Glu Phe Val Pro Thr Ala Cys Pro His CGT TCT ATG GTT CTG CAT ACT GGT TTC AAC CCG GTT ACT CAG GGT Arg Ser Met Val Leu His Thr Gly Phe Asn Pro Val Thr Gln Gly 300

47 901 CGT CCG TCT CAG GCA ATC ATG AAC AAA CTG AAG GAC TAT TTC ATC Arg Pro Ser Gln Ala Ile Met Asn Lys Leu Lys Asp Tyr Phe Ile AAG CAG ATC AAG AAC TAC ATG GAC AAG GGT ACT TCT TCT TCT ACT Lys Gln Ile Lys Asn Tyr Met Asp Lys Gly Thr Ser Ser Ser Thr GTC GTT AAA GAC GGT AAA ACT TCT TCT GCA TCT ACT CCG GCA ACT Val Val Lys Asp Gly Lys Thr Ser Ser Ala Ser Thr Pro Ala Thr CGT CCG GTT ACT GGT TCT TGG AAG AAA AAC CAG TAC GGT ACT TGG Arg Pro Val Thr Gly Ser Trp Lys Lys Asn Gln Tyr Gly Thr Trp TAT AAA CCG GAA AAC GCA ACT TTC GTT AAC GGT AAC CAG CCG ATC Tyr Lys Pro Glu Asn Ala Thr Phe Val Asn Gly Asn Gln Pro Ile GTT ACT CGT ATC GGT TCT CCG TTC CTG AAC GCA CCG GTT GGT GGT Val Thr Arg Ile Gly Ser Pro Phe Leu Asn Ala Pro Val Gly Gly AAC CTG CCG GCA GGT GCA ACT ATC GTT TAT GAC GAA GTT TGT ATC Asn Leu Pro Ala Gly Ala Thr Ile Val Tyr Asp Glu Val Cys Ile CAG GCG GGT CAT ATC TGG ATC GGT TAT AAC GCA TAT AAC GGT AAC Gln Ala Gly His Ile Trp Ile Gly Tyr Asn Ala Tyr Asn Gly Asn CGT GTT TAT TGT CCG GTT CGT ACT TGT CAG GGT GTT CCG CCG AAC Arg Val Tyr Cys Pro Val Arg Thr Cys Gln Gly Val Pro Pro Asn CAG ATC CCG GGT GTT GCA TGG GGT GTT TTC AAA Gln Ile Pro Gly Val Ala Trp Gly Val Phe Lys 446

48 According to nucleotide sequencing of amplified gami-lysk (1,344bp) gene, the nucleotide and amino acid sequences of the gami-lysk (49.6KDa, pi 8.4) were correct as below. 1 ATG GCA AAG ACT CAG GCA GAA ATC AAC AAA CGT CTG GAC GCA TAT 45 1 Met Ala Lys Thr Gln Ala Glu Ile Asn Lys Arg Leu Asp Ala Tyr GCA AAG GGT ACT GTT GAC TCT CCG TAT CGT GTT AAG AAA GCA ACT Ala Lys Gly Thr Val Asp Ser Pro Tyr Arg Val Lys Lys Ala Thr TCT TAT GAC CCG TCT TTC GGT GTT ATG GAA GCA GGT GCA ATC GAC Ser Tyr Asp Pro Ser Phe Gly Val Met Glu Ala Gly Ala Ile Asp GCA GAC GGT TAT TAT CAT GCA CAG TGT CAG GAC CTG ATC ACT GAC Ala Asp Gly Tyr Tyr His Ala Gln Cys Gln Asp Leu Ile Thr Asp TAT GTT CTG TGG CTG ACT GAC AAC AAA GTT CGT ACT TGG GGT AAC Tyr Val Leu Trp Leu Thr Asp Asn Lys Val Arg Thr Trp Gly Asn GCA AAA GAC CAG ATC AAA CAG TCT TAT GGT ACT GGT TTC AAA ATC Ala Lys Asp Gln Ile Lys Gln Ser Tyr Gly Thr Gly Phe Lys Ile CAT GAA AAC AAA CCG TCT ACT GTT CCG AAG AAG GGT TGG ATC GCA His Glu Asn Lys Pro Ser Thr Val Pro Lys Lys Gly Trp Ile Ala GTT TTC ACT TCT GGT TCT TAT GAA CAG TGG GGT CAT ATC GGT ATC Val Phe Thr Ser Gly Ser Tyr Glu Gln Trp Gly His Ile Gly Ile GTT TAT GAC GGT GGT AAC ACT TCT ACT TTC ACT ATC CTG GAA CAG Val Tyr Asp Gly Gly Asn Thr Ser Thr Phe Thr Ile Leu Glu Gln 135

49 406 AAC TGG AAC GGT TAT GCA AAC AAG AAG CCG ACT AAA CGT GTT GAC Asn Trp Asn Gly Tyr Ala Asn Lys Lys Pro Thr Lys Arg Val Asp AAC TAT TAT GGT CTG ACT CAT TTC ATC GAA ATC CCG GTT AAA GCA Asn Tyr Tyr Gly Leu Thr His Phe Ile Glu Ile Pro Val Lys Ala GGT ACT ACT GTT AAG AAG GAA CCT AAA TAC GCA TAC CGT AAC GGC Gly Thr Thr Val Lys Lys Glu Pro Lys Tyr Ala Tyr Arg Asn Gly GTA GGT CGT CCT GAA GGT ATC GTA GTT CAT GAT ACA GCT AAT GAT Val Gly Arg Pro Glu Gly Ile Val Val His Asp Thr Ala Asn Asp CGT TCG ACG ATA AAT GGT GAA ATT AGT TAT ATG AAA AAT AAC TAT Arg Ser Thr Ile Asn Gly Glu Ile Ser Tyr Met Lys Asn Asn Tyr CAA AAC GCA TTC GTA CAT GCA TTT GTT GAT GGG GAT CGT ATA ATC Gln Asn Ala Phe Val His Ala Phe Val Asp Gly Asp Arg Ile Ile GAA ACA GCA CCA ACG GAT TAC TTA TCT TGG GGT GTC GGT GCA GTC Glu Thr Ala Pro Thr Asp Tyr Leu Ser Trp Gly Val Gly Ala Val GGT AAC CCT AGA TTC ATC AAT GTT GAA ATC GTA CAC ACA CAC GAC Gly Asn Pro Arg Phe Ile Asn Val Glu Ile Val His Thr His Asp TAT GCT TCA TTT GCA CGT TCA ATG AAT AAC TAT GCT GAC TAT GCA Tyr Ala Ser Phe Ala Arg Ser Met Asn Asn Tyr Ala Asp Tyr Ala GCT ACA CAA TTA CAA TAT TAT GGT TTA AAA CCA GAC AGT GCT GAG Ala Thr Gln Leu Gln Tyr Tyr Gly Leu Lys Pro Asp Ser Ala Glu TAT GAT GGA AAT GGT ACA GTA TGG ACT CAC TAC GCT GTA AGT AAA Tyr Asp Gly Asn Gly Thr Val Trp Thr His Tyr Ala Val Ser Lys 300

50 901 TAT TTA GGT GGT ACG GAC CAT GCC GAT CCA CAT GGA TAT TTA AGA Tyr Leu Gly Gly Thr Asp His Ala Asp Pro His Gly Tyr Leu Arg AGT CAT AAT TAT AGT TAT GAT CAA TTA TAT GAC GGT ACT TCT TCT Ser His Asn Tyr Ser Tyr Asp Gln Leu Tyr Asp Gly Thr Ser Ser TCT ACT GTC GTT AAA GAC GGT AAA ACT TCT TCT GCA TCT ACT CCG Ser Thr Val Val Lys Asp Gly Lys Thr Ser Ser Ala Ser Thr Pro GCA ACT CGT CCG GTT ACT GGT TCT TGG AAG AAA AAC CAG TAC GGT Ala Thr Arg Pro Val Thr Gly Ser Trp Lys Lys Asn Gln Tyr Gly ACT TGG TAT AAA CCG GAA AAC GCA ACT TTC GTT AAC GGT AAC CAG Thr Trp Tyr Lys Pro Glu Asn Ala Thr Phe Val Asn Gly Asn Gln CCG ATC GTT ACT CGT ATC GGT TCT CCG TTC CTG AAC GCA CCG GTT Pro Ile Val Thr Arg Ile Gly Ser Pro Phe Leu Asn Ala Pro Val GGT GGT AAC CTG CCG GCA GGT GCA ACT ATC GTT TAT GAC GAA GTT Gly Gly Asn Leu Pro Ala Gly Ala Thr Ile Val Tyr Asp Glu Val TGT ATC CAG GCG GGT CAT ATC TGG ATC GGT TAT AAC GCA TAT AAC Cys Ile Gln Ala Gly His Ile Trp Ile Gly Tyr Asn Ala Tyr Asn GGT AAC CGT GTT TAT TGT CCG GTT CGT ACT TGT CAG GGT GTT CCG Gly Asn Arg Val Tyr Cys Pro Val Arg Thr Cys Gln Gly Val Pro CCG AAC CAG ATC CCG GGT GTT GCA TGG GGT GTT TTC AAA Pro Asn Gln Ile Pro Gly Val Ala Trp Gly Val Phe Lys 448

51 The amino acid sequences of replaced gchap and gami modules are clearly different from corresponding modules of LysK and their amino acid sequences were compared in Figure 8. Therefore, codop-lysk, gchap-lysk, and gami-lysk were successfully constructed. Figure 8. Comparison of amino acid sequences of gchap and gami with corresponding modules of LysK. (A) The identities of LyK-CHAP and gchap modules are 18% (22/112) and (B) the identities of LysK-ami and gamidase modules are 20% (32/162).

52 Antimicrobial activity of chimeric lysins produced by IVTC/TL According to the results of antimicrobial activity testing, the CFU of PMB4 mixed with codop-lysk and gami-lysk was kept constant during 60min. However, the CFU of PMB4 mixed with gchap-lysk rapidly decreased within 30min and near to zero after 60min (Figure 9). Therefore, only gchap-lysk expressed using IVTC/TL showed antimicrobial activity against PMB CFU of S.aureus codop-lysk gami-lysk gchap-lysk Time (min) Figure 9. Antibacterial activity of chimeric lysins produced by IVTC/TL. The codop-lysk and gami-lysk are constant during 60min but gchap- LysK reduces the CFU of S.aurues.

53 Optimized expression of gchap-lysk in E. coli The optimal concentration of L-arabinose for the expression of soluble and active gchap-lysk was confirmed by SDS-PAGE and antimicrobial activity test. As a result, the size of gchap-lysk protein larger than 49KDa (53kDaca) was clearly visible in the samples induced with 0.2, 0.02, and 0.002% L-arabinose but invisible in , , and 0% (negative control) samples (Figure 10). Figure 10. SDS-PAGE of soluble fractions of L-arabinose-induced BL21 (DE3) gchap-lysk. Lanes 1: 0.2% L-arabinose-induction, 2: 0.02% L- arabinose-induction, 3: 0.002% L-arabinose-induction, 4: % L-arabinose-

54 induction, 5: % L-arabinose-induction, 6: 0% L-arabinose-induction (negative control).

55 According to the antibacterial activity test for the soluble gchap-lysk induced by different concentration of L-arabinose 0.2% L-arabinose-induced gchap-lysk showed highest relative colony reduction rate, 25.8% in comparison with others (Table 3). Also, the maximal expression of soluble gchap-lysk was produced in 16 C than 37 C. Therefore, the optimal conditions for L-arabinose concentration was 0.2% and temperature/incubation time was 16 C for 20 h for the maximal expression of soluble gchap-lysk. Table 3. Relative antibacterial efficacy of semi-purified LysK-gCHAP against Staphylococcus aureus (PMB4 from bovine mastitis) Sample no L-arabinose con. 0.2% 0.02% 0.002% % % 0% 1st 114* nd Mean Relative of colony reduction 25.8% 6.9% 5.0% 1.3% 6.3% 0% * Count colony forming unit

56 Characterization of purified gchap-lysk from soluble fraction of E. coli To further verify the nature of gchap-lysk expressed in optimized condition, SDS PAGE and western blotting were performed. As shown in Figure 12, two specific bands with molecular weight of approximately 53kDa and 46kDa were detected in only 0.2% L-arabinose-induced sample. Figure 11. SDS-PAGE and Western blotting of gchap-lysk expressed in optimal condition. (A) SDS-PAGE of L-arabinose-induced (lane 1) and uninduced (lane 2)

57 samples (lane M: protein size marker). (B) Western blotting of induced (lane 3) and uninduced (lane 4) samples (lane M: protein size marker).

58 According to the result of antibacterial activity testing with the induced and uninduced gchap-lysk the induced gchap-lysk significantly decreased the CFU of PMB4 after 30min and 60min (Figure 12) (P<0.05). However, the uninduced sample did not show any antibacterial activity CFU of S.aureus ** *** uninduced L-arabinose induced Time (min) Figure 12. Antibacterial activity of gchap-lysk produced by E. coli expression in optimized condition. ** (P<0.05)/*** (P<0.01) significant decrease of CFU in comparison with uninduced sample.

59 The antibacterial activity of gchap-lysk a turbidity reduction assay was performed (Figure 13). According to the result the turbidity of uninduced sample increased during observation period (60min) but the induced sample decreased the turbidity apparently over time. Therefore, the antibacterial activity of gchap-lysk was verified using recombinant protein expressed in E. coli O.D 570nm uninduced L-arabinose induced Time (min) Figure 13. Turbidity reduction assays of gchap-lysk produced by E. coli expression in optimal condition. The gchap-lysk induced by L-arabinose decreses turbidity, while uninduced samples increased turbidity during 60min.

60 4. Discussion As antibiotic-resistant bacteria increased globally, phage therapy has been applied to prevent or treat bacterial infectious diseases (Matsuzaki et al., 2005). In case of Gram-negative bacteria infections phages are more economic but lysins are less efficacious due to the presence of outer membrane outside of peptidoglycan layer. However, lysins are directly accessible to the peptidoglycan layer of Gram-positive bacteria prophylactic and therapeutic chimeric lysins have been explosively developed. Although natural lysins were functionally active efforts to improve them resulted in development of various chimeric lysins of which antibacterial efficacy and spectrum have been improved dramatically (Dong et al., 2015; Donovan et al., 2006; Gilmer et al., 2013; Yang et al., 2015; Yang et al., 2014b; Yoong et al., 2004). Now, the massive genome information on bacteria and phages is available and bioinformatics tools have become more accurate. Therefore, various combinations of catalytic and cell-binding modules from multiple origins

61 have been designed and expressed in E. coli for antibacterial efficacy test. However, it took long time and required multiple steps to prepare candidate recombinant chimeric lysins using E. coli expression. For this reason I simplified the recombinant protein preparation using IVTC/TL. IVTC/TL using E. coli S30 extract has been used for preparation of small amount of recombinant proteins for functional study and applied to diagnosis of inheritary familial cancers (Kang et al., 2002). In this study I successfully selected antibacterial gchap-lysk using IVTC/TL and verified antibacterial activity using E. coli expression. However, no antibacterial activity of codop-lysk and gami-lysk were unexpected (Biswas et al., 2006). The reasons why codop-lysk and gami-lysk did not show antibacterial activity were not determined, but relatively low antibacterial activity or misfolding may be possible causes (Becker et al., 2008; Becker et al., 2016; Manoharadas et al., 2009; Sass and Bierbaum, 2007). Although LysK has potent antibacterial activity against S. aureus resistant to methicillin and vancomycin recombinant LysK is consistently located in the insoluble fraction when expressed in E. coli (O'Flaherty et al., 2004;