Microsoft PowerPoint - 김진수단장(IBS)자료



Similar documents
유전자가위 기술 소개 및 활용 유전자가위 기술은 2011년과 2013년에 각각 권위 있는 학술지 Nature methods와 기초과학연구원, 유전체교정연구단 김은지, 김진수 Science에 의해 올해의 실험기법(Method of the Year), 올해

미래의학 - 맞춤형의학 유전자가위

sirna 실험은잘됐는데... 그러면이제유전자의기능을완전히억제하고싶은데... 1 화 : CRISPR 은손쉽다 CRISPR 에게맡겨봐! 내게염기서열만알려주면 knock out 을시켜버릴게! Gene editing( 게놈편집 ) 을이용하면특정유전자의기능을완전히 knock-


PowerPoint Presentation

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

융합WEEKTIP data_up

현대패션의 로맨틱 이미지에 관한 연구


012임수진

<313120C0AFC0FCC0DA5FBECBB0EDB8AEC1F2C0BB5FC0CCBFEBC7D15FB1E8C0BAC5C25FBCF6C1A42E687770>

Invitrogen GeneArt Platinum Cas9 Nuclease character design & illustration: ryuji nouguchi Invitrogen GeneArt Genomic Cleavage Detection Kit

09김정식.PDF

System Biology Core

hwp

( )Kju269.hwp


DBPIA-NURIMEDIA


Can032.hwp

example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for

보건사회연구-25일수정

공급 에는 권역에 두개의 프라임 오피스가 준공 되었다. 청진구역 2,3지구에는 광화문 D타워가 준공되어 대림에서 약 50%를 사용하며 나머지 50%는 임대마케팅을 진행 중이다. 메트로타워는 GS건설의 사옥에서 매각 이후 2013년 4분기에 리모델링을 시작하여, 에 완공

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

歯MW-1000AP_Manual_Kor_HJS.PDF

Ä¡¿ì³»ÁöÃÖÁ¾

30이지은.hwp

FMX M JPG 15MB 320x240 30fps, 160Kbps 11MB View operation,, seek seek Random Access Average Read Sequential Read 12 FMX () 2

?

Microsoft PowerPoint - ch03ysk2012.ppt [호환 모드]

Àå¾Ö¿Í°í¿ë ³»Áö

< C6AFC1FD28B1C7C7F5C1DF292E687770>

<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>


[ReadyToCameral]RUF¹öÆÛ(CSTA02-29).hwp

<5B D B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>

170

006- 5¿ùc03ÖÁ¾T300çÃâ

사용시 기본적인 주의사항 경고 : 전기 기구를 사용할 때는 다음의 기본적인 주의 사항을 반드시 유의하여야 합니다..제품을 사용하기 전에 반드시 사용법을 정독하십시오. 2.물과 가까운 곳, 욕실이나 부엌 그리고 수영장 같은 곳에서 제품을 사용하지 마십시오. 3.이 제품은

Genome engineering 을통한지능형인공미생물개발. 울산과학기술대학교 이성국교수 최근몇년간미국의 CNN 1, 영국의 BBC 2 와국영방송 3 등여러권위있는미디어매체를통해합성생물학의잠재성이보도되었다. 현재가장뜨거운관심이모아지고있는분야인합성생물학은기존몇개의유전자를


BSC Discussion 1

02이용배(239~253)ok

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

pdf 16..

½Éº´È¿ Ãâ·Â

»ï°¢½£ 46È£_¿Ï

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

<4D F736F F F696E74202D20332DB5B9BFACBAAFC0CC2DB0A8BCF6BAD0BFAD2DBFB0BBF6C3BCC0CCBBF3205BC8A3C8AF20B8F0B5E55D>

hwp

Á¶´öÈñ_0304_final.hwp

03±èÀçÈÖ¾ÈÁ¤ÅÂ

지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :


공급 에는 3권역 내에 준공된 프라임 오피스가 없었다. 4분기에는 3개동의 프라임 오피스가 신규로 준공 될 예정이다.(사옥1개동, 임대용 오피스 2개동) 수요와 공실률 2014년 10월 한국은행이 발표한 자료에 따르면 한국의 2014년 경제성장률 예측치는 3.5%로 지

<BFACBCBCC0C7BBE7C7D E687770>

중국, 동아시아의 발전상에 대한 독일, 유럽의 시각

Kaes010.hwp

한국 출산력의 저하 요인에 관한 연구

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

(

Vol.259 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M

<B1B9BEC7BFF8B3EDB9AEC1FD5FC1A63234C1FD5FBFCF2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>


2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

<BCF6BDC D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>

Lumbar spine

Chapter 26

untitled

시안

< C7D0B3E2B5B520C0DABFACB0E8BFAD20B8F0C0C7C0FBBCBAB0EDBBE72020B9AEC1A62E687770>

歯채민병.PDF

개정판 서문 Prologue 21세기 한국경제를 이끌어갈 후배들에게 드립니다 1부 인생의 목표로써 CEO라는 비전을 확고히 하자 2부 인생의 비전을 장기 전략으로 구체화하라 1장 미래 경영환경 이해하기 20p 4장 장기 실행 전략 수립하기 108p 1) 미래 환경분석이

1030 ¿©¼º»ý¸í12³â»ç ¼öÁ¤

INDUS-8.HWP

CONTENTS.HWP


뉴스지14호-칼라

이용석 박환용 - 베이비부머의 특성에 따른 주택유형 선택 변화 연구.hwp

#Ȳ¿ë¼®

¹Ìµå¹Ì3Â÷Àμâ

Stage 2 First Phonics

분 기 보 고 서 (제 47 기) 사업연도 2014년 01월 01일 2014년 03월 31일 부터 까지 금융위원회 한국거래소 귀중 2014년 5월 30일 제출대상법인 유형 : 면제사유발생 : 주권상장법인 해당사항 없음 회 사 명 : 파미셀 주식회사 대 표 이 사 : 김

No BiolNdustry No. 107 (2016-8) 글로벌 CRISPR 시장현황및전망

Chapter 11

OP_Journalism

06-구인회

00약제부봄호c03逞풚

보안과제 ( ), 일반과제 ( ) 과제번호 SB010 유전자적중및핵이식에의한레쉬 - 니한증후군질환모델복제돼지의생산 레쉬 - 니한증후군질환모델 HPRT1 유전자적중복제돼지의생산 비외과적수정란이식에의한복제돼지생산기술개발

09È«¼®¿µ 5~152s

한국성인에서초기황반변성질환과 연관된위험요인연구

서론

248019_ALIS0052.hwp

May 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr

김기남_ATDC2016_160620_[키노트].key

Microsoft Word - retail_ doc

Interview OT&C 김은우 대표 를 제공하고 있습니다. 그것이 가능하려면 복잡한 시스템 이 필요한데요, 저희와 같은 회사들이 그 일을 담당하고 있습니다. Q 아마도 많은 업력이 있으실 것 같은데요. 독자들이 아~! 거기! 하고 쉽게 생각할 수 있도록 어떤 도서관

Transcription:

CRISPR 유전자가위로세상을바꾼다 김진수서울대학교화학부기초과학연구원유전체교정연구단 1

유전적다양성 유전자의차이가개체의차이를대부분설명함 유전자에따라질병에대한감수성이달라짐 2

유전질환 : Genetic Disorders 혈우병, 겸상적혈구증등 10,000 종이있음 전체신생아의 1% 가유전질환자임 소아과진료의 40% 에해당 대부분완치불가능 돌연변이유전자를다음세대에물려줌 3

정상적혈구와낫모양적혈구 흑인 500 명중한명비율로발생하는빈혈증 단일염기변이로인해헤모글로빈아미노산한개가바뀜 낫모양적혈구형성, 기능상실 4

유전체교정 : Genome Editing 유전자가위를사용해세포내유전자 DNA를절단함 절단된 DNA가수선되는과정에서변이가발생함 유전질환, 암, 감염성질환의치료법으로개발되고있음 가축, 농작물, 어류, 곤충등에널리활용됨 5

유전자가위 : Programmable Nuclease CRISPR/Cas-derived RNA-guided endonuclease (RGEN)

Comparison of Programmable Nucleases ZFN TALEN RGEN Success rate ~24% >99% ~90% Average mutation <10% ~20% ~20% rate Length of target site 20 to 36 bp 30 to 40 bp 23 bp Restriction in target site Guanine-rich Start with T and end with A End with GG (PAM) Design density One per ~100 bp One per every bp One per 8 bp Off-target effects High Low Variable Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + grna Kim H & Kim JS, Nat. Rev. Genet. (2014) 7

CRISPR RNA-Guided ENdonuclease 8

Thomson Reuters Hot Papers 9

Double-Strand Break Repair Gene-targeting efficiency is boosted drastically by DSBs. Kim H & Kim JS, Nat. Rev. Genet. (2014) DSBs also induce NHEJ, an error-prone DSB repair system. 10

What Is Genome Editing? Targeted gene knockout and knock-in Single base change, gene correction, gene addition, gene disruption, etc. Targeted chromosomal rearrangements: large deletion, inversion, translocation

CRISPR: Adaptive Immune System in Bacteria Clusters of Regularly Interspaced Palindromic Repeats CRISPR-Cas9: RNA-guided programmable nucleases 12

RNA-Guided ENdonuclease (RGEN) Cas9 Guide RNA GG GG

Plasmid-free Gene Knockout in Human Cells Purified Cas9 protein: Guide RNA : + - - + + CCR5 Indels (%) : 2.7 8.3 33 51 57 CAATCTATGACATCAATTATTATA-CATCGGAGCCCTGCCAAAAAATCAA WT CAATCTATGACATCAATTATTATAACATCGGAGCCCTGCCAAAAAATCAA +1 CAATCTATGACATCAATTATTAT--------------GCCAAAAAATCAA -13 CAATCTATGACATC---------------GGAGCCCTGCCAAAAAATCAA -14 CAATCTATGACAT-------------------GCCCTGCCAAAAAATCAA -18 CAATCTATGACATCAATTATTAT--------------------AAATCAA -19 CAATCTATGACATC-------------------------CAAAAAATCAA -24 CAATCTATGACA-------------------------------AAATCAA -30 Purified Cas9 protein and in vitro transcribed sgrna are used. Mutation frequencies range from 1% to 98%.

Gene/cell therapy targeting CCR5 CCR5 is an essential co-receptor of HIV infection. CCR5 32 deletion leads to resistance to HIV infection. Homozygote CCR5 32 carriers are healthy (1% of Caucasian) 15

16

T cells from HIV+ patients are treated with a programmable nuclease. CCR5-inactive T cells are delivered back to patients 17

혈우병 : The Royal Disease Queen Victoria (1819-1901) Queen Victoria and her royal family British Queen Victoria was a carrier of the hemophilia gene. Almost half of the severe form of hemophilia A is caused by DNA inversion. 18

F8 유전자 일반인 F8 유전 자 혈우병환자 유전자가위 F8 유전 자 F8 유전자 유전자복구 ( 치료 ) 19

(A) Chromosomal Flip-Flop in Human ips Cells Homolog 1 Inverted clones Reverted clones Pa WT #1 #2 #1 #2 #3 #3 Factor VIII WT Inv 1 Inv 2 Rev 1 Rev 2 Rev 3 Homolog 2 FOXA2 Inversion 1 Sox17 Inversion 2 GAPDH Prof. Dong Wook Kim at Yonsei Univ. A TALEN was used to create F8 gene-inverted clones and to revert them. 20

줄기세포와유전자교정 검출 환자체세포 세포역분화 환자유래분화만능줄기세포 유전병환자 유전자가위 이식 세포분화 유전자교정된줄기세포 분화된세포 21

Targeted gene knockout in mice Prof. Han-Woong Lee at Yonsei Univ. RNA transcripts encoding ZFNs/TALENs were injected into the embryos. 49 to 77% of F0 contained mutations.

Naturally-occurring MSTN KO animals Myostatin inhibits muscle differentiation and growth. Animals lacking myostatin have extensive muscles.

MSTN KO Pigs Created Using TALENs No naturally-occurring MSTN -/- pigs have been found. MSTN KO pigs may be exempted from GMO regulation. 24

Bananageddon and Banana Save Project Banana is infected by a fungus. Gros Michel is an old banana variety extinct in 1950 s. Cavendish banana will be extinct in 10~20 years. Genome editing can be used to make banana resistant to the fungus.

CRISPR Revolution Biomedical research Drug target discovery Gene and cell therapy Plant biotechnology Animal biotechnology 26

유전체교정기술과맞춤형아기 가타카 (1997): 미국 SF 영화 인간생식세포유전자교정 유전자강화된맞춤형아기 유전체교정기술개발로실현가능성대두 일부과학자들, 모라토리움요청 27

Center Genome for Engineering Genome Center Engineering Human Genome KO Stem Cell Group Animal Research Group Pig genome engineering Core Group Plant Research Group Plant genetics Plant biotechnology Cell Therapy Group Therapeutics 28

Acknowledgments Dr. Seokjoong Kim, ToolGen, Inc. Dr. Eunji Kim, ToolGen, Inc. Prof. Cheol-Hee Kim, Chungnam Nat. Univ. Prof. Dong Wook Kim, Yonsei Univ. Prof. Han-Woong Lee, Yonsei Univ. Prof. Narry Kim, Seoul National Unv. Prof. Xi Jun Yin, Yanbian Univ. Prof. Hyongbum Kim, Hanyang Univ. Prof. Emery Bresnick, Univ. of Wisconsin Prof. Jae Jung, Univ. of Southern California Home page: http://cge.ibs.re.kr E-mail: jskim01@snu.ac.kr 29