Safety warning and Precaution ExiProgen TM EC-Tagfree Protein Synthesis Kit is developed and supplied for research purposes only. Certain applications

Transcription

1 User s Guide 8 Version No.: 1.0 ( ) Please read all the information in booklet before using the kit Bioneer Corporation 8-11, Munpyeongseo-ro Daedeuk-gu, Daejeon Korea Tel: Fax: sales@bioneer.com

2 Safety warning and Precaution ExiProgen TM EC-Tagfree Protein Synthesis Kit is developed and supplied for research purposes only. Certain applications possible with this kit may require special approval by appropriate local and/or national regulatory authorities in the country of use. Wear appropriate protection when handling any irritant or harmful reagents. The use of a laboratory coat, protective gloves and safety goggles are highly recommended. For more information please consult the appropriate Material Safety Data Sheet (MSDS). Warranty and Liability All BIONEER products undergo extensive Quality Control testing and validation. BIONEER guarantees quality during the warranty period as specified, when following the appropriate protocol as supplied with the product. It is the responsibility of the purchaser to determine the suitability of the product for its particular use. Liability is conditional upon the customer providing full details of the problem to BIONEER within 30 days. Patent ExiProgen TM and its kits are protected by the patents KR , PCT/KR2012/006715, KR , and KR Trademark ExiProgen TM is trademark of Bioneer Corporation. Copyright 2012 by Bioneer Corporation, All rights reserved.

3 Contents 1. Introduction The ExiProgen protein synthesis system ExiProgen EC-Tagfree Protein Synthesis Kit Overview Preparation of template DNA Kit contents and storage Information of components Cartridges Other components Experimental procedure Preparation of experiment Preparation of protein expression mixture Protein synthesis with ExiProgen Analysis of sample Maintenance Troubleshooting guide Appendix 1 : pbivt vectors Appendix 2 : Determination of template DNA concentration References Related products

4 1. Introduction Proteins are one of the essential components in the vital reactions in vivo and in vitro, with various functions as enzymes, hormones, and structural proteins. The research on the roles and structures of proteins has been done actively in the post-genomic era, starting with the production of proteins of interest by using recombinant DNA technology. In order to produce recombinant proteins people generally transform various host cells, such as E. coli, yeast, and mammalian cells with a vector that contains a piece of DNA necessary for the expression of a target protein. The transformed cells that demonstrate a stable expression of the recombinant protein are selected by the selection marker co-inserted into the host cells with a target DNA. The recombinant proteins are produced during the culture process of the selected transformed cells and after the culture collected and purified from either the cell lysate or the culture solution. The whole process of cell-based protein synthesis comprising from recombination and transformation up to purification is usually a tedious and labor intensive job. Additionally for the toxic proteins to the host cells it is very hard to express those proteins in a cell-based system. Therefore those toxic proteins are obtained through repeated trials and errors under various conditions, which takes several days or even several months. To overcome the limitations of cell-based system, a cell-free protein expression method and its related products have been developed to accomplish protein synthesis inside a reaction vessel in a short period of time. This method only requires to add cell lysate and template DNA, either of an expression vector or a PCR product, to protein expression solution that contains amino acids, nucleic acids and energy source in the reaction vessel. Then the target recombinant protein is expressed during a reaction at appropriate temperature. This method has the advantage of quite shorter processing time, over the cell based method, as well as of expression of toxic proteins to the cells. The cell-free protein expression method has been used in functional research on new genes and comparison studies on functional activities of various mutant proteins. It also has broad applications such as research on the mechanism of protein-protein interaction and on the active site of proteins.. 2

5 2. The ExiProgen TM protein synthesis system Bioneer has developed the ExiProgen that combines cell-free protein expression system and highly efficient purification system.the ExiProgen expresses and purifies various proteins within a day in a fully automated fashion and provides the target protein with high purity and amount of from micrograms up to milligrams. Furthermore, the ExiProgen can extract DNA and RNA from various biological samples within an hour. The ExiProgen expressed a target protein from a template DNA and reagents provided by Bioneer and purifies the expressed protein using affinity reactions between the Ni-NTA magnetic nanoparticles and the 6x histidine tag attached at the end of the protein. The entire process of expression and purification is automated. The only requirement is to construct a user s own template DNA and to install a protein synthesis kit in the ExiProgen. Bioneer currently provides various protein synthesis kits that have been optimized for many different proteins. Therefore, researchers can simply execute a protocol already programmed in the ExiProgen along with installing the kit of interest. Bioneer s cell-free protein synthesis products are divided into three groups (a figure on page 4): 1) products for the generation of template DNA; 2) AccuRapid products for manual expression of proteins; 3) ExiProgen products for automated protein expression and purification using ExiProgen instrument. 3

6 4

7 3. ExiProgen EC-Tagfree Protein Synthesis Kit 3.1. Overview ExiProgen EC-Tagfree Protein Synthesis Kit is to provide an authentic protein without histidine tag. In some proteins, the histidine tag may affect the protein activity and structure in an undesirable way, in spite of the useful applications in protein purification. ExiProgen EC-Tagfree Protein Synthesis Kit produces histidine tag-free proteins by TEV protease that acts on expressed proteins bound to Ni-NTA magnetic beads (Figure below). The kit synthesizes proteins up to 200 ug per reaction using ExiProgen instrument. The entire processes consisting of protein expression, purification, removal of histidine tag, and dialysis are performed in a fully automated manner and the final protein is recovered in Storage buffer. ExiProgen EC-Tagfree Protein Synthesis Kit improves the expression rate of a target protein by adopting the proprietary stepwise exchange cell free protein expression method in which energy sources neccessary for protein expression are fed continuously. 5

8 3.2. Prepare of template DNA A protein expression vector can be used as template DNA for the ExiProgen TM EC-Tagfree Protein Synthesis Kit. Figure 1 shows the typical structure of template DNA for the ExiProgen. The template DNA should have the structure of T7 promoter - Ribosome binding site (RBS) TEV site - Target gene - T7 terminator. Figure 1. 1) Structure of Template DNA (5 end 6x histidine tagged template) T7 Promoter---RBS ATG 6x histidine tag--tev site--target stop T7 terminator 2) Sequences of TEV recognition site G l u - X - X - Tyr - X - G l n - G l y( o r S e r ) Cleavage site of TEV For cloning of a target gene, one can use pbivt vector from Bioneer, which is a protein expression vector for in vitro translation (Cat. No. K-7350). A detailed explanation on pbivt vector is provided in Appendix 1of the manu. pk7, pivex, and pet-series vectors could be used for this purpose. In order to obtain the maximum amount of synthesized protein, it is recommended that the DNA sequence of target gene be optimized to the codon of E. coli. Bioneer provides Gene Synthesis Service to a customer if the target gene is not optimized to E. coli. Throughout the service a customer can get codon-optimized target gene cloned into pbivt vector (or other in vitro translation vector a customer selects). Please refer to Bioneer s homepage ( for more information. 6

9 Note) Construction method for a template DNA 1 Using an user s expression vector with N-terminal 6X histidine tag sequence A user may prepare a PCR product including TEV recognition site (ex) GAAAACTTATATTTTCAGGGC, Glu-Asn-Leu-Tyr-Phe-Gln-Gly) between 6x histidine tag and target gene sequences. The PCR product is cloned into a desirable vector. 2 Usng a Positive Control DNA as a Vector When using a Positive Control DNA as a vector, a user may prepare a PCR product with primers (as shown below) and the PCR product is cloned into a Positive Control DNA. Forward primer : 5 -CGCCTACGGATCCGAAAACTTATATTTTCAGGGCXXXXXXXXXXXXX BamHⅠ TEV recognition site Overlapping sequence to XXX-3 target gene (16-mer) Reverse primer : 5 - CGCCTACGCGGCCGCXXXXXXXXXXXXXXXX 3 NotⅠ Overlapping sequence to target gene (16-mer) 7

10 3.3. Kit contents and storage ExiProgen EC-Tagfree Protein Synthesis Kit 1 Cartridge 1 96 well x 1ea Store Dialysis tube 1 pack (16 ea/pack) at 4 ~ 8 Disposable filter tip 1 pack (8 ea/pack) Store at Protection cover 1 ea Room temperature ExiProgen EC-Tagfree Protein Synthesis Kit 2 Cartridge 2 96 well x 1ea E. coli extract 8-tube strip (Yellow) x 1 ea Master mix 8-tube strip (Violet) x 1 ea DEPC DW 8-tube strip (White) x 1 ea Storage buffer 35 ml x 2 bottle TEV protease 1.5mL tube x 1 ea Positive Control DNA 1.5mL tube x 1 ea Store at -20~ -70 ExiProgen TM EC-Tagfree Protein Synthesis Kit is consisted of Kit 1 and Kit 2. The Kit 1 includes Cartridge 1, Disposable filter tip, Dialysis tube, and a Protection cover. Cartridge 1 contains buffers to be used for protein purification and should be stored in a refrigerator (4-8 C) along with Dialysis tube The Kit 2 includes Cartridge 2, E. coli extract, Master mix, DEPC DW, Storage buffer, TEV protease and a tube of Positive Control DNA. Cartridge 2 contains Feeding solution for protein expression. The Kit 2 should be stored at - 20 C or below, and E. coli extract is strongly recommended to locate at a -70 C deep freezer. The Cartridges of this kit are covered with 3-ply sealing films in order to prevent cross-contamination, evaporation, or leakage of solutions inside. All of the plastic products and buffers in this kit are provided under Nuclease- and Protease-free condition. Please be careful not to contaminate any part of the kit with nucleases or proteases. 8

11 3.4. Information of components Cartridges Ni-NTA magnetic bead Binding/Washing buffer ; Buffer for binding of expressed proteins on Ni-NTA magnetic beads & for washing process to remove impurities Autoclaved DW ; Distilled Water for tip Feeding buffer ; Buffer for protein expression to be added to the reaction mixture. It contains NTPs, amino acids, and energy source etc. Storage buffer ; Buffer for storage of final target protein 9

12 Other components A. E. coli extract The E. coli extract in the Kit 2 is a cell lysate which includes T7 RNA polymerase, ribosome, trna required for protein expression. It is provided as an 8-tube strip, and each tube contains 130 ul. B. Master mix The Master mix, which is also provided in the Kit 2, includes NTPs, amino acids, energy sources and salts required for protein expression. It is provided as an 8- tube strip, and each tube contains 220 ul. C. DEPC DW It is used to adjust final volume of protein expression solution. It is provided as an 8- tube strip, and each tube contains 130 ul. D. Dialysis tube Dialysis tube, which is specifically manufactured by Bioneer, is used to supply the protein source materials from the Feeding buffer to the protein expression solution, and to exchange the purification buffer to Storage buffer after purification of a target protein. It is provided in 20% ethanol and individually wrapped can be used as many as needed. It is required to remove 20% ethanol and rinse out with distilled water once before use. E. Storage buffer Composition of Storage buffer in the Kit 2 is as follows; 50mM Tris-Cl (ph7.6), 100mM NaCl, 1mM DTT, 0.1mM EDTA, 0.05%(v/v) NaN 3, 50%(v/v) glycerol Please add 1 ml of the storage buffer provided in two separate bottles in the kit to each well of G2 to J1 in Cartridge2 right before use. When necessary, a user may construct another buffer with different composition and use it instead of the storage buffer provided by the manufacturer. Just keep in mind that a user s own buffer should contain 10% of glycerol not to overflow out of the Reaction block. F. TEV protease TEV protease is used to remove 6x histidine tag and supplied in 1.5mL tube. A user may add 100uL of TEV solution each to the wells of row G1 in the Cartridge

13 3.5. Experimental procedure Preparation of experiment Supplies ; latex gloves, forceps, sterile distilled water in squeeze bottle, scissors, micropipettes, Reaction block (provided with the ExiProgen instrument) 1 Take out the Cartridge 2 from a freezer and thaw it at room temperature. (Please make sure that all solutions are completely thawed before the experiment.) 2 Get the Cartridge 1 in the Kit 1 out of a refrigerator and leave it at room temperature. 3 Prepare the Reaction block. 4 Take out twice as many Dialysis tubes as the number of samples, remove the 20% ethanol solution and rinse out the inside and the outside of the tube with sterile distilled water. 5 Install the DW-rinsed Dialysis tube on a Reaction Block as the diagram below indicates. Fill 500 ul of sterile distilled water in the Dialysis tube located in the row B. Protein Expression Section Dialysis Section 6 Take Disposable filter tip and a Protection cover out of the Kit box

14 Preparation of protein expression mixture The first step of protein synthesis using the ExiProgen is to prepare the protein expression solution containing template DNA. 1 Cut off quickly 8-tube strip of E. coli extract, Master mix, and DEPC DW as many as the number of samples and thaw them on ice.. 2 When using Positive Control DNA, take out the Positive Control DNA tube from the kit2 and thaw it on ice. Note) The pbivt-(tev site)-acgfp of about 3.8 kb which corresponds to 29kDa size of protein is provided as a Positive Control DNA. 3 Prepare protein expression solution using pre-thawed E. coli extract, Master mix and DEPC DW. It is necessary to spin-down each tube with a micro centrifuge and then mix with a pipette before use. Positive Control Sample Template DNA 6 ul X ul E. coli extract 120 ul 120 ul Master mix 210 ul 210 ul DEPC DW 114 ul (120-X) ul Total 450 ul 450 ul Note) The amount of template DNA, in microgram quantity, can be determined generally as follows. Use 0.6 µg of plasmid DNA per kb (kilobase) of the insert size of DNA. (For example, 3 µg of plasmid DNA is appropriate for 5 kb-sized insert). If you want to get the maximum amount of protein, please refer to the Appendix 2 for further information. 4 Remove water completely from the inside of Dialysis tube in the row A of the reaction block, then add protein expression solution. 5 Cover the Protection cover on a Reaction Block. 12

15 Protein synthesis with ExiProgen 1 Punch holes in the sealing films of Buffer Cartridge 1 and 2 using a 6 hole punch before the installation of the Cartridges on the ExiProgen instrument, and add the of TEV protease on G1 and Storage buffer on G2~J1 rows of Cartridge 2 (Refer to the page 9~10). Note) The number of columns punched should be matched with the sample number. Example1) For 1 sample Example 2) For 8 sample 2 Install the Buffer Cartridges and related components on the ExiProgen instrument as follows; 1. Open the door of ExiProgen TM instrument, pull out the Base Plate completely. 2. Install the Cartridge 2 in the position of 2 on the Base Plate. * Ensure that Cartridge 2 is firmly installed without any movement and that the row L of the Cartridge 2 is located on the top of the heating block of the Base Plate. 13

16 3. Install the Cartridge 1 in the position of 1 on the Base Plate. * There are silicon rings embedded in both sides of the installation position of Cartridge 1. Install the left side of the Cartridge 1 first and then the right side. Ensure that the Cartridge 1 is firmly installed, without any movement. 4. Install the Waste Tray between the Cartridge 2 and 1. * Follow the exact installation order of Cartridge 2 Cartridge 1 Waste Tray. Ensure that the Cartridges and the Waste Tray are firmly installed, without any movement. 5. Install the Reaction Block on the magnetic part of the Base Plate. (See the left figure.) * Ensure that the row A of the Reaction block is located toward the two Cartridges (inside) and the row B toward a user (outside). 6. Load as many Disposable tip(s) as the number of samples into the same location of column with punched hole(s) in the row B of the Disposable Tip Rack * Ensure that 1) tips are located at the same columns with the punched holes of the Cartridges, and 2) there should be no tip at the columns which will not be used. 7. Push the Base Plate completely, until you hear click sound or feel clicking, and close the door of ExiProgen. 14

17 3 After completion of setup, run the ExiProgen instrument as follows. 1. Turn on the ExiProgenTM instrument and press the Press to start button in the center of the screen. Soon the ExiProgen screen with moving scroll bar appears, and after a short period of time it moves to the MENU screen. The short pause is for the initialization process of the instrument. If it does not move to the next screen, turn off the instrument and call the customer center for A/S. 2. In the MENU screen, press Start button to select a proper protocol. 3. In the PREP SETUP screen shown as left, input 904 of protocol number. Ensure that the statement Prep type: Protein Sample SRC; Synthesis_TF appears on the screen. Then select Enter. 15

18 4. Choose ok to go to the next step. * This step is for nucleic acid extraction only. 5. Choose 30 and ok to go to the next step. 6. Ensure that everything is correctly installed following the CHECK LIST, then choose ok. If not, make an appropriate change. 7. In the Running Mode screen shown as left, ensure that the statement Prep type: Protein Sample SRC; Synthesis_TF appears on the screen. Then press RUN to initiate protein synthesis. Work Completion screen appears when the Tagfree protocol is completed. Open the door and collect purified proteins. Remove all components used in the experiment, and choose 1, 2, or OK; * UV lamp will be on automatically if ok button is selected to finish the use of the ExiProgen. 16

19 Analysis of sample After the synthesis of protein using the ExiProgen TM instrument, the final target protein in about 180~190 ul of Storage buffer is collected from the Dialysis tube in the row B of Reaction Block. (It may contain trace amount of Ni-NTA magnetic beads, which has no influence to the protein and can be easily removed through centrifugation at 10,000 rpm for 1 min). Final target proteins Some of reaction samples from protein expression and/or purification processes could also be collected from the wells of row K1, or K2 at the Cartridge 2 as shown in Figure 2. Figure 2. Samples at the selected rows of Cartridge 2 Expression sample Unbound sample * Expression sample ; Samples after expression, but without purification * Unbound sample ; Samples not bound to Ni-NTA beads 17

20 Through SDS-PAGE or other methods a user is able to check whether the desired protein is synthesized accordingly. Here is the protocol for SDS- PAGE: a. Prepare loading mixture as shown in the table. Final target protein solution Expression/Unbound sample 5 ul 5 ul 4x loading dye 5 ul 5 ul Sterile DW 10 ul 10 ul Total 20 ul 20 ul b. Treat the samples at 95 for 5-10 min. c. Prepare SDS-PAGE mini-gel either 10% or 12% SDS-PAGE gel (10x8 (cm),10 wells) is typically used. Load 10 ul of Final target protein solution and 5 ul each of Expression/Unbound to a well and run the SDS-PAGE. d. After staining of the gel with Coomassie blue solution, a band of target protein is detected as in Figure 3. Figure 3. Final target protein on SDS-PAGE M1; AccuLadder Protein Size Marker (Low), 1; Dual specificity protein phosphatase 3 (22kDa), 2; Human growth hormone (23kDa), 3; CAT (24kDa), 4; AcGFP (28kDa) 18

21 Figure 4. Confirmation of removal of 6x histidine tag from target protein M: AccuLadder Protein Size Marker (Low), 1 : Expression sample of pbivt-tev-acgfp, 2 : Histidine tag-tev-acgfp (histidine tagged sample), 3 : AcGFP (histidine tag-free sample) ( 19

22 4. Maintenance After protein synthesis, wash and store the Reaction Block and other accessories as follows. A. Reaction Block Rinse all the used wells of the Reaction Block with sterile distilled water. Remove any residual water completely and store it in 70% ethanol solution. B. Waste tray and Disposable tip rack Discard all the solution in the waste tray, wash it in the running water and rinse it with 20% ethanol. If there remains any dirty sludge on the Disposable tip rack, clean it with 20% ethanol solution. And store at room temperature. C. Cartridge 1, 2 The Cartridges with unused wells should be covered with their lid and be stored in a refrigerator (Cartridge 1) and in a freezer (Cartridge 2). 20

23 5. Troubleshooting guide Please refer to the troubleshooting guide below if there is a problem in protein synthesis/purification using Bioneer s ExiProgen protein synthesis kits and the ExiProgen instrument. Keep in mind those solutions in the guide are for most of proteins, but not for all proteins. 1. No protein synthesis, including positive control protein Causes Contamination of nucleases (DNase or RNase) Solutions Wear gloves all times. Use DNase- & RNase-free pipette tips. Pipetting error or no reagent added Inappropriate storage of reagents Check accuracy of pipettes. Add exact amount of DNA and/or reagents. Mix every reagents exactly according to the protocol. Store every reagents/components in the kit at recommended temperature. No repeated freeze-and-thaw of E. coli extract. 2. No protein synthesis, except positive control protein Causes Error(s) in gene sequence of Template DNA Solutions Check if the target gene contains start codon (ATG) and stop codon (TAA, TAG, or TAG) at the right position. Check if the target gene codon is in-frame. Check if there is a mutation in the ORF (Open Reading Frame) of template DNA (Translation may be stopped.). 21

24 Structure of expression vector Contamination DNA of template Check if the gene of a target protein is cloned into the expression vector with T7 expression system containing T7 promoter, T7 terminator, and RBS. Add appropriate amount of IPTG (Isopropyl β-d-1-thiogalactopyranoside) to reaction mixture if the expression vector can produce endogenous lac repressor. Prepare and use fresh, uncontaminated template DNA. 3. Low yield of target protein Causes Solutions Low purity of template DNA Use template DNA of which A 260/280 is between 1.7 and 2.0, and A 260/230 is over 1.5. Concentration of template DNA No codon optimization of template DNA to E. coli Determine and use the optimal concentration of template DNA (See Appendix 2.). Do the codon optimization of target gene to E. coli. 22

25 4. Low activity and/or solubility of target protein Causes Requiring posttranslational modification for activity and/or solubility Requirng cofactor for protein activity Aggregation of protein due to low solubility Solutions Not available yet, due to the lack of posttranslational modification in cell-free protein synthesis using E. coli Add the cofactor required to the final target protein. Synthesize protein at lower temperature. Add chaperone protein to help protein folding. 23

26 6. Appendix 1 : pbivt vectors pbivt vector set (Cat. No. K-7350) is designed for Bioneer s cell-free protein synthesis system. It fits well into all kits of ExiProgen protein synthesis system. Using this vector set it is possible to add 6x histidine tag to either N-terminal or C- terminal of target protein. The structure of vector is as follows. 1 pbivt-1 s MCS (Multi Cloning Site) sequences CATATGCACCACCACCACCACCACGGATCCGAGCTCAAGCTTGCGGCCGC Nde I 6x histidine tag BamH I Sac I Not I ATAGGTCGAC Sal I 2 pbivt-2 s MCS (Multi Cloning Site) sequences CATATGGGATCCGAGCTCAAGCTTGCGGCCGCACACCACCACCACCACC Nde I BamH I Sac I Not I 6x histidine tag ACTAGGTCGAC Sal I 24

27 7. Appendix 2 : Determination of template DNA concentration A different amount of template DNA in protein synthesis reaction with ExiProgen may result in a different yield of target protein. It is strongly recommended to optimize the amount (or concentration) of template DNA for protein synthesis in the ExiProgen. For the optimization of template DNA amount it is useful to use the AccuRapid Cell-free Protein Expression Kit (Cat. No. K-7250). Protocol is shown in the below. AccuRapid TM Cell-Free Protein Expression Kit (Cat. No. K-7250) 1. Prepare template DNA with the following concentrations. Ex) 25, 50, 100, 200, 300, and 400 (ng/ul) 2. Express the target protein following the manual of AccuRapid Kit 1) Prepare reaction mixture - Reaction volume ; 45 ul - Sample DNA ; Add 2 ul of template DNA from #1. ; Final DNA amount Ex) 50, 100, 200, 400, 600, and 800 ng/rxn 2) Incubate the mixture at 30 for 3 hrs. 3) Verify the amount of template DNA which shows the highest yield of target protein, through SDS-PAGE. ExiProgen TM EC-Tagfree Protein Synthesis Kit 3. Determine the 10-times more DNA of the optimized amount from Add the amount of template DNA from 3. Then synthesize protein using the ExiProgen EC-Tagfree Protein Synthesis Kit. 25

28 8. References Ahn JH, Kang TJ, Kim DM (2008) Tuning the expression level of recombinant proteins by modulating mrna stability in a cell-free protein synthesis system. Biotechnol Bioeng 101: Ahn JH, Keum JW, Kim DM (2008) High-throughput, combinatorial engineering of initial codons for tunable expression of recombinant proteins. J Proteome Res 7: Chursov A, Walter MC, Schmidt T, Mironov A, Shneider A, et al. (2011) Sequencestructure relationships in yeast mrnas. Nucleic Acids ResIn press Frydman J, Hartl FU (1996) Principles of chaperone-assisted protein folding: differences between in vitro and in vivo mechanisms. Science, 272(5267): Frydman J (2001) Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu Rev Biochem, 70: Forster AC, Cornish VW, Blacklow SC (2004) Pure translation display. Anal Biochem 2004, 333(2): Gualerzi CO, Giuliodori AM, Pon CL (2003) Transcriptional and posttranscriptional control of cold-shock genes. J Mol Biol, 331(3): Hino M, Kataoka M, Kajimoto K, Yamamoto T, Kido J, Shinohara Y, Baba Y (2008) Efficiency of cell-free protein synthesis based on a crude cell extract from Escherichia coli, wheat germ, and rabbit reticulocytes. J Biotechnol, 133(2): Honda S. et al. (2008) Crystal Structure of a Ten-Amino Acid Protein. J Am Chem Soc. 130(46): Jermutus L, Ryabova LA, Pluckthun A (1998) Recent advances in producing and selecting functional proteins by using cell-free translation. Curr Opin Biotechnol, 9(5): Josephson K, Hartman MC, Szostak JW (2005) Ribosomal synthesis of unnatural peptides. J Am Chem Soc, 127(33): Katzen F, Chang G, Kudlicki W (2005) The past, present and future of cell-free protein synthesis. Trends Biotechnol, 23(3): Keum JW, Ahn JH, Choi CY, Lee KH, Kwon YC, et al. (2006) The presence of a common downstream box enables the simultaneous expression of multiple proteins in an E. coli extract. Biochem Biophys Res Commun 350: Keum JW, Ahn JH, Kang TJ, Kim DM (2009) Combinatorial, selective and reversible control of gene expression using oligodeoxynucleotides in a cell-free protein synthesis 26

29 system. Biotechnol Bioeng 102: Kigawa T, Yamaguchi-Nunokawa E, Kodama K, Matsuda T, Yabuki T, et al. (2002) Selenomethionine incorporation into a protein by cell-free synthesis. J Struct Funct Genomics 2: Kim HC, Kim TW, Kim DM (2011) Prolonged production of proteins in a cell free protein synthesis system using polymeric carbohydrates as an energy source. Process Biochemistry 46: Kim TW, Keum JW, Oh IS, Choi CY, Park CG, et al. (2006) Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. J Biotechnol 126: Kim TW, Oh IS, Keum JW, Kwon YC, Byun JY, et al. (2007) Prolonged cell free protein synthesis using dual energy sources: Combined use of creatine phosphate and glucose for the efficient supply of ATP and retarded accumulation of phosphate. Biotechnol Bioeng 97: Kuriki Y (1986) Stimulation in vitro of expression of the amp gene of pbr322 by soluble protein fractions isolated from E. coli. Biochem Int, 12(4): Nallamsetty, S., Waugh DS (2007) A generic protocol for the expression and purification of recombinant proteins in Escherichia coli using a combinatorial His6-maltose binding protein fusion tag. Nat Protoc. 2(2): Netzer WJ, Hartl FU (1997) Recombination of protein domains facilitated by cotranslational folding in eukaryotes. Nature, 388(6640): Ohashi H, Shimizu Y, Ying BW, Ueda T (2007) Efficient protein selection based on ribosome display system with purified components. Biochem Biophys Res Commun, 352(1): Park S, Hamad-Schifferli K (2010) Enhancement of in vitro translation by gold nanoparticle DNA conjugates. ACS Nano 4: Ramachandiran V, Kramer G, Hardesty B (2000) Expression of different coding sequences in cell-free bacterial and eukaryotic systems indicates translational pausing on Escherichia coli ribosomes. FEBS Lett, 482(3): Roberts RW, Szostak JW (1997) RNA-peptide fusions for the in vitro selection of peptides and proteins. Proc Natl Acad Sci U S A, 94(23): Rungpragayphan S, Nakano H, Yamane T (2003) PCR-linked in vitro expression: a novel system for high-throughput construction and screening of protein libraries. FEBS Lett 540:

30 Shimizu Y, Inoue A, Tomari Y, Suzuki T, Yokogawa T, Nishikawa K, Ueda T (2001) Cell-free translation reconstituted with purified components. Nat Biotechnol, 19(8): Shimizu Y, Kanamori T, Ueda T (2005) Protein synthesis by pure translation systems. Methods, 36(3): Swartz J (2006) Developing cell-free biology for industrial applications. J Ind Microbiol Biotechnol, 33(7): Torizawa T, Shimizu M, Taoka M, Miyano H, Kainosho M (2004) Efficient production of isotopically labeled proteins by cell-free synthesis: a practical protocol. J Biomol NMR 30: Tropea JE. et al. (2007) A generic method for the production of recombinant proteins in Escherichia coli using a dual hexahistidine-maltose-binding protein affinity tag. Methods Mol Biol. 363:1-1 Trotta E (2011) The 3-base periodicity and codon usage of coding sequences are correlated with gene expression at the level of transcription elongation. PLoS ONE 6: e Underwood KA, Swartz JR, Puglisi JD (2005) Quantitative polysome analysis identifies limitations in bacterial cell-free protein synthesis. Biotechnol Bioeng, 91(4): Villemagne D, Jackson R, Douthwaite JA (2006) Highly efficient ribosome display selection by use of purified components for in vitro translation. J Immunol Methods, 313(1-2): Waugh DS. (2005) Making the most of affinity tags. Trends Biotechnol. 23(6): Ying BW, Taguchi H, Ueda H, Ueda T (2004) Chaperone-assisted folding of a singlechain antibody in a reconstituted translation system. Biochem Biophys Res Commun 2004, 320(4): Zubay G (1973) In vitro synthesis of protein in microbial systems. Annu Rev Genet, 7:

31 7. Related products Cat. No. Product Size K-7250 AccuRapid Cell-Free Protein Expression Kit K-7260 AccuRapid Midi Protein Expression Kit K-7270 AccuRapid Maxi Protein Expression Kit K ul x 24 reactions 1mL x 5 reactions 10mL x 1 reaction 16 reactions K-7301 ExiProgen TM EC Protein Synthesis Kit 32 reactions K reactions K-7310 ExiProgen TM EC-Maxi Protein Synthesis Kit 8 reactions K-7330 ExiProgen TM EC-Disulfide Protein Synthesis Kit 8 reactions K-7350 pbivt vector set Each 5ug K reactions ExiProgen TM ProXpress PCR Template Kit K reactions D-2010 AccuLadder Protein Size Marker (Broad) 500 ul D-2020 AccuLadder Protein Size Marker (Low) 500 ul S-2041 Gene Synthesis Service - S-2500 Protein Synthesis Service - A-5041 ExiProgen TM

32

33 사용설명서 8 Version No.: 1.0 ( ) Please read all the information in booklet before using the kit 바이오니아 대전광역시대덕구문평서로 8-11 Tel: Fax: order@bioneer.co.kr

34 Safety warning and Precaution ExiProgen TM EC-Tagfree Protein Synthesis Kit is developed and supplied for research purposes only. Certain applications possible with this kit may require special approval by appropriate local and/or national regulatory authorities in the country of use. Wear appropriate protection when handling any irritant or harmful reagents. The use of a laboratory coat, protective gloves and safety goggles are highly recommended. For more information please consult the appropriate Material Safety Data Sheet (MSDS). Warranty and Liability All BIONEER products undergo extensive Quality Control testing and validation. BIONEER guarantees quality during the warranty period as specified, when following the appropriate protocol as supplied with the product. It is the responsibility of the purchaser to determine the suitability of the product for its particular use. Liability is conditional upon the customer providing full details of the problem to BIONEER within 30 days. Patent ExiProgen TM and its kits are protected by the patents KR , PCT/KR2012/006715, KR , and KR Trademark ExiProgen TM is trademark of Bioneer Corporation. Copyright 2012 by Bioneer Corporation, All rights reserved.

35 Contents 1. Introduction The ExiProgen protein synthesis system ExiProgen EC-Tagfree Protein Synthesis Kit Overview Preparation of template DNA Kit contents and storage Information of components Cartridges Other components Experimental procedure Preparation of experiment Preparation of protein expression mixture Protein synthesis with ExiProgen Analysis of sample Maintenance Troubleshooting guide Appendix 1 : pbivt vectors Appendix 2 : Determination of template DNA concentration References Related products

36 1. Introduction 단백질은효소, 호르몬, 구조단백질등의다양한기능으로생체반응에있어서필수적인요소이기때문에, 포스트게놈시대에이러한단백질들의역할및구조등에대한연구가활발하게진행되고있으며, 이러한연구는특정단백질을만들어내는것으로부터시작됩니다. 재조합단백질을합성하는방법은대장균, 효모, 동물세포등다양한세포주를이용하며, 재조합단백질을발현할수있는벡터를세포내로형질전환시키고세포주를배양하여재조합단백질을발현시킨후이세포를파쇄하여발현된단백질을정제하는방법들이일반적으로사용되고있습니다. 이방법은재조합단백질을안정하게발현시키는균주선별과정을필요로하며, 이후세포배양, 세포파쇄, 그리고단백질정제의일련의과정을거쳐야하므로많은시간과노동력이필요합니다. 특히세포주에독성을나타내는단백질인경우에는단백질을발현시키는것이어려워다양한발현조건들을시도해야만하기에많은노력이필요하여하나의순수한단백질을합성하기까지최소수일에서길게는수개월의시간이소요됩니다. 이러한문제점을극복하고자짧은시간내에반응용기내에서단백질을합성하는무세포단백질발현방법과이와관련한제품들이개발되어왔습니다. 이방법은반응용기에단백질을발현할수있는주형 DNA ( 예 )expression vector, PCR product), 세포파쇄액, 아미노산과핵산그리고에너지물질이들어있는단백질발현용액을첨가한후, 적정온도에서반응을시켜재조합단백질을발현시키는방법으로, 세포를사용하여단백질을발현시키는방법에비해서소요시간을획기적으로줄일수있을뿐만아니라세포내에서독성을가지는단백질도발현을시킬수있다는장점을가지고있습니다. 무세포단백질발현법은새로운유전자의기능에대한발견뿐만아니라다양한 mutants 단백질들에대한성능을비교하는데사용되고있으며, 단백질- 단백질상호작용기작연구, 단백질의활성부위에대한연구등에도폭넓게활용되고있습니다

37 2. The ExiProgen TM protein synthesis system 바이오니아에서는무세포단백질발현방법과나노자성입자를이용한 친화성정제방법을이용하여전자동으로다양한단백질을합성하고고순도로 정제할수있는 ExiProgen 전자동단백질합성장비를개발했습니다. ExiProgen 전자동단백질합성장비는당사의다양한단백질발현및정제키트를이용하여고순도의단백질을전자동으로획득할수있으며, 뿐만아니라핵산추출키트를이용하여다양한시료로부터필요한 DNA, RNA 를전자동으로추출할수있습니다. 당사의단백질발현및합성키트는세가지제품군 (35 페이지참조 ) 으로분류됩니다. 무세포단백질발현에사용되는 template DNA 를제조하는키트와 Manual 방식으로손쉽게재조합단백질발현할수있는 AccuRapid series 및 ExiProgen 을이용하여전자동으로단백질을발현하고정제할수있는 ExiProgen series 로나누어집니다. 당사의키트는 E. coli 의 T7 발현시스템을이용하며, 주형 DNA (Expression vector 또는 PCR product) 만가지고있으면곧바로단백질발현에사용할수있습니다. 또한 ExiProgen 장비를이용한전자동단백질합성은주형 DNA 를이용하여단백질발현한후, 목적단백질을정제하는순차적인반응으로진행이됩니다. 각키트를이용하여최소 ug 단위부터최대 mg 단위까지단백질의발현및합성이가능합니다. 각키트에대한자세한설명은바이오니아홈페이지 ( 을참조하시기바랍니다. 34

38 35

39 3. ExiProgen EC-Tagfree Protein Synthesis Kit 3.1. Overview ExiProgen EC-Tagfree Protein Synthesis Kit는당사의 ExiProgen 장비를이용하여전자동으로 6x histidine tag 가제거된목적단백질을합성할수있는키트입니다. 특정단백질의경우, 6x histidine tag이단백질활성및구조형성에부정적영향을미칠수있기때문에 histidine tag을제거해주어야만합니다. 이키트는순수목적단백질을반응당최대 200 ug까지합성할수있으며, 단백질발현 / 정제를비롯하여, 6x histidine tag 제거및투석까지모든과정이전자동으로이루어지며, 최종목적단백질은 Storage buffer에용해된상태로회수할수있습니다. 이키트는단백질발현에필요한에너지원등을지속적으로공급해줌으로써단백질발현수율을높이는당사의 stepwise exchange cell free 단백질발현법을이용하여단백질을발현하고, 발현된단백질은 Ni-NTA magnetic bead에결합한상태로, 단백질분해효소인 TEV 처리에의해순수목적단백질만정제되는키트이며그원리는아래와같습니다. 36

40 3.2. Preparation of template DNA ExiProgen TM EC-Tagfree Protein Synthesis Kit 에서사용가능한 template DNA 의구조는아래와같습니다. template DNA 는 T7 promoter - Ribosome binding site (RBS) 6x histidine tag TEV recognition site - Target gene - T7 terminator 의구조를가지고있어야하며, 그구조는아래와같습니다. < 그림 1> 1) Template DNA 구조 (5 end 6x histidine tagged template) T7 Promoter---RBS 2) TEV site sequence ATG 6x histidine tag--tev site--target stop T7 terminator G l u - X - X - Tyr - X - G l n - G l y( o r S e r ) TEV Cleavage site 발현벡터는 바이오니아에서판매하는 In vitro translation 전용벡터인 pbivt 벡터 (Cat. No. K-7350, Appendix 1. 참조 ) 에클로닝하여사용가능 하며, 그밖에도 pk7, pivex, pet 벡터등을사용할수있습니다. 단백질합성을최대화하기위해서는 DNA 의서열이 E.coli 코돈에최적화되어있어야하며, 만약코돈최적화가안되어있는경우당사의 Gene synthesis service 를통해서합성하실수있습니다. 또한당사의 In vitro translation 전용 vector 에클로닝된상태로제공받으실수있습니다. 자세한내용은홈페이지 ( co.kr) 를참조하시기바랍니다. 37

41 Note 1) Template DNA 제작방법 1 보유하고있는발현벡터 (N-terminal histidine tagged) 를사용하는경우 6x histidine tag과 target gene 사이에 TEV 인식서열이 (ex ; GAAAACTTATATTTTCAGGGC, Glu-Asn-Leu-Tyr-Phe-Gln-Gly) 포함된 PCR product를확보후, 사용하고자하는발현벡터에클로닝하시면됩니다. 2 Positive control DNA 를 Vector 로사용하는경우 아래와같이 primers 를제작하여 PCR produc 를확보하시기바랍니다. Forward primer : 5 -CGCCTACGGATCCGAAAACTTATATTTTCAGGGCXXXXXXXXXXXXX-3 BamHⅠ TEV recognition site Overlapping sequence to target gene (18-mer) Reverse primer : 5 - CGCCTACGCGGCCGCXXXXXXXXXXX 3 NotⅠ Overlapping sequence to target gene 준비된 PCR product 는 Positive Control DNA 에클로닝하시면됩니다. 38

42 3.3. Kit contents and storage ExiProgen EC-Tagfree Protein Synthesis Kit 1 Cartridge 1 96 well x 1ea Store Dialysis tube 1 pack (16 ea/pack) at 4 ~ 8 Disposable filter tip 1 pack (8 ea/pack) Store at Protection cover 1 ea Room temperature ExiProgen EC-Tagfree Protein Synthesis Kit 2 Cartridge 2 96 well x 1ea E. coli extract 8-tube strip (Yellow) x 1 ea Master mix 8-tube strip (Violet) x 1 ea DEPC DW 8-tube strip (White) x 1 ea Storage buffer 35 ml tube x 2 ea TEV protease 1.5mL tube x 1ea Positive control DNA 1.5mL tube x 1 ea Store at -20 ~ -70 ExiProgen TM EC-Tagfree Protein Synthesis Kit 는 Kit 1 과 Kit 2 로구성되어 있습니다. Kit 1 에는단백질정제에사용할 buffer 류를포함하는 Cartridge 1 과 Disposable filter tip, Dialysis tube 그리고 Protection cover 가포함되어있으며, 이중 Cartridge 1 은냉장보관 (4~8 ) 해야합니다. 또한 Kit 2 는단백질발현에사용할 Feeding 용액이들어있는 Cartridge2 와 E. coli extract, Master mix, DEPC DW, Storage buffer, TEV protease 그리고 Positive Control DNA 가포함되어있으며, 냉동보관 (-20~-70 ) 에서보관해야 합니다. ( 이중 E. coli 권장합니다.) extract 는 deep freezer (-70 ) 에서보관하는것을 본키트의 Cartridges 는교차오염, 증발, 용액누출을막기위해 Sealing film 으로밀봉포장되어있고, 키트의모든플라스틱제품이나버퍼류는 DNasefree, RNase-free 상태로제공되므로보관및사용중 Nuclease 또는 Protease 에의해서오염되지않도록주의하시기바랍니다. 39

43 3.4. Information of components Cartridges 에단백질발현물이결합할수있게평형화해주며목적단백질결합후세척과정불순물제거에사용 세척에사용 순차적단백질발현반응시첨가해주는단백질발현용액으로아미노산에너지원등을포함하고있음 단백질정제후최종목적단백질을보관해주는완충용액 을제거에사용 40

44 Other components A. E. coli extract Kit 2 의구성품인 E. coli extract 는세포파쇄액으로, 단백질발현에필요한필요한 T7 RNA polymerase, Ribosome, trna 등을공급해주며, 8-tube strip 으로공급되며, 각 tube 당 130 ul 씩분주되어있습니다. B. Master mix Kit 2 의구성품인 Master mix 는단백질발현에필요한 NTPs, 아미노산및에너지원과 salt 를포함하고있으며, 8-tube strip 으로공급되며, 각 tube 당 220 ul 씩분주되어있습니다. C. DEPC DW 단백질발현용액의최종부피를맞추어주는용도로사용되며, 8-tube strip 으로공급되며, 각 tube 당 130 ul 씩분주되어있습니다. D. Dialysis tube Dialysis tube 는당사에서제작한특수한 membrane tube 로, Feeding buffer 내의에너지원을단백질발현용액으로공급해주고, 목적단백질정제후정제버퍼를 Storage buffer 로교체할때사용되며, 20% ethanol 에담겨져있습니다. 또한각 tube 는개별포장되어있으므로, 사용시필요한개수만큼꺼내어사용하시면됩니다. 사용하기전 20% 에탄올을제거하고 DW 로한번세척한후사용하기바랍니다. E. Storage buffer Kit 에들어있는 Storage buffer 의조성은다음과같습니다. 50mM Tris-Cl (ph7.6), 100mM NaCl, 1mM DTT, 0.1mM EDTA, 0.05%(v/v) NaN 3, 50%(v/v) glycerol Storage buffer 는 bottle 에제공되며, 사용직전에 Cartridge 2 의 G2~J1 열에 1mL 씩분주하여사용하시면됩니다. 만일다른조성의 buffer 를사용하시고자하는경우조성에맞게직접제조하여사용하시면됩니다. 단, buffer 에 glycerol 을 10% 이상첨가해주셔야합니다. 그렇지않을시, 투석튜브내의용액이 Reaction block 밖으로넘쳐흐를수있습니다. F. TEV protease 6 x histidine tag 을제거하는데사용되며, 사용직전에 Cartridge 2 의 G1 열에 100uL 씩분주하여사용하시면됩니다. 41

45 3.5. Experimental Procedure Preparation of experiment 준비물 ; 라텍스장갑, 핀셋, 멸균수가들어있는 squeeze bottle, 폐수통, 가위, micropipettes, Reaction block (ExiProgen 악세사리 ) 1 냉동보관중인 Cartridge 2를상온에서미리녹입니다. ( 사용전모든용액이완전히녹은것을확인하고사용하시기바랍니다. 참고 ) 상온 (20~25 의경우약 2 시간소요됨 ) 2 냉장보관중인 Cartridge 1은꺼내서상온에둡니다. 3 Reaction block 을준비합니다. 4 키트 1 박스에서 Dialysis tube 를 sample 수의 2 배개수만큼핀셋을이용하여 tube 를꺼낸후, pipettes 을이용하거나상하로흔들어주어 tube 내의에탄올을제거합니다. 그후, squeeze bottle 에있는멸균증류수로, tube 안과, 바깥쪽을세척해줍니다. 5 Pipettes 을이용하여 tube 내의물기를완전히제거하고, Reaction block 에하기그림과같이장착하고, B 행의 tube 에는멸균증류수 500uL 를채워놓습니다. Protein Expression Section Dialysis Section 6 키트 1 박스에서 Disposable filter tip 그리고 Protection cover 를꺼내서준비합니다. 42

46 Preparation of protein expression mixture ExiProgen 으로단백질합성을하기에앞서, 발현시키고자하는 DNA 가 첨가된발현용액을제조해야합니다. 1 키트 2 번박스에서 E. coli extract, Master mix, DEPC DW tube 를 반응시료의수에맞게꺼내어녹입니다. 2 (Positive Control DNA 를사용하고자하는경우 ) 키트 2 번박스에서 Positive Control DNA tube 를꺼내어녹입니다. 참고 ) Positive Control DNA 로는 pbivt-(tev site)-acgfp 가제공되며, 약 3.8kb ( 단백질크기 29kDa 의분자량 ) 입니다. 3 미리녹인 E. coli extract 와 Master mix, DEPC DW 를이용하여 하기와같이단백질발현용액을제조합니다. ( 각 tube 를 spin-down 한후, tube 내의용액을 pipette 으로 mixing 한후사용하시기바랍니다.) Positive Control Sample Template DNA 6 ul X ul E. coli extract 120 ul 120 ul Master mix 210 ul 210 ul DEPC DW 114 ul (120-X) ul Total 450 ul 450 ul 참고 ) Sample DNA 의양은다음과같이정할수있습니다. 일반적으로 plasmid DNA 크기에비례하여 0.6ug/kb (ex) plasmid DNA ; 5kb 3 ug 사용 ) 를첨가하시면되지만, 최적의단백질 합성을원하시는경우 Appendix 2. 를참조하여 DNA 농도스크리닝 실험을선행하시기바랍니다. 4 위에서제조한각단백질발현용액을 Reaction block 의 A 행의 tube 에 넣습니다. 5 Reaction block 위에 Protection cover 를씌워실험준비를마칩니다. 43

47 Protein synthesis with ExiProgen 1 ExiProgen 장비에장착하기에앞서, 6 Hole-punch (ExiProgen 장비악세사리 ) 를이용하여, cartridge 1, 2의실링필름에구멍을뚫어주시기바랍니다. Cartridge 2의 G1열에는 Page 40~ 41와같이준비한 TEV protease를, G2~J1열에는 Storage buffer를분주하시기바랍니다. 예 1) 1 개의시료인경우 예 2) 8 개의시료인경우 2 이후, 아래의순서로 ExiProgen 장비에장착하시기바랍니다. 1. ExiProgen TM 장비의문을열고 Setup tray 를 앞으로완전히잡아당깁니다. 2. 숫자 2 가씌여진위치에 Cartridge 2 를 장착하시기바랍니다. 주의 ) Cartridge 2 의 L 행을 Heating block 위의 guard 에끼워넣어장착하신후, Cartridge 가 흔들리지않는지확인하시기바랍니다. 44

48 3. 숫자 1 이씌여진위치에 Cartridge 1 을 장착하시기바랍니다. 주의 ) Cartridge 1 장착위치에는 Cartridge 고정을위한실리콘링이양쪽에있습니다. 따라서 Cartridge의왼쪽면부터맞춘후, 오른쪽면을눌러서끼우고, Cartridge가흔들리지않는지확인하시기바랍니다. 4. Cartridge 2와 1을모두장착한후, 사이에 Waste tray를장착하시기바랍니다. 주의 ) Cartridge 2 Cartridge 1 Waste tray 순서를지켜서장착하신후, 흔들리지않고제대로고정이되었는지, 확인하시기바랍니다. 5. 반응용기위에 Protection cover를씌우고, 좌측의그림과같이마그네틱파트가있는부분에반응블럭을장착하시기바랍니다. 주의 ) 반응블럭을장착할시에는 B열은 Tip rack쪽, A열은장비안쪽을향하게장착되었는지확인하시기바랍니다. 6. Disposable Tip Rack의 B행에 sample의개수에맞게 Tip을꽂으시기바랍니다. 주의 ) 단, Cartridge의뚫린 열 과같은 열 에 tip을꽂으셔야합니다. 또한, Cartridge 의뚫지않은열에상응하는위치에는 tip을꽂지마시기바랍니다. 7. Setup tray를밀어넣고문을닫습니다. 단, 이때에 Set up tray는소리가날때까지밀어넣으시기바랍니다. 45

49 3 셋팅이완료된후, 아래의순서로 ExiProgen 장비를가동하시기바랍니다. 1. ExiProgen TM 장비를전원을켜고, Press to start 버튼을눌러주시기바랍니다. start 버튼을누르면, 좌측과같이 ExiProgen 화면이뜨고, 스크롤바가 움직인후, 다음화면으로넘어갑니다. ( 이과정은장비의 X, Y, Z 축값을초기화하는과정입니다. 만약정상적으로다음화면으로넘어가지않는경우에는장비의전원을끄고, A/S센터로연락하시기바랍니다. ) 2. MENU 화면에서 Start 버튼을 누르면, 프로토콜을선택할수있는 다음화면으로넘어갑니다. 3. 좌측화면과같이 PREP SETUP 화면이나타나고, 각키트에해당하는프로토콜번호를선택할수있는화면이나타납니다. 여기에서 904 를눌러화면에서 Prep type: Protein Sample SRC; Synthesis_TF 가나타나는지확인해주시기바랍니다. 그후, Enter 버튼을눌러주시기바랍니다. 46

50 4. 프로토콜선택후, Elution volume 을선택할수있는화면이나타나는데, 이는핵산추출시사용되는것으로본키트사용시에는곧바로 ok 버튼을눌러다음단계로이동하시기바랍니다. 5. Elution volume 선택화면후, 단백질합성시온도를선택할수있는화면이나타나며, 본키트사용시에는 30 를선택하신후, ok 버튼을눌러주시기바랍니다. 6. CHECK LIST 화면이뜨면, Cartridge 와반응블럭등을각위치에맞게셋팅되어있는지확인하신후 ok 버튼을눌러주시기바랍니다. 7. 좌측과같이 Running Mode 화면이뜨면, 최종적으로 Prep type: Protein과 Sample SRC; Synthesis_TF 가맞는지확인하신후, RUN 버튼을눌러주시기바랍니다. 그후, 장비가동이시작되고프로토콜실행이완료되면좌측하단의그림처럼 Work Completion 화면이나타납니다. 실험에사용한모든부속품을제거하신후, 원하시는버튼을눌러주시기바랍니다. ( 단, 종료를원하시어 ok 버튼을누르시면, 시면, UV lamp가가동됩니다.) 47

51 Analysis of sample ExiProgen TM 장비를이용한단백질합성이끝난후, 최종목적단백질은반응블럭의 B행의투석튜브에서회수하실수있으며, 단백질용액은약 180~190 ul 정도가회수됩니다. ( 단, 최종단백질용액에는 Ni-magnetic magnetic bead가포함되어있을수있으나, 이는 centrifuge를통해제거하신후사용하시면됩니다.) 최종단백질시료 또한단백질발현및정제과정중의일부시료는그림 2 와같이 Cartridge 2 의 K1, K2 행에서회수하실수있습니다. 그림 2. Cartridge 2 의각행별시료 Expression sample Unbound sample * Expression sample ; 단백질발현시료 * Unbound sample ; 발현시료를 Ni-NTA bead 에결합시킨후의상등액 (bead 에결합하지않은단백질을포함하는용액 ) 48

52 각시료는 SDS-PAGE 를통해원하는단백질의합성이제대로이루어졌는지확인할수있습니다. a. Loading mixture 를아래와같이제조하시기바랍니다. 최종단백질시료 Expression/Unbound 시료 sample 5 ul 5 ul 4x loading dye 5 ul 5 ul 멸균증류수 10 ul 10 ul Total 20 ul 20 ul b. 95 에서 5~10min 분간열처리를하시기바랍니다. c. 10% 또는 12% SDS-PAGE gel(10x8 (cm), 10 well) 에각시료를하기와같은양을 loading 하신후, running 하시기바랍니다. 최종단백질시료 ; 10 ul Expression/Unbound 시료 ; 5uL d. Coomassie blue 용액으로염색및탈색하시면그림 4 와같이목적단백질의밴드를확인하실수있습니다. 그림 3. 단백질합성확인 M1; AccuLadder Protein Size Marker (Low), 1; Dual specificity protein phosphatase 3 (22kDa), 2; Human growth hormone (23kDa), 3; CAT (24kDa), 4; AcGFP (28kDa) 49

53 그림 4. 목적단백질앞의 6x histidine tag 제거확인 M: AccuLadder Protein Size Marker (Low), 1 : Expression sample of pbivt-tev-acgfp, 2 : Histidine tag-tev-acgfp (histidine tagged sample), 3 : AcGFP (histidine tag-free sample) ( 50

54 4. Maintenance 단백질합성이끝난후, 반응블록및기타장비액세서리는다음과같이 세척후보관하시면됩니다. A. Reaction Block 단백질합성이끝난후, Reaction Block은사용한모든웰을멸균증류수로세척한후, 70% 에탄올용액에담근상태로상온에서보관하시면됩니다. 사용전에꺼내어, 멸균증류수로세척한후말린후사용하시면됩니다. B. Waste tray 및 Disposable tip rack Waste tray는 tray 안의용액을버리고흐르는물에씻은후 20% EtOH을뿌려서닦은후, 보관하면됩니다. 또한 Disposable tip rack은불순물이묻어있지않은경우에는그대로보관하시고, 만약불순물이묻은경우에는 20% EtOH을뿌려서닦은후, 보관하면됩니다. C. Cartridge 1, 2 반응이끝나고, 남은 Cartridge 는뚜껑을덮은상태로, 각각의온도에 맞게냉장또는냉동보관하시기바랍니다. 51

55 5. Troubleshooting Guide 단백질합성에문제가있는경우아래의내용을참고하여해결하시기바랍니다. ( 단, 아래의내용은일반적인단백질의합성에대한해결방법을제시해줄수있으나, 모든단백질의합성문제의해결방안에해당되지는않을수있다는점을유의하시기바랍니다.) 1. Positive control 단백질의합성이되지않는경우 원인핵산분해효소 (DNase, RNase) 의오염 Pipetting error 또는시약미첨가시약의보관상태 해결방안실험을하실때에는항상장갑을끼고, DNase-, RNase-free한 pipette tips을이용하시기바랍니다. 실험을하기전 pipettes을체크하시고, 정확한양의 DNA 또는시약을첨가하시기바랍니다. 또한프로토콜에따라서모든시약이빠짐없이혼합되었는지확인하시기바랍니다. 키트내의모든시약및구성품은권장하는온도에서보관하시기바라며, 특히 E. coli extract는 freezing/thawing을반복하지않도록주의하시기바랍니다. 2. Positive control 단백질은합성되나, 목적단백질이합성되지않는경우 원인 Template DNA 의염기서열 해결방안 Target gene을포함하는코돈의프레임 (ATG (start) ~ TAA, TGA, TAG (Stop)) 이올바른지확인하시기바랍니다. Template DNA의 ORF (Open Reading Frame) 에 mutation이생기는경우 52

56 translation 중간에합성이끝날수있으니, 반드시 ORF의 서열을 확인하시기 바랍니다. 발현벡터의구조 목적단백질을발현할수있는유전자는 T7 promoter와 terminator가있는벡터 (ex) pbivt, pk7, pivex, pet 일부 ) 에 클로닝하여사용하여야하며, endogenous lac repressor가생성될수있는벡터의 경우에는 IPTG를첨가하여합성을하셔야 합니다. Template DNA의오염 Template DNA를 준비하는 과정에서 핵산분해효소의 오염에 의해서 DNA가 분해된 경우에는 단백질 합성이 되지 않습니다. 3. 목적단백질의합성량이낮은경우 원인 Template DNA 의순도 Template DNA 의농도 해결방안최적화된단백질합성을하기위해서는 template DNA의순도가높아야합니다. A 260/280 값이 1.7~2.0, A 260/230 값이 1.5 이상일수록합성효율이높아집니다. 만약 DNA의순도가낮은경우에는단백질의합성이되지않을수도있습니다. Template DNA의농도에따라서단백질의합성량에차이가있을수있습니다. 단백질합성량의최대화하기위해서는실험에앞서발현스크리닝을통해서최적 DNA 농도를결정한후, 단백질합성을하시기바랍니다. (Appendix 2. 참조 ) 53

57 Template DNA 의 E. coli 코돈최적화여부 Template DNA의염기서열이 E. coli 코돈최적화가이루어지지않은경우에는단백질의합성이되지않거나, 합성량이낮을수있습니다. 4. 목적단백질의활성또는 solubility 가낮은경우 원인 Posttranslational modification을필요로하는단백질인경우단백질활성에특정요소를필요로하는경우단백질의 solubility가낮아서 aggregation이되는경우 해결방안 E. coli를이용한무세포단백질합성시스템에서는 glycosylation, phosphorylation 등과같은 posttranslational modification이필요한단백질은합성이불가능합니다. 합성된단백질이활성을나타내기위해서특정요소등을필요로하는경우에는최종적으로정제된단백질용액에이러한요소들을첨가해준후활성을확인하셔야합니다. 단백질합성온도를낮춰주거나, 단백질의 folding을도와주는 chaperone protein을첨가한후합성을하면, solubility가향상될가능성이있습니다. 54

58 6. Appendix 1 : pbivt vectors 당사의무세포단백질합성전용벡터인 pbivt 벡터세트는 ExiProgen 단백질합성시스템의모든키트에적용가능합니다. 본벡터세트는 N-terminal 또는 C-terminal 에 6x histidine tagging 이가능하며, 구조는아래와같습니다. 1 pbivt-1 s MCS (Multi Cloning Site) sequences CATATGCACCACCACCACCACCACGGATCCGAGCTCAAGCTTGCGGCCGC Nde I 6x Histidine tag BamH I Sac I Not I ATAGGTCGAC Sal I 2 pbivt-2 s MCS (Multi Cloning Site) sequences CATATGGGATCCGAGCTCAAGCTTGCGGCCGCACACCACCACCACCACCA Nde I BamH I Sac I Not I 6x Histidine tag CTAGGTCGAC Sal I 55

59 7. Appendix 2 : Determination of template DNA concentration ExiProgen 단백질합성시스템을이용하여단백질을합성하실때, template DNA의양에따라서단백질합성량에차이가있을수있습니다. Template DNA는하기와같이농도에따른발현스크리닝먼저선행하신후, ExiProgen 을이용한단백질합성을하시면최적의단백질합성결과를얻으실수있습니다. AccuRapid TM Cell-Free Protein Expression Kit (Cat. No. K-7250) 1. Template DNA 를각농도별로준비합니다. Ex) 25, 50, 100, 200, 300, 400 (ng/ul) 2. Kit 의매뉴얼에따라서단백질발현실험진행을진행합니다. 1 Reaction Mixture 준비 - Reaction volume ; 45uL - Sample DNA ; 1 번에서준비한 DNA 를각 2uL 씩첨가 ; Final DNA 농도 Ex) 50, 100, 200, 400, 600, 800ng 2 PCR machine 을이용하여 30 에서 3 시간동안반응을시킵니다. 3 SDS-PAGE gel 을통해서최적발현농도를확인합니다. ExiProgen TM EC-Tagfree Protein Synthesis Kit 3. 이전실험을통해확인한최적 DNA 농도의 10 배수에해당하는 DNA 농도를확인합니다. 4. 위에서결정한농도의 DNA 를 ExiProgen EC-Tagfree Protein Synthesis Kit 에첨가하여단백질을합성합니다. 56