CRISPR 유전자가위로세상을바꾼다 김진수서울대학교화학부기초과학연구원유전체교정연구단 1
유전적다양성 유전자의차이가개체의차이를대부분설명함 유전자에따라질병에대한감수성이달라짐 2
유전질환 : Genetic Disorders 혈우병, 겸상적혈구증등 10,000 종이있음 전체신생아의 1% 가유전질환자임 소아과진료의 40% 에해당 대부분완치불가능 돌연변이유전자를다음세대에물려줌 3
정상적혈구와낫모양적혈구 흑인 500 명중한명비율로발생하는빈혈증 단일염기변이로인해헤모글로빈아미노산한개가바뀜 낫모양적혈구형성, 기능상실 4
유전체교정 : Genome Editing 유전자가위를사용해세포내유전자 DNA를절단함 절단된 DNA가수선되는과정에서변이가발생함 유전질환, 암, 감염성질환의치료법으로개발되고있음 가축, 농작물, 어류, 곤충등에널리활용됨 5
유전자가위 : Programmable Nuclease CRISPR/Cas-derived RNA-guided endonuclease (RGEN)
Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99% ~90% Average mutation <10% ~20% ~20% rate Length of target site 20 to 36 bp 30 to 40 bp 23 bp Restriction in target site Guanine-rich Start with T and end with A End with GG (PAM) Design density One per ~100 bp One per every bp One per 8 bp Off-target effects High Low Variable Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + grna Kim H & Kim JS, Nat. Rev. Genet. (2014) 7
CRISPR RNA-Guided ENdonuclease 8
Thomson Reuters Hot Papers 9
Double-Strand Break Repair Gene-targeting efficiency is boosted drastically by DSBs. Kim H & Kim JS, Nat. Rev. Genet. (2014) DSBs also induce NHEJ, an error-prone DSB repair system. 10
What Is Genome Editing? Targeted gene knockout and knock-in Single base change, gene correction, gene addition, gene disruption, etc. Targeted chromosomal rearrangements: large deletion, inversion, translocation
CRISPR: Adaptive Immune System in Bacteria Clusters of Regularly Interspaced Palindromic Repeats CRISPR-Cas9: RNA-guided programmable nucleases 12
RNA-Guided ENdonuclease (RGEN) Cas9 Guide RNA GG GG
Plasmid-free Gene Knockout in Human Cells Purified Cas9 protein: Guide RNA : + - - + + CCR5 Indels (%) : 2.7 8.3 33 51 57 CAATCTATGACATCAATTATTATA-CATCGGAGCCCTGCCAAAAAATCAA WT CAATCTATGACATCAATTATTATAACATCGGAGCCCTGCCAAAAAATCAA +1 CAATCTATGACATCAATTATTAT--------------GCCAAAAAATCAA -13 CAATCTATGACATC---------------GGAGCCCTGCCAAAAAATCAA -14 CAATCTATGACAT-------------------GCCCTGCCAAAAAATCAA -18 CAATCTATGACATCAATTATTAT--------------------AAATCAA -19 CAATCTATGACATC-------------------------CAAAAAATCAA -24 CAATCTATGACA-------------------------------AAATCAA -30 Purified Cas9 protein and in vitro transcribed sgrna are used. Mutation frequencies range from 1% to 98%.
Gene/cell therapy targeting CCR5 CCR5 is an essential co-receptor of HIV infection. CCR5 32 deletion leads to resistance to HIV infection. Homozygote CCR5 32 carriers are healthy (1% of Caucasian) 15
16
T cells from HIV+ patients are treated with a programmable nuclease. CCR5-inactive T cells are delivered back to patients 17
혈우병 : The Royal Disease Queen Victoria (1819-1901) Queen Victoria and her royal family British Queen Victoria was a carrier of the hemophilia gene. Almost half of the severe form of hemophilia A is caused by DNA inversion. 18
F8 유전자 일반인 F8 유전 자 혈우병환자 유전자가위 F8 유전 자 F8 유전자 유전자복구 ( 치료 ) 19
(A) Chromosomal Flip-Flop in Human ips Cells Homolog 1 Inverted clones Reverted clones Pa WT #1 #2 #1 #2 #3 #3 Factor VIII WT Inv 1 Inv 2 Rev 1 Rev 2 Rev 3 Homolog 2 FOXA2 Inversion 1 Sox17 Inversion 2 GAPDH Prof. Dong Wook Kim at Yonsei Univ. A TALEN was used to create F8 gene-inverted clones and to revert them. 20
줄기세포와유전자교정 검출 환자체세포 세포역분화 환자유래분화만능줄기세포 유전병환자 유전자가위 이식 세포분화 유전자교정된줄기세포 분화된세포 21
Targeted gene knockout in mice Prof. Han-Woong Lee at Yonsei Univ. RNA transcripts encoding ZFNs/TALENs were injected into the embryos. 49 to 77% of F0 contained mutations.
Naturally-occurring MSTN KO animals Myostatin inhibits muscle differentiation and growth. Animals lacking myostatin have extensive muscles.
MSTN KO Pigs Created Using TALENs No naturally-occurring MSTN -/- pigs have been found. MSTN KO pigs may be exempted from GMO regulation. 24
Bananageddon and Banana Save Project Banana is infected by a fungus. Gros Michel is an old banana variety extinct in 1950 s. Cavendish banana will be extinct in 10~20 years. Genome editing can be used to make banana resistant to the fungus.
CRISPR Revolution Biomedical research Drug target discovery Gene and cell therapy Plant biotechnology Animal biotechnology 26
유전체교정기술과맞춤형아기 가타카 (1997): 미국 SF 영화 인간생식세포유전자교정 유전자강화된맞춤형아기 유전체교정기술개발로실현가능성대두 일부과학자들, 모라토리움요청 27
Center Genome for Engineering Genome Center Engineering Human Genome KO Stem Cell Group Animal Research Group Pig genome engineering Core Group Plant Research Group Plant genetics Plant biotechnology Cell Therapy Group Therapeutics 28
Acknowledgments Dr. Seokjoong Kim, ToolGen, Inc. Dr. Eunji Kim, ToolGen, Inc. Prof. Cheol-Hee Kim, Chungnam Nat. Univ. Prof. Dong Wook Kim, Yonsei Univ. Prof. Han-Woong Lee, Yonsei Univ. Prof. Narry Kim, Seoul National Unv. Prof. Xi Jun Yin, Yanbian Univ. Prof. Hyongbum Kim, Hanyang Univ. Prof. Emery Bresnick, Univ. of Wisconsin Prof. Jae Jung, Univ. of Southern California Home page: http://cge.ibs.re.kr E-mail: jskim01@snu.ac.kr 29