untitled

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "untitled"

Transcription

1 OLETF 당뇨쥐에서당뇨시기에따른방광의기능적, 형태학적및분자생물학적변화 Functional, Morphologic, and Molecular Biological Changes in the Bladder of OLETF Diabetic Rats according to Duration of Diabetes Mellitus Jun Ha Lee, Hong Jin Suh, Hyuk Jin Cho, Yong Seok Lee, Hyun Woo Kim, Sang Hoon Kim, Sae Woong Kim, Tae Kon Hwang, Sun-Ju Lee 1, Ji Youl Lee From the Department of Urology, The Catholic University of Korea College of Medicine, 1 School of Medicine, Kyung Hee University, Seoul, Korea Purpose: Our study was undertaken to investigate changes in the bladder according to duration of diabetes mellitus in the Otsuka Long Evans Tokushima Fatty (OLETF) rat model, which is similar to type 2 diabetes. Materials and Methods: OLETF rats (n=14) and Long Evans Tokushima Otsuka (LETO, n=14) rats were used. LETO is a normal control of OLETF. The animals were assigned to 4 groups: L-40 group, LETO rats 40 weeks after birth (n=7); O-40 group, OLETF rats 40 weeks after birth (n=7); L-60 group, LETO rats 60 weeks after birth (n=7); and O-60 group, OLETF rats 60 weeks after birth (n=7). At 40 weeks or 60 weeks after birth, blood glucose, cystometry, bladder weight, detrusor contractility, and mrna expression of nerve growth factor (NGF) were assessed. Results: Cystometry showed that diabetic bladders had increased compliance compared with the control groups at 40 and 60 weeks, and the O-60 group had greater compliance than the O-40 group. Contractile responses to electrical stimulation, bethanecol (250μM), and ATP (10 mm) were decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The mrna expression of NGF was decreased in the experimental groups compared with the control groups, and the O-60 group had lower expression than the O-40 group. Changes in NGF were identified through immunohistochemical staining. Conclusions: The degree of diabetic cystopathy in OLETF rats was changed by duration of type 2 diabetes mellitus. Our results showed that the changes in the bladder in type 2 diabetes mellitus can be identified through a new rat model. (Korean J Urol 2009;50: ) Key Words: Type 2 diabetes mellitus, Neurogenic bladder, Nerve growth factor Korean Journal of Urology Vol. 50 No. 4: , April 2009 DOI: /kju 가툴릭대학교, 1 경희대학교의과대학비뇨기과학교실 이준하ㆍ서홍진ㆍ조혁진ㆍ이용석김현우ㆍ김상훈ㆍ김세웅황태곤ㆍ이선주 1 ㆍ이지열 Received:November 21, 2008 Accepted:December 24, 2008 Correspondence to:ji Youl Lee Department of Urology, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, 505, Banpo-dong, Seocho-gu, Seoul , Korea TEL: FAX: uroljy@catholic.ac.kr C The Korean Urological Association, 2009 서론당뇨병은당뇨병의기간및조절유무에따라다양한합병증을동반하는전신질환으로여러가지합병증중에비뇨기과적으로중요한합병증은당뇨병성방광병증이다. 당 뇨병에의해방광의지각신경및자율신경침범으로유발되는당뇨병성방광병증의유병률은성 (sex) 과나이에관련이없으며, 당뇨병의유병기간과관련이있다. 1 또한당뇨병성방광병증의경우요폐, 잔뇨감, 복압배뇨, 빈뇨, 요실금등다양한배뇨장애를보인다. 당뇨병에따른이러한방광기능의장애에대한기전은아직확실하지는않으나방광 387

2 388 Korean Journal of Urology vol. 50, , April 2009 근의변화, 지각신경및자율신경의변화및요로상피의변화로발생한다고생각되고있다. 2 당뇨병이발생시방광내에는여러형태학적, 생화학적그리고기능적인변화가일어나며이러한변화를알아보고자많은연구들이이루어졌다. 또한최근들어당뇨병으로인하여발생하는방광병변의원인을세포학적인또는분자생물학적인수준에서알아보고자하는노력들이이루어지고있다. Koo 등 3 은 streptozotocin (STZ) 에의해유도된제1 형당뇨쥐에서당뇨병초기의방광내유전자변화를연구하였으며, Steinbacher와 Nadelhaft 4 는제1형당뇨쥐에서방광과배근신경절 (dorsal root ganglion) 에서신경성장인자 (nerve growth factor; NGF) 의변화를관찰하였다. 이와같이현재까지의연구는주로 STZ를투여하는제1형당뇨쥐에대한연구가이루어졌으며또한분자생물학적인연구에서도당뇨병유도후초기변화에대한연구만시행되었다. 그러나실질적으로대다수를차지하고있는제2형당뇨병은증상및그합병증에있어서제1형당뇨병에비하여경한것으로되어있고, 따라서방광내에나타나는기능변화및기전이제1형당뇨병과는다르게나타날수있을것으로생각한다. 이에저자들은 STZ으로유발된제1형당뇨병과는다른자연발생적인제2형당뇨쥐인 Otsuka Long Evans Tokushima Fatty (OLETF) 쥐에서당뇨시기에따른방광의기능적, 형태학적및분자생물학적변화를알아보고자하였다. 재료및방법 1. 실험동물대조군으로는 Long Evans Tokushima Otsuka (LETO, n=14) 쥐, 실험군으로는 OLETF (n=14) 당뇨쥐를사용하였다. L-40군 ( 생후 40주 LETO쥐 ), O-40군 ( 생후 40주 OLETF쥐 ), L-60군 ( 생후 60주 LETO쥐 ) 및 O-60군 ( 생후 60주 OLETF 쥐 ) 으로나누어각각 7마리씩실험에사용하였다. 2. 당뇨쥐의각시기별혈당측정실험군과대조군의쥐를각시기별로꼬리의정맥에서공복시혈액을채취하여혈당치를측정하여당뇨가형성되었음을확인하였다. 3. 방광기능검사정상대조군과실험군에서모두흡입마취후복부를종절개하고 25 G needle을방광내로유치시킨후 6시간의안정기를거쳐 harvard syringe pump를이용하여생리식염수를 0.04 ml/min의속도로방광내로주입하였다. 수축력, 수축간간격등은변환기를통해 Polygraph (Grass 7D, Grass Inst. Co., Quincy, USA) 에기록하였다. 4. 방광근절취및처치각군의실험동물은방광기능검사가끝난후방광및요도를주위조직으로부터박리하여, 방광삼각부직상방에서방광을제거하였다. 방광의무게를측정한후종절개를가하여넓게펴고 1/2은조직절편및신경성장인자 (NGF) 에대한분석을위해 70 o C의액화질소탱크에보관하고, 나머지 1/2은방광근수축력측정을위해 3x10 mm 크기로 2 개의근육절편을만들었다. 5. 방광근수축력측정각군의근육절편을 30 ml의 Tyrode's solution (Nacl mm, KCl 2.6 mm, NaHCO mm, MgCl 2ㆍ 6H 2O 0.5 mm, NaH 2PO 4ㆍ H 2O 0.4 mm, dextrose 5.5 mm and CaCl mm) 이담긴수조에종으로길게매달았다. 수조를 37 o C로유지하고 95% O 2 와 5% CO 2 를통기시키면서 1 g의초기장력을가하여 60분간안정시킨다. 그후 3분간격으로 2, 8, 16, 32 Hz의전기자극 (80 V, 1 msec duration) 을 30초간가하여최대수축력을측정하고, 약물반응에대한검사로서 bethanechol (250μM) 및 ATP (10 mm) 에대한방광근의수축력을측정하며, 자극에대한반응은 force transducer를통해 polygraph (Grass 7D, Grass Inst. Co., Quincy, USA) 에기록하였다. 6. 방광근내신경성장인자 (NGF) 에대해 RT-PCR을이용한 mrna의변화측정 1) Total RNA 분리와 cdna 합성 : 보관된조직에서의 total RNA 분리는 RNeasy minikit (Qiagen Inc., Hilden, Germany) 를이용하여분리하였으며, 자외선흡광기 (Ultrospec 3,000, Pharmacia Biotech Inc., Cambridge, England) 를이용하여 260 nm/280 nm 흡광도의비를구하여 RNA의순도를검정하고전기영동으로 RNA의파괴유무를확인하였다. 분리된총 RNA로부터 cdna 합성은 First Strand cdna Synthesis Kit (Life Technologies Inc., Grand Island, USA) 를이용하였다. 분리된 RNA 1μg과 10x reaction buffer (100 mm Tris, 500 mm KCl, ph 8.3) 2μl, 25 mm MgCl 2 4μl, dntp (10 mm mixture of datp, dctp, dgtp and dttp) 2μl, oligo (dt) 15 primer 2μl, RNase inhibitor 1μl, AMV reverse transcriptase 0.8μl를넣고 DEPC-처리증류수를혼합한 20 μl의용액을 25 o C에서 10분간반응시켰다. 그후 42 o C에서 60분간반응시키고역전사효소의불활성화를위해 99 o C에서 5분간방치시킨후 20 o C에보관하였다. 2) 중합효소연쇄반응 (polymerase chain reaction; PCR):

3 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 389 중합효소연쇄반응에는신경성장인자와 internal control 유전자인 glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 의 sense primer와 antisense primer에대한염기서열은 Table 1과같다. 신경성장인자의경우 PCR tube에 0.5μg의 cdna, 2μl의 10x PCR buffer (15 mm MgCl 2, 100 mm tris-hcl, 500 mm KCl), 0.4μl의 dntp (10 mm mixture of datp, dctp, dgtp and dttp), 20 pm씩의 sense primer와 antisense primer, 0.2μg 의 Taq DNA polymerase (Life Technologies Inc.) 를혼합하고 DEPC-처리증류수를넣은 20μl의용액으로중합효소연쇄반응을시행하였다. 중합효소연쇄반응은 thermal cycler (Gene cyclertm, Bio-Rad Laboratories, Hercules, USA) 를이용하여 94 o C 30초, 58 o C 30초그리고 72 o C에서 45초로 30주기동안반응시키고 4 o C에서반응을정지시켰다. GAPDH의경우 sense primer와 antisense primer를각각 20 pm씩을혼합하고 94 o C 1분, 72 o C 2분으로 30주기동안반응시키고 4 o C 에서반응을정지시켰다. 5μl씩의 PCR 생성물을 100-bp ladder (Bioneer Corporation, 대전, 한국 ) 와함께 1.5% agarose gel에전기영동을시행한다음 ethidium bromide (Sigma, Saint Louis, USA) 로염색하여자외선하에서형광띠를확인하고 Gel-doc (Bio-Rad, USA) 으로촬영하였다. 관찰하고자하는 mrna 발현정도는 densitometer (ImageMaster VDS, Pharmacia Biotech Inc., San Francisco, USA) 를이용하여 GAPDH의발현정도에대한상대치를구하였다. 7. 신경성장인자 (NGF) 에대한면역조직화학염색 액체질소에냉동보관된조직을 4% paraformaladehyde로 4 o C에서 4시간고정하고, 20% sucrose 용액에넣어 4 o C에서 12시간방치한후, Polyethylene glycol인 optimal cutting temperature (OCT) 용액을이용하여포매시켰다. 10μm 조직절편을만들어 slide에부착시킨후 phosphate buffered saline (PBS) 용액 (ph 7.4) 을이용하여 5분씩 3번세척하였 Table 1. Primer sequences used for polymerase chain reaction analysis Primer Sequence 5' 3' Size NGF Sense AAGTTATCCCAGCCAAACTA 294 bp Antisense ATGTCAGTGTTGGGAGTAGG GAPDH Sense TGAAGGTCGGTGTGAACGGATTTGGC Antisense CATGTAGGCCATGAGGTCCACCAC 983 bp NGF: nerve growth factor, GAPDH: glyceraldehyde 3-phosphate dehydrogenase 다. 내인성 peroxidase의활성을저지 (blocking) 하기위하여 3% 과산화수소로처리하고, 비특이적염색반응을없애기위해서 10% normal goat serum solution으로상온에서 1시간동안반응시켰다. 1차항체로 rabbit anti-mouse NGF antiserum (1:1000; Chemicon, Temecula, USA) 을사용하여상온에서 2시간동안반응시킨후 PBS 용액으로 10분씩 3번세척하고, 2차항체로 Alexa Fluor R 568 goat anti-rabbit IgG (1:500; Molecular Probe, Eugene, USA) 를이용하여상온암실에서 1시간동안반응시키고 PBS 용액으로 3분간 3번세척하였다. Anti-fading solution (Vectashield, Vector Laboratories Inc., Burlingame, USA) 으로 mounting하여형광현미경으로관찰하였다. 8. 통계분석방법모든실험성적은평균 ± 표준오차 (mean±sem) 로표시하였고, 통계학적분석은 Student's t-test와분산분석법 (ANOVA) 을이용하여분석하였으며각군간의비교는 Neuman- Keuls multiple comparison test를시행하여 p값이 0.05 미만일때의의있는것으로판정하였다. 결과 1. 공복시혈당수치의변화 L-40, O-40, L-60 및 O-60군의혈당수치는 106±3.4, 265± 14.0, 112.4±3.1 및 312±14.2 mg/dl로 LETO쥐에비하여 OLETF 당뇨쥐에서유의하게높은혈당수치를보였다 (p<0.05) (Fig. 1). 2. 방광기능의변화방광기능검사에서각군의수축간간격은 139.6±5.7, 171.4±7.6, 122.4±6.9 및 412.7±13.3초 (sec) 이고, 각군의방광용적은 106.4±3.4, 265.7±14.0, 112.4±3.1 및 312.7±14.2 ml 이며, 각군의방광유순도 (ΔVolume/ΔPressure) 는 0.178± 0.011, 0.253±0.019, 0.162±0.015 및 0.312±0.023 ml/cmh 2O로 40주, 60주모두대조군에비해실험군에서유의하게증가하였다 (p<0.05). 60주 OLETF 당뇨쥐에서는 40주 OLETF 당뇨쥐에비하여수축간격, 방광용적및유순도가더욱증가하였다 (p<0.05) (Fig. 2). 3. 방광무게의변화 40주 LETO쥐의방광무게는 ±2.80 mg이었으며 40 주 OLETF 당뇨쥐는 ±5.63 mg이었고, 60주 LETO쥐의방광무게는 ±3.14 mg이었으며 60주 OLETF 당뇨쥐는 ±5.37 mg으로, 40주에는대조군과실험군사이

4 390 Korean Journal of Urology vol. 50, , April 2009 Fig. 1. Comparison of blood glucose level in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. Blood glucose levels of the experimental groups were increased compared with the control groups at 40 and 60 weeks, and the O-60 group had a higher level than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 3. Contractile response of the bladder muscle strip to 2, 8, 16, and 32 Hz electrical stimulation in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. Contractile response to electrical stimulation was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The data are expressed as mean± SEM. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 에유의한차이는없었다. 그러나 60주에는대조군에비해실험군에서의미있는증가를보였다 (p<0.05). 4. 방광근수축력의변화 Fig. 2. Comparison of bladder compliance in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The diabetic bladders had increased compliance compared with the control groups at 40 and 60 weeks, and the O-60 group had greater compliance than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 모든수축력은방광조직 100 mg에대한수축력으로교정하여 g tension으로표시하였다. 전기자극에대한방광근의수축력은모든군에서주파수가증가할수록방광근의수축력은점차증가되었고실험군의방광근수축력이대조군에비하여유의하게감소하였으며, 특히고주파로갈수록더욱많이감소하였다 (p<0.05). 60주 OLETF 당뇨쥐의방광근수축력은 40주 OLETF 당뇨쥐에비하여현저하게감소하였다 (p<0.05) (Fig. 3). 각군에서 bethanechol (250μM) 에대한방광근의수축력은 45.9±3.5, 35.9±5.7, 42.9±3.3 및 24.1±2.5로실험군에서대조군에비하여유의하게감소하였으며, 60주 OLETF 당뇨쥐의경우 40주 OLETF 당뇨쥐에비하여더욱많이감소하였다 (p<0.05) (Fig. 4). 각군에서 ATP (10 mm) 에대한방광근의수축력은 15.4±0.9, 11.2±1.7, 13.9±0.7 및 8.2±0.7로실험군에서대조군에비하여유의하게감소하였으며, 60주 OLETF 당뇨쥐의경우 40주 OLETF 당뇨쥐에비하여더욱많이감소하였다 (p<0.05) (Fig. 5).

5 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 391 Fig. 4. Contractile response of bladder muscle strip to bethanechol (250μM) in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The contractile response to bethanecol (250μM) was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 5. Contractile response of the bladder muscle strip to ATP (10 mm) in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The contractile response to ATP (10 mm) was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the L-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 6. (A) Reverse transcript-polymerase chain reaction (RT-PCR) measurement of nerve growth factor (NGF) mrna expression. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for the internal control. M: 100 bp marker; lane 1: GAPDH (983 bp); lane 2: GAPDH+NGF (294 bp); lane 3: L-40 group; lane 4: O-40 group; lane 5: L-60 group; lane 6: O-60 group. (B) Results of densitometric scanning of NGF mrna expression. The mrna expression of NGF was decreased in the O-40 and O-60 groups compared with the control groups. The mrna expression of NGF was lower in the O-60 group than in the O-40 group. The data are expressed as mean±sem. L-40 group: Long Evans Tokushima Otsuka (LETO) rats 40 weeks after birth (n=7), O-40 group: Otsuka Long Evans Tokushima Fatty (OLETF) rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 5. 방광근내 NGF mrna 의발현도 각군의 NGF mrna에대한 RT-PCR을시행하였으며모든군에서 NGF mrna의발현이확인되었다. NGF mrna

6 392 Korean Journal of Urology vol. 50, , April 2009 의 발현은 실험군에서 그 발현이 대조군에 비하여 모두 감 소하였으며 (p 0.05), 60주 OLETF 당뇨쥐에서는 40주 OLETF 고 찰 당뇨쥐에 비하여 더욱 감소하였다 (p 0.05) (Fig. 6). 6. 신경성장인자 (NGF)에 대한 면역조직화학염색 당뇨병은 췌장의 인슐린 분비장애와 인슐린 작용기능의 결함으로 발생하는 대사질환으로써 여러 장기에 영향을 미 각 군의 조직에 대하여 신경성장인자의 분포 및 염색정 쳐 많은 합병증을 초래하게 되며, 그 분류는 크게 제1형 당 도를 관찰하였다. 실험군에서는 대조군에 비하여 방광근 뇨병, 제2형 당뇨병으로 나눌 수 있으며, 그 외에 이차성 당 내 형광반응이 감소되어 있었고, 60주 OLETF 당뇨쥐에서 뇨병과 임신성당뇨병이 있다. 최근 우리나라는 식생활의 는 40주 OLETF 당뇨쥐에 비하여 현저하게 감소되었으나, 서구화로 인해 비만과 함께 제2형 당뇨병이 증가하고 있는 요로상피에서의 신경성장인자의 형광반응은 실험군과 대 추세이다.5 이러한 제2형 당뇨병과 유사한 특성을 가지는 조군 사이에 차이가 없었다 (Fig. 7). 당뇨쥐인 OLETF쥐는 당뇨를 유도하는 여러 가지 열성유전 Fig. 7. Nerve growth factor (NGF) immunohistochemical staining of the bladder. NGF expression was decreased in the O-40 and O-60 groups compared with the control groups. NGF expression of the O-40 group was lower than in the O-60 group. (A) L-40 group (scale bar=25μm), (B) O-40 group (scale bar=25μm), (C) L-60 group (scale bar=25μm), (D) O-60 group (scale bar=25μm). L-40 group: Long Evans Tokushima Otsuka (LETO) rats 40 weeks after birth (n=7), O-40 group: Otsuka Long Evans Tokushima Fatty (OLETF) rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7).

7 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 393 자를가지고있으며, 경도의비만을가지고만성질환의과정을거치게된다. 생후 18주가지나서고혈당이나타나게되고, 췌장의변화가서서히일어나서 40주가지나면췌장의위축이발생하게된다. OLETF쥐의이러한특징은인간의제2형당뇨병과유사하다. 6 당뇨병은여러장기에영향을미칠뿐아니라평활근의기능에도영향을미쳐많은합병증을초래하게되며, 특히비뇨기과적으로는당뇨병에따른방광기능의장애가가장중요한합병증이되고있다. 당뇨병이발병시방광에는형태학적인변화를비롯하여많은기능적인변화와분자생물학적변화가일어나게된다. 7 당뇨병에따른형태학적인변화로써여러구조적인변화가발생하는데 Andersson 등 8 은 STZ로유도된당뇨쥐에서방광내압검사를시행한결과방광의용적이증가되었다고보고하였으며 Longhurst와 Belis 9 는방광무게와용적이당뇨쥐에서증가된다고하였다. 또한평활근비대와함께방광근내에콜라겐 (collagen) 의침착이증가된다고알려져있다. 10 이러한변화들은화학적으로유도된당뇨병초기에서도관찰되어질수있다고하였으며 11 이러한것이방광기능의장애와관련이될수있을것으로보고되었다. 12,13 그러나, 저자들의경우 40주 OLETF 당뇨쥐에서방광의무게와 40주 LETO쥐에서방광의무게사이에약간의증가는있었지만통계학적인의의는없었으나, 60주 LETO와 OLETF쥐사이에서는의의있는증가소견을보였다. 성인쥐에서 STZ 를투여하여유도된당뇨병은췌장의 β 세포를급속히괴사시켜제1형당뇨병을형성시키며일반적으로매우빠른급성변화를일으킴으로써단기간에방광무게와용적을증가시킨다. 그러나제2형당뇨쥐인 OLETF쥐는여러가지열성유전자에의해당뇨병이발생하여, 서서히진행하게되며출생약 18주가지나야고혈당이나타나게되고 40주가되어야췌장의변화가생기기시작한다. 따라서저자들의경우에 STZ로유도된제1형당뇨쥐와는다르게당뇨병발생초기에방광무게의변화가심하지않았던원인은이와같은발생과정의차이에기인한것으로생각한다. 당뇨병이존재할때비뇨기계의여러장기에서도합병증이발생한다. 14,15 방광에도여러가지기능적인문제가발생하게된다. 이러한기능적인문제는자율신경장애에따른것으로알려지고있다. 당뇨가진행함에따라방광의지각신경에손상이발생하면서방광에대한감각의저하가일어나고결과적으로방광의과팽창이발생하게된다. 그후이러한과정이지속적으로반복되면서배뇨근대상부전 (decompensation) 상태로진행하여방광근기능에문제가발생하고, 결국방광근이무력해지면서방광근수축력에장애가발생하게된다. 현재까지이러한당뇨병에따른기능 적인변화에대한많은연구가이루어져왔다. Andersson 등 8 은 STZ로유도된제1형당뇨쥐에서방광기능검사를한결과, 배뇨시작을유도하는요량이증가하고방광의유순도가증가한다고하였다. 그러나 Starer와 Libow 16 는이러한전형적인배뇨장애형태보다불수의적배뇨근수축의중요성을강조하는의견을제시하였다. Kaplan 등 17 도조사대상환자의 55% 에서불수의적배뇨근수축이있었다고보고하였다. 저자들의경우 40주 OLETF 당뇨쥐와 60주 OLETF 당뇨쥐에서각각의대조군에비해방광유순도가모두증가했으며, 60주 OLETF 당뇨쥐는 40주 OLETF 당뇨쥐에비해유순도가더욱증가하였다. 이는당뇨가진행될수록반복적인과팽창과배뇨근의대상부전으로인한방광근수축력의장애가더심해진것으로생각할수있으며일부개체에서발생한불수의적배뇨근수축에대한연구도필요할것으로생각한다. Longhurst와 Belis 9 는 2개월된당뇨쥐에서전기자극, acetylcholine 및 KCL에대한방광체부의배뇨근수축력이모두감소한다고하였다. 반면에 STZ로유도된당뇨쥐에서무스카린작용제를투여했을때그반응성이증가한다는보고도있으나작용기전에대해서는명확히밝혀지지않았다 주 OLETF 당뇨쥐의경우전기자극, bethanechol 및 ATP에대한방광근의수축력이대조군에비해감소하였으나그감소폭이작았으며, 60주 OLETF 당뇨쥐의경우에는전기자극, bethanechol 및 ATP에대한방광근의수축력이의미있게감소하는현상을나타냈다. 따라서방광근의수축력의감소도당뇨가진행될수록더욱더심해진다는것을알수있었으며, 이와같은것을확인하기위해서조직염색을통한방광근의상태및수용체에대한연구가병행되어야할것으로생각한다. 최근당뇨병성방광병증의원인을세포학적인또는분자생물학적인수준에서알아보고자하는노력이이루어지고있다. 또한당뇨병성방광병증은당뇨의흔한합병증인말초신경병증의하나로알려져있으며이러한말초신경병증에 NGF가중요한역할을하는것으로알려져있다. Koo 등 3 은 STZ에의해유도된인슐린의존성당뇨쥐에서 NGF가 4주까지증가한후다시감소하는현상을나타냈다고하였다. 이러한당뇨병에따른초기현상은세포비대, 성장및재형성 (remodeling) 에따른현상이라고보았으며 NGF의증가는당뇨병에서계속적인신경의분포와공급및혈관재생에따른보상작용의결과라고하였다. Steinbacher와 Nadelhaft 4 는제1형당뇨쥐에서방광과배근신경절에서 NGF가증가하였다고하였으며, 실험첫주에 NGF가증가한후천천히감소하는현상을관찰하였다. 이와같이당뇨병에따른방광의기능장애에있어서 NGF의중요성이강조되고있으며최근이에대한연구가많이진행되고있다.

8 394 Korean Journal of Urology vol. 50, , April 2009 NGF는말초교감신경과신경릉에서기원한감각신경계가분포된조직에서생산된다. 생산된 NGF는그조직에분포된신경말단의수용체에의해결합되며, 역행성으로운반되어그기능을나타내게된다. 따라서모든병리적인현상은이러한 NGF 기능결핍이나직, 간접적인역행성축삭운반 (retrograde axonal transport) 의장애에따라나타날수있다. 이와같이당뇨병이존재시여러조직에서의 NGF 단백질및 NGF mrna의감소가보고되었고 여러신경에서의 NGF의감소및 NGF의역행성축삭운반의감소 가일어난다고알려졌다. 반면에 Hellweg와 Hartung 25 은당뇨병을유도한후수주뒤대부분의말초신경지배조직에서최대 % 까지 NGF의양의증가를관찰하였다. 그리고그이유를 NGF에민감한신경의퇴화에의해 NGF의생산증가가일어나거나또는퇴화된신경에의한 NGF 제거감소에따른것이라고보고하였다. 이와같이 NGF 변화에차이가나는것은조직의종류나당뇨발생후그측정시기에따라그양이달라질수있기때문이며, 당뇨병성방광병증의경우방광내 NGF 생산의감소와역행성축삭운반의장애가발생한다고알려져왔다. 26,27 저자들의경우에도 OLETF 당뇨쥐에서방광근내에 NGF mrna의발현감소를보였는데이는 NGF의합성감소, 수용체와결합장애로인한 NGF mrna의발현감소가일어났다고생각되며, 이를확인하기위해서는 NGF와수용체의결합장애와역행성축삭운반장애의문제에대해좀더연구해볼필요성이있다고생각한다. 결론제2형당뇨병을가진 OLETF 당뇨쥐의당뇨병성방광은그시기에따라형태학적, 기능적그리고분자생물학적변화에차이가있다. 당뇨병초기 (40주 OLETF 당뇨쥐 ) 에는정상대조군에비해변화가크지않았지만, 시간이지날수록당뇨가진행되어 60주 OLETF 당뇨쥐에서는정상대조군과큰차이를나타냈다. 따라서당뇨는오랜시간에걸쳐미세혈관및말초신경의장애를일으켜방광의변화를유발시켰으며, 그변화를관찰함으로써시기에따른당뇨병성방광의형태적, 기능적변화와 RT-PCR을이용한 NGF mrna의변화를알수있었다. 이러한실험을통해서자연발생적인제2형당뇨병의시기에따른방광병변을이해하는데많은도움을줄수있을것이며, 추후제2형당뇨병성방광의기초적인실험자료로사용될수있을것이다. REFERENCES 1. Frimodt-Moller C. Diabetic cystopathy: epidemiology and related disorders. Ann Intern Med 1980;92: Yoshimura N, Chancellor MB, Andersson KE, Christ GJ. Recent advances in understanding the biology of diabetes-associated bladder complications and novel therapy. BJU Int 2005;95: Koo HP, Santarosa RP, Buttyan R, Shabsigh R, Olsson CA, Kaplan SA. Early molecular changes associated with streptozotocin-induced diabetic bladder hypertrophy in the rat. Urol Res 1993;21: Steinbacher BC Jr, Nadelhaft I. Increased levels of nerve growth factor in the urinary bladder and hypertrophy of dorsal root ganglion neurons in the diabetic rat. Brain Res 1998;782: Kim NS, Moon OR, Kang JH, Lee SY, Jeong BG, Lee SJ, et al. Increasing prevalence of obesity related disease for Koreans associated with overweight and obesity. Korean J Prev Med 2001;34: Kawano K, Hirashima T, Mori S, Natori T. OLETF (Otsuka Long-Evans Tokushima Fatty) rat: a new NIDDM rat strain. Diabetes Res Clin Pract 1994;24(Suppl):S Kim JC, Seo SI, Park YH, Hwang TG. Changes of detrusor contractility and growth factors in streptozotosin-induced NIDDM rat. Korean J Urol 2000;41: Andersson PO, Malmgren A, Uvelius B. Cystometrical and in vivo evaluation of urinary bladder function in rats with streptozotocin-induced diabetes. J Urol 1988;139: Longhurst PA, Belis JA. Abnormalities of rat bladder contractility in streptozotocin-induced diabetes mellitus. J Pharmacol Exp Ther 1986;238: Eika B, Levin RM, Longhurst PA. Collagen and bladder function in streptozotocin-diabetic rats: effects of insulin and aminoguanidine. J Urol 1992;148: Lincoln J, Crockett M, Haven AJ, Burnstock G. Rat bladder in the early stages of streptozotocin-induced diabetes: adrenergic and cholinergic innervation. Diabetologia 1984;26: Steers WD, Mackway AM, Ciambotti J, de Groat WC. Effects of streptozotocin-induced diabetes on bladder function in the rat. J Urol 1990;143: Longhurst PA, Kauer J, Levin RM. The ability of insulin treatment to reverse or prevent the changes in urinary bladder function caused by streptozotocin-induced diabetes mellitus. Gen Pharmacol 1991;22: Chung YG, Yoo HG, Kwon YH, Park CS, Lim WS, Ryu JK, et al. The significance of periurethral fibrosis and the change of nitric oxide synthase containing nerves in the urethra of diabetic rats. Korean J Urol 2007;48: Kang DI, Kim SH, Lee SD, Kwak HS, Choi SH, Kim DR,

9 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 395 et al. Effects of Alpha-lipoic acid on nitric oxide synthase expression and ultrastructural changes in the bladder of rats with streptozotocin-induced diabetes. Korean J Urol 2007;48: Starer P, Libow L. Cystometric evaluation of bladder dysfunction in elderly diabetic patients. Arch Intern Med 1990;150: Kaplan SA, Te AE, Blaivas JG. Urodynamic findings in patients with diabetic cystopathy. J Urol 1995;153: Kanda M, Eto K, Tanabe N, Sugiyama A, Hashimoto K, Ueno A. Effects of ONO-2235, an aldose reductase inhibitor, on muscarinic receptors and contractile response of the urinary bladder in rats with streptozotocin-induced diabetes. Jpn J Pharmacol 1997;73: Ordonez G, Fernandez A, Perez A, Sotelo J. Low contents of nerve growth factor in serum and submaxillary gland of diabetic mice. A possible etiological element of diabetic neuropathy. J Neurol Sci 1994;121: Fernyhough P, Diemel LT, Brewster WJ, Tomlinson DR. Deficits in sciatic nerve neuropeptide content coincide with a reduction in target tissue nerve growth factor messenger RNA in streptozotocin-diabetic rats: effects of insulin treatment. Neuroscience 1994;62: Fernyhough P, Diemel LT, Brewster WJ, Tomlinson DR. Altered neurotrophin mrna levels in peripheral nerve and skeletal muscle of experimentally diabetic rats. J Neurochem 1995;64: Jakobsen J, Brimijoin S, Skau K, Sidenius P, Wells D. Retrograde axonal transport of transmitter enzymes, fucose-labeled protein, and nerve growth factor in streptozotocin-diabetic rats. Diabetes 1981;30: Schmidt RE, Modert CW, Yip HK, Johnson EM Jr. Retrograde axonal transport of intravenously administered 125 I-nerve growth factor in rats with streptozotocin-induced diabates. Diabetes 1993;32: Hellweg R, Raivich G, Hartung HD, Hock C, Keutzberg GW. Axonal transport of endogenous nerve growth factor (NGF) and NGF receptor in experimental diabetic neuropathy. Exp Neurol 1994;130: Hellweg R, Hartung HD. Endogenous levels of nerve growth factor (NGF) are altered in experimental diabetes mellitus: a possible role for NGF in the pathogenesis of diabetic neuropathy. J Neurosci Res 1990;26: Sasaki K, Yoshimura N, Chancellor MB. Implications of diabetes mellitus in urology. Urol Clin North Am 2003;30: Pittenger G, Vinik A. Nerve growth factor and diabetic neuropathy. Exp Diabesity Res 2003;4:271-85

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

May 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr

May 10~ Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression fr May 10~12 2012 Hotel Inter-Burgo Exco, Daegu Plenary lectures From metabolic syndrome to diabetes Meta-inflammation responsible for the progression from obesity to metabolic syndrome originates in the

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6

01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

Kaes010.hwp

Kaes010.hwp 갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

16_이주용_155~163.hwp

16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

590호(01-11)

590호(01-11) T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

페링야간뇨소책자-내지-16

페링야간뇨소책자-내지-16 야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

DIABETES FACT SHEET IN KOREA 2012 SUMMARY About 3.2 million Korean people (10.1%) aged over 30 years or older had diabetes in 2010. Based on fasting g

DIABETES FACT SHEET IN KOREA 2012 SUMMARY About 3.2 million Korean people (10.1%) aged over 30 years or older had diabetes in 2010. Based on fasting g DIABETES FACT SHEET IN KOREA 2012 Korean Diabetes Association (KDA) / Korea Centers for Disease Control and Prevention (CDC) DIABETES FACT SHEET IN KOREA 2012 SUMMARY About 3.2 million Korean people (10.1%)

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>

<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770> C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

untitled

untitled Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom

More information

A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

(Establishment and Management of Proteomics Core Facility)

(Establishment and Management of Proteomics Core Facility) (Establishment and Management of Proteomics Core Facility) 1 sample running on SDS-PAGE Gel (10well) 163570 10 16357 1D size marker 225500 100 2255 Buffer(20X, 500ml) 119900 20 5995 Staining

More information

main.hwp

main.hwp 열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

077~088 해계 유침과 전침이

077~088 해계 유침과 전침이 loperamide 77 DOI : 10.3831/KPI.2009.12.4.077 loperamide Received : 09. 10. 21 Accepted : 09. 11. 04 The Effect of Acupuncture and Electro-acupuncture at ST41 on Intestinal Hypomotility Induced with Loperamide

More information

( )Kju098.hwp

( )Kju098.hwp 건강한젊은남성과중년남성에서성적자극에의한뇌의활성화비교 Difference of Brain Activation by Visual Erotic Stimuli in Young and Middle-aged Healthy Males Dong Wan Sohn, Kang June Cho, Hyo Sin Kim, Choong Bum Lee, Sung Hak Kang, Yong-Hyun

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )

2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, ) Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :

27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( : 27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( ) :,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Microsoft PowerPoint - 발표자료(KSSiS 2016)

Microsoft PowerPoint - 발표자료(KSSiS 2016) Sang Jun Kim, MD, PhD Application of 3D Printing in the Orthotic Fields Hallux Valgus, Charcot Marie Tooth, ADL Kit, Foot Insole, Wrist Pain, Foot Drop Development of Automated Program for Ankle Foot Orthosis

More information

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: / ,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;

More information

12.077~081(A12_이종국).fm

12.077~081(A12_이종국).fm J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and

More information

슬라이드 1

슬라이드 1 Proposed Korean guideline for the diagnosis of BPH Hyun Woo Kim The Catholic University of Korea BPH Guideline AHCPR guideline on BPH (1994) AUA guideline on BPH (2003) EAU guideline on BPH (2004) International

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

-07-......

-07-...... A Depth Interview on Qualification, Role, and Professionalism of Infant/Toddler Teachers Department of Child & Family Studies, Kyung Hee University Associate Professor : Ahn, Sun Hee Department of Early

More information

[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon

[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon [ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou

제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou 제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuous vs single injection, interscalene vs supraclavicular approach 의정부성모병원

More information

04-07도현수

04-07도현수 대 한 외 상 학 회 지 Vol. 19, No. 2, December, 2006 원 저 임상실습과정 의과대학생을 대상으로 카데바 모델을 이용한 단순 봉합술 교육의 효율성 충남대학교 의과대학 응급의학교실 Abstract 도현수 민진홍 홍승우 한상균 김인수 유@ 승 이진웅 김승환 유인술 Evaluation of the Educational Efficacy of

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: NCS : G * The Analy

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   NCS : G * The Analy Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.133-158 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.133 NCS : G * The Analysis of the Cognitive Level of Basic Job Skills of Specialized

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

untitled

untitled 백서에서난소절제술후여성호르몬투여가방광에미치는영향 The Effects of Estrogen on Detrusor Contraction and the Expression of Muscarinic Receptors in Ovariectomized Rats Ho Young Chung, Jin Seok Chang, Se Hun Kim 1, Ki Hak Song, Young

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

<30322EBABBB9AE2E687770>

<30322EBABBB9AE2E687770> 대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

<31305FC0CCBCD2BFB528C0CCC5C3295FBFF8C0FA2E687770>

<31305FC0CCBCD2BFB528C0CCC5C3295FBFF8C0FA2E687770> 대한배뇨장애요실금학회지 J Korean Continence Soc 29;13:152-8 원저 과민성방광모델로서자연발생고혈압쥐에서비마취하요역동학검사로관찰한항콜린성제제인 tolterodine 의배뇨압력및용적에대한경구및주사효과 인하대학교의과대학비뇨기과학교실, 1 SK 생명과학연구센터 이소영 1 진롱후 권용현 장진혁 강용진 윤상민 이택 The Effect of tolterodine

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

Apparel Purchase Behaviors and Image Preferences of Preteen Girls and Their Mothers: Considering Preteen Girls BMI and Body Image Department of Home Economics Education, Pai Chai University Assistant Professor

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

00약제부봄호c03逞풚

00약제부봄호c03逞풚 경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품

More information

Microsoft Word - KSR2012A038.doc

Microsoft Word - KSR2012A038.doc YWXY º º t rzyywxyhwz_ º zƒ A Study on the Relation of Railroad System and Energy Saving ö ä ø ã ä ãã In Moon, Han-Min Lee *, Jong-Eun Ha * * Abstract Now the world, such as the impact of fossil energy

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information