untitled

Size: px

Start display at page:

Download "untitled"

신혜 추
5 years ago
Views:

1 OLETF 당뇨쥐에서당뇨시기에따른방광의기능적, 형태학적및분자생물학적변화 Functional, Morphologic, and Molecular Biological Changes in the Bladder of OLETF Diabetic Rats according to Duration of Diabetes Mellitus Jun Ha Lee, Hong Jin Suh, Hyuk Jin Cho, Yong Seok Lee, Hyun Woo Kim, Sang Hoon Kim, Sae Woong Kim, Tae Kon Hwang, Sun-Ju Lee 1, Ji Youl Lee From the Department of Urology, The Catholic University of Korea College of Medicine, 1 School of Medicine, Kyung Hee University, Seoul, Korea Purpose: Our study was undertaken to investigate changes in the bladder according to duration of diabetes mellitus in the Otsuka Long Evans Tokushima Fatty (OLETF) rat model, which is similar to type 2 diabetes. Materials and Methods: OLETF rats (n=14) and Long Evans Tokushima Otsuka (LETO, n=14) rats were used. LETO is a normal control of OLETF. The animals were assigned to 4 groups: L-40 group, LETO rats 40 weeks after birth (n=7); O-40 group, OLETF rats 40 weeks after birth (n=7); L-60 group, LETO rats 60 weeks after birth (n=7); and O-60 group, OLETF rats 60 weeks after birth (n=7). At 40 weeks or 60 weeks after birth, blood glucose, cystometry, bladder weight, detrusor contractility, and mrna expression of nerve growth factor (NGF) were assessed. Results: Cystometry showed that diabetic bladders had increased compliance compared with the control groups at 40 and 60 weeks, and the O-60 group had greater compliance than the O-40 group. Contractile responses to electrical stimulation, bethanecol (250μM), and ATP (10 mm) were decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The mrna expression of NGF was decreased in the experimental groups compared with the control groups, and the O-60 group had lower expression than the O-40 group. Changes in NGF were identified through immunohistochemical staining. Conclusions: The degree of diabetic cystopathy in OLETF rats was changed by duration of type 2 diabetes mellitus. Our results showed that the changes in the bladder in type 2 diabetes mellitus can be identified through a new rat model. (Korean J Urol 2009;50: ) Key Words: Type 2 diabetes mellitus, Neurogenic bladder, Nerve growth factor Korean Journal of Urology Vol. 50 No. 4: , April 2009 DOI: /kju 가툴릭대학교, 1 경희대학교의과대학비뇨기과학교실 이준하ㆍ서홍진ㆍ조혁진ㆍ이용석김현우ㆍ김상훈ㆍ김세웅황태곤ㆍ이선주 1 ㆍ이지열 Received:November 21, 2008 Accepted:December 24, 2008 Correspondence to:ji Youl Lee Department of Urology, Seoul St. Mary's Hospital, College of Medicine, The Catholic University of Korea, 505, Banpo-dong, Seocho-gu, Seoul , Korea TEL: FAX: uroljy@catholic.ac.kr C The Korean Urological Association, 2009 서론당뇨병은당뇨병의기간및조절유무에따라다양한합병증을동반하는전신질환으로여러가지합병증중에비뇨기과적으로중요한합병증은당뇨병성방광병증이다. 당 뇨병에의해방광의지각신경및자율신경침범으로유발되는당뇨병성방광병증의유병률은성 (sex) 과나이에관련이없으며, 당뇨병의유병기간과관련이있다. 1 또한당뇨병성방광병증의경우요폐, 잔뇨감, 복압배뇨, 빈뇨, 요실금등다양한배뇨장애를보인다. 당뇨병에따른이러한방광기능의장애에대한기전은아직확실하지는않으나방광 387

2 388 Korean Journal of Urology vol. 50, , April 2009 근의변화, 지각신경및자율신경의변화및요로상피의변화로발생한다고생각되고있다. 2 당뇨병이발생시방광내에는여러형태학적, 생화학적그리고기능적인변화가일어나며이러한변화를알아보고자많은연구들이이루어졌다. 또한최근들어당뇨병으로인하여발생하는방광병변의원인을세포학적인또는분자생물학적인수준에서알아보고자하는노력들이이루어지고있다. Koo 등 3 은 streptozotocin (STZ) 에의해유도된제1 형당뇨쥐에서당뇨병초기의방광내유전자변화를연구하였으며, Steinbacher와 Nadelhaft 4 는제1형당뇨쥐에서방광과배근신경절 (dorsal root ganglion) 에서신경성장인자 (nerve growth factor; NGF) 의변화를관찰하였다. 이와같이현재까지의연구는주로 STZ를투여하는제1형당뇨쥐에대한연구가이루어졌으며또한분자생물학적인연구에서도당뇨병유도후초기변화에대한연구만시행되었다. 그러나실질적으로대다수를차지하고있는제2형당뇨병은증상및그합병증에있어서제1형당뇨병에비하여경한것으로되어있고, 따라서방광내에나타나는기능변화및기전이제1형당뇨병과는다르게나타날수있을것으로생각한다. 이에저자들은 STZ으로유발된제1형당뇨병과는다른자연발생적인제2형당뇨쥐인 Otsuka Long Evans Tokushima Fatty (OLETF) 쥐에서당뇨시기에따른방광의기능적, 형태학적및분자생물학적변화를알아보고자하였다. 재료및방법 1. 실험동물대조군으로는 Long Evans Tokushima Otsuka (LETO, n=14) 쥐, 실험군으로는 OLETF (n=14) 당뇨쥐를사용하였다. L-40군 ( 생후 40주 LETO쥐 ), O-40군 ( 생후 40주 OLETF쥐 ), L-60군 ( 생후 60주 LETO쥐 ) 및 O-60군 ( 생후 60주 OLETF 쥐 ) 으로나누어각각 7마리씩실험에사용하였다. 2. 당뇨쥐의각시기별혈당측정실험군과대조군의쥐를각시기별로꼬리의정맥에서공복시혈액을채취하여혈당치를측정하여당뇨가형성되었음을확인하였다. 3. 방광기능검사정상대조군과실험군에서모두흡입마취후복부를종절개하고 25 G needle을방광내로유치시킨후 6시간의안정기를거쳐 harvard syringe pump를이용하여생리식염수를 0.04 ml/min의속도로방광내로주입하였다. 수축력, 수축간간격등은변환기를통해 Polygraph (Grass 7D, Grass Inst. Co., Quincy, USA) 에기록하였다. 4. 방광근절취및처치각군의실험동물은방광기능검사가끝난후방광및요도를주위조직으로부터박리하여, 방광삼각부직상방에서방광을제거하였다. 방광의무게를측정한후종절개를가하여넓게펴고 1/2은조직절편및신경성장인자 (NGF) 에대한분석을위해 70 o C의액화질소탱크에보관하고, 나머지 1/2은방광근수축력측정을위해 3x10 mm 크기로 2 개의근육절편을만들었다. 5. 방광근수축력측정각군의근육절편을 30 ml의 Tyrode's solution (Nacl mm, KCl 2.6 mm, NaHCO mm, MgCl 2ㆍ 6H 2O 0.5 mm, NaH 2PO 4ㆍ H 2O 0.4 mm, dextrose 5.5 mm and CaCl mm) 이담긴수조에종으로길게매달았다. 수조를 37 o C로유지하고 95% O 2 와 5% CO 2 를통기시키면서 1 g의초기장력을가하여 60분간안정시킨다. 그후 3분간격으로 2, 8, 16, 32 Hz의전기자극 (80 V, 1 msec duration) 을 30초간가하여최대수축력을측정하고, 약물반응에대한검사로서 bethanechol (250μM) 및 ATP (10 mm) 에대한방광근의수축력을측정하며, 자극에대한반응은 force transducer를통해 polygraph (Grass 7D, Grass Inst. Co., Quincy, USA) 에기록하였다. 6. 방광근내신경성장인자 (NGF) 에대해 RT-PCR을이용한 mrna의변화측정 1) Total RNA 분리와 cdna 합성 : 보관된조직에서의 total RNA 분리는 RNeasy minikit (Qiagen Inc., Hilden, Germany) 를이용하여분리하였으며, 자외선흡광기 (Ultrospec 3,000, Pharmacia Biotech Inc., Cambridge, England) 를이용하여 260 nm/280 nm 흡광도의비를구하여 RNA의순도를검정하고전기영동으로 RNA의파괴유무를확인하였다. 분리된총 RNA로부터 cdna 합성은 First Strand cdna Synthesis Kit (Life Technologies Inc., Grand Island, USA) 를이용하였다. 분리된 RNA 1μg과 10x reaction buffer (100 mm Tris, 500 mm KCl, ph 8.3) 2μl, 25 mm MgCl 2 4μl, dntp (10 mm mixture of datp, dctp, dgtp and dttp) 2μl, oligo (dt) 15 primer 2μl, RNase inhibitor 1μl, AMV reverse transcriptase 0.8μl를넣고 DEPC-처리증류수를혼합한 20 μl의용액을 25 o C에서 10분간반응시켰다. 그후 42 o C에서 60분간반응시키고역전사효소의불활성화를위해 99 o C에서 5분간방치시킨후 20 o C에보관하였다. 2) 중합효소연쇄반응 (polymerase chain reaction; PCR):

3 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 389 중합효소연쇄반응에는신경성장인자와 internal control 유전자인 glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 의 sense primer와 antisense primer에대한염기서열은 Table 1과같다. 신경성장인자의경우 PCR tube에 0.5μg의 cdna, 2μl의 10x PCR buffer (15 mm MgCl 2, 100 mm tris-hcl, 500 mm KCl), 0.4μl의 dntp (10 mm mixture of datp, dctp, dgtp and dttp), 20 pm씩의 sense primer와 antisense primer, 0.2μg 의 Taq DNA polymerase (Life Technologies Inc.) 를혼합하고 DEPC-처리증류수를넣은 20μl의용액으로중합효소연쇄반응을시행하였다. 중합효소연쇄반응은 thermal cycler (Gene cyclertm, Bio-Rad Laboratories, Hercules, USA) 를이용하여 94 o C 30초, 58 o C 30초그리고 72 o C에서 45초로 30주기동안반응시키고 4 o C에서반응을정지시켰다. GAPDH의경우 sense primer와 antisense primer를각각 20 pm씩을혼합하고 94 o C 1분, 72 o C 2분으로 30주기동안반응시키고 4 o C 에서반응을정지시켰다. 5μl씩의 PCR 생성물을 100-bp ladder (Bioneer Corporation, 대전, 한국 ) 와함께 1.5% agarose gel에전기영동을시행한다음 ethidium bromide (Sigma, Saint Louis, USA) 로염색하여자외선하에서형광띠를확인하고 Gel-doc (Bio-Rad, USA) 으로촬영하였다. 관찰하고자하는 mrna 발현정도는 densitometer (ImageMaster VDS, Pharmacia Biotech Inc., San Francisco, USA) 를이용하여 GAPDH의발현정도에대한상대치를구하였다. 7. 신경성장인자 (NGF) 에대한면역조직화학염색 액체질소에냉동보관된조직을 4% paraformaladehyde로 4 o C에서 4시간고정하고, 20% sucrose 용액에넣어 4 o C에서 12시간방치한후, Polyethylene glycol인 optimal cutting temperature (OCT) 용액을이용하여포매시켰다. 10μm 조직절편을만들어 slide에부착시킨후 phosphate buffered saline (PBS) 용액 (ph 7.4) 을이용하여 5분씩 3번세척하였 Table 1. Primer sequences used for polymerase chain reaction analysis Primer Sequence 5' 3' Size NGF Sense AAGTTATCCCAGCCAAACTA 294 bp Antisense ATGTCAGTGTTGGGAGTAGG GAPDH Sense TGAAGGTCGGTGTGAACGGATTTGGC Antisense CATGTAGGCCATGAGGTCCACCAC 983 bp NGF: nerve growth factor, GAPDH: glyceraldehyde 3-phosphate dehydrogenase 다. 내인성 peroxidase의활성을저지 (blocking) 하기위하여 3% 과산화수소로처리하고, 비특이적염색반응을없애기위해서 10% normal goat serum solution으로상온에서 1시간동안반응시켰다. 1차항체로 rabbit anti-mouse NGF antiserum (1:1000; Chemicon, Temecula, USA) 을사용하여상온에서 2시간동안반응시킨후 PBS 용액으로 10분씩 3번세척하고, 2차항체로 Alexa Fluor R 568 goat anti-rabbit IgG (1:500; Molecular Probe, Eugene, USA) 를이용하여상온암실에서 1시간동안반응시키고 PBS 용액으로 3분간 3번세척하였다. Anti-fading solution (Vectashield, Vector Laboratories Inc., Burlingame, USA) 으로 mounting하여형광현미경으로관찰하였다. 8. 통계분석방법모든실험성적은평균 ± 표준오차 (mean±sem) 로표시하였고, 통계학적분석은 Student's t-test와분산분석법 (ANOVA) 을이용하여분석하였으며각군간의비교는 Neuman- Keuls multiple comparison test를시행하여 p값이 0.05 미만일때의의있는것으로판정하였다. 결과 1. 공복시혈당수치의변화 L-40, O-40, L-60 및 O-60군의혈당수치는 106±3.4, 265± 14.0, 112.4±3.1 및 312±14.2 mg/dl로 LETO쥐에비하여 OLETF 당뇨쥐에서유의하게높은혈당수치를보였다 (p<0.05) (Fig. 1). 2. 방광기능의변화방광기능검사에서각군의수축간간격은 139.6±5.7, 171.4±7.6, 122.4±6.9 및 412.7±13.3초 (sec) 이고, 각군의방광용적은 106.4±3.4, 265.7±14.0, 112.4±3.1 및 312.7±14.2 ml 이며, 각군의방광유순도 (ΔVolume/ΔPressure) 는 0.178± 0.011, 0.253±0.019, 0.162±0.015 및 0.312±0.023 ml/cmh 2O로 40주, 60주모두대조군에비해실험군에서유의하게증가하였다 (p<0.05). 60주 OLETF 당뇨쥐에서는 40주 OLETF 당뇨쥐에비하여수축간격, 방광용적및유순도가더욱증가하였다 (p<0.05) (Fig. 2). 3. 방광무게의변화 40주 LETO쥐의방광무게는 ±2.80 mg이었으며 40 주 OLETF 당뇨쥐는 ±5.63 mg이었고, 60주 LETO쥐의방광무게는 ±3.14 mg이었으며 60주 OLETF 당뇨쥐는 ±5.37 mg으로, 40주에는대조군과실험군사이

4 390 Korean Journal of Urology vol. 50, , April 2009 Fig. 1. Comparison of blood glucose level in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. Blood glucose levels of the experimental groups were increased compared with the control groups at 40 and 60 weeks, and the O-60 group had a higher level than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 3. Contractile response of the bladder muscle strip to 2, 8, 16, and 32 Hz electrical stimulation in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. Contractile response to electrical stimulation was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The data are expressed as mean± SEM. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 에유의한차이는없었다. 그러나 60주에는대조군에비해실험군에서의미있는증가를보였다 (p<0.05). 4. 방광근수축력의변화 Fig. 2. Comparison of bladder compliance in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The diabetic bladders had increased compliance compared with the control groups at 40 and 60 weeks, and the O-60 group had greater compliance than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 모든수축력은방광조직 100 mg에대한수축력으로교정하여 g tension으로표시하였다. 전기자극에대한방광근의수축력은모든군에서주파수가증가할수록방광근의수축력은점차증가되었고실험군의방광근수축력이대조군에비하여유의하게감소하였으며, 특히고주파로갈수록더욱많이감소하였다 (p<0.05). 60주 OLETF 당뇨쥐의방광근수축력은 40주 OLETF 당뇨쥐에비하여현저하게감소하였다 (p<0.05) (Fig. 3). 각군에서 bethanechol (250μM) 에대한방광근의수축력은 45.9±3.5, 35.9±5.7, 42.9±3.3 및 24.1±2.5로실험군에서대조군에비하여유의하게감소하였으며, 60주 OLETF 당뇨쥐의경우 40주 OLETF 당뇨쥐에비하여더욱많이감소하였다 (p<0.05) (Fig. 4). 각군에서 ATP (10 mm) 에대한방광근의수축력은 15.4±0.9, 11.2±1.7, 13.9±0.7 및 8.2±0.7로실험군에서대조군에비하여유의하게감소하였으며, 60주 OLETF 당뇨쥐의경우 40주 OLETF 당뇨쥐에비하여더욱많이감소하였다 (p<0.05) (Fig. 5).

5 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 391 Fig. 4. Contractile response of bladder muscle strip to bethanechol (250μM) in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The contractile response to bethanecol (250μM) was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the O-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 5. Contractile response of the bladder muscle strip to ATP (10 mm) in Long Evans Tokushima Otsuka (LETO) and Otsuka Long Evans Tokushima Fatty (OLETF) rats. The contractile response to ATP (10 mm) was decreased in the experimental groups compared with the control groups at 40 and 60 weeks, and the O-60 group had a lower contractile response than the L-40 group. The data are expressed as mean±sem. L-40 group: LETO rats 40 weeks after birth (n=7), O-40 group: OLETF rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). Fig. 6. (A) Reverse transcript-polymerase chain reaction (RT-PCR) measurement of nerve growth factor (NGF) mrna expression. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for the internal control. M: 100 bp marker; lane 1: GAPDH (983 bp); lane 2: GAPDH+NGF (294 bp); lane 3: L-40 group; lane 4: O-40 group; lane 5: L-60 group; lane 6: O-60 group. (B) Results of densitometric scanning of NGF mrna expression. The mrna expression of NGF was decreased in the O-40 and O-60 groups compared with the control groups. The mrna expression of NGF was lower in the O-60 group than in the O-40 group. The data are expressed as mean±sem. L-40 group: Long Evans Tokushima Otsuka (LETO) rats 40 weeks after birth (n=7), O-40 group: Otsuka Long Evans Tokushima Fatty (OLETF) rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7). a : significantly different from the control groups (p<0.05), b : significantly different from the O-40 group (p<0.05). 5. 방광근내 NGF mrna 의발현도 각군의 NGF mrna에대한 RT-PCR을시행하였으며모든군에서 NGF mrna의발현이확인되었다. NGF mrna

392 Korean Journal of Urology vol. 50, 387-395, April 2009 의 발현은 실험군에서 그 발현이 대조군에 비하여 모두 감 소하였으며 (p 0.

주 OLETF 당뇨쥐에서는 40주 OLETF 고 찰 당뇨쥐에 비하여 더욱 감소하였다 (p 0.05) (Fig. 6)

관찰하였다. 실험군에서는 대조군에 비하여 방광근 뇨병, 제2형 당뇨병으로 나눌 수 있으며, 그 외에 이차성 당 내 형광반응이 감소되어 있었고, 60주 OLETF 당뇨쥐에서 뇨병과 임신성당뇨병이 있다.

5 이러한 제2형 당뇨병과 유사한 특성을 가지는 조군 사이에 차이가 없었다 (Fig. 7). 당뇨쥐인 OLETF쥐는 당뇨를 유도하는 여러 가지 열성유전 Fig. 7. Nerve growth factor (NGF) immunohistochemical staining of the bladder.

6 392 Korean Journal of Urology vol. 50, , April 2009 의 발현은 실험군에서 그 발현이 대조군에 비하여 모두 감 소하였으며 (p 0.05), 60주 OLETF 당뇨쥐에서는 40주 OLETF 고 찰 당뇨쥐에 비하여 더욱 감소하였다 (p 0.05) (Fig. 6). 6. 신경성장인자 (NGF)에 대한 면역조직화학염색 당뇨병은 췌장의 인슐린 분비장애와 인슐린 작용기능의 결함으로 발생하는 대사질환으로써 여러 장기에 영향을 미 각 군의 조직에 대하여 신경성장인자의 분포 및 염색정 쳐 많은 합병증을 초래하게 되며, 그 분류는 크게 제1형 당 도를 관찰하였다. 실험군에서는 대조군에 비하여 방광근 뇨병, 제2형 당뇨병으로 나눌 수 있으며, 그 외에 이차성 당 내 형광반응이 감소되어 있었고, 60주 OLETF 당뇨쥐에서 뇨병과 임신성당뇨병이 있다. 최근 우리나라는 식생활의 는 40주 OLETF 당뇨쥐에 비하여 현저하게 감소되었으나, 서구화로 인해 비만과 함께 제2형 당뇨병이 증가하고 있는 요로상피에서의 신경성장인자의 형광반응은 실험군과 대 추세이다.5 이러한 제2형 당뇨병과 유사한 특성을 가지는 조군 사이에 차이가 없었다 (Fig. 7). 당뇨쥐인 OLETF쥐는 당뇨를 유도하는 여러 가지 열성유전 Fig. 7. Nerve growth factor (NGF) immunohistochemical staining of the bladder. NGF expression was decreased in the O-40 and O-60 groups compared with the control groups. NGF expression of the O-40 group was lower than in the O-60 group. (A) L-40 group (scale bar=25μm), (B) O-40 group (scale bar=25μm), (C) L-60 group (scale bar=25μm), (D) O-60 group (scale bar=25μm). L-40 group: Long Evans Tokushima Otsuka (LETO) rats 40 weeks after birth (n=7), O-40 group: Otsuka Long Evans Tokushima Fatty (OLETF) rats 40 weeks after birth (n=7), L-60 group: LETO rats 60 weeks after birth (n=7), O-60 group: OLETF rats 60 weeks after birth (n=7).

7 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 393 자를가지고있으며, 경도의비만을가지고만성질환의과정을거치게된다. 생후 18주가지나서고혈당이나타나게되고, 췌장의변화가서서히일어나서 40주가지나면췌장의위축이발생하게된다. OLETF쥐의이러한특징은인간의제2형당뇨병과유사하다. 6 당뇨병은여러장기에영향을미칠뿐아니라평활근의기능에도영향을미쳐많은합병증을초래하게되며, 특히비뇨기과적으로는당뇨병에따른방광기능의장애가가장중요한합병증이되고있다. 당뇨병이발병시방광에는형태학적인변화를비롯하여많은기능적인변화와분자생물학적변화가일어나게된다. 7 당뇨병에따른형태학적인변화로써여러구조적인변화가발생하는데 Andersson 등 8 은 STZ로유도된당뇨쥐에서방광내압검사를시행한결과방광의용적이증가되었다고보고하였으며 Longhurst와 Belis 9 는방광무게와용적이당뇨쥐에서증가된다고하였다. 또한평활근비대와함께방광근내에콜라겐 (collagen) 의침착이증가된다고알려져있다. 10 이러한변화들은화학적으로유도된당뇨병초기에서도관찰되어질수있다고하였으며 11 이러한것이방광기능의장애와관련이될수있을것으로보고되었다. 12,13 그러나, 저자들의경우 40주 OLETF 당뇨쥐에서방광의무게와 40주 LETO쥐에서방광의무게사이에약간의증가는있었지만통계학적인의의는없었으나, 60주 LETO와 OLETF쥐사이에서는의의있는증가소견을보였다. 성인쥐에서 STZ 를투여하여유도된당뇨병은췌장의 β 세포를급속히괴사시켜제1형당뇨병을형성시키며일반적으로매우빠른급성변화를일으킴으로써단기간에방광무게와용적을증가시킨다. 그러나제2형당뇨쥐인 OLETF쥐는여러가지열성유전자에의해당뇨병이발생하여, 서서히진행하게되며출생약 18주가지나야고혈당이나타나게되고 40주가되어야췌장의변화가생기기시작한다. 따라서저자들의경우에 STZ로유도된제1형당뇨쥐와는다르게당뇨병발생초기에방광무게의변화가심하지않았던원인은이와같은발생과정의차이에기인한것으로생각한다. 당뇨병이존재할때비뇨기계의여러장기에서도합병증이발생한다. 14,15 방광에도여러가지기능적인문제가발생하게된다. 이러한기능적인문제는자율신경장애에따른것으로알려지고있다. 당뇨가진행함에따라방광의지각신경에손상이발생하면서방광에대한감각의저하가일어나고결과적으로방광의과팽창이발생하게된다. 그후이러한과정이지속적으로반복되면서배뇨근대상부전 (decompensation) 상태로진행하여방광근기능에문제가발생하고, 결국방광근이무력해지면서방광근수축력에장애가발생하게된다. 현재까지이러한당뇨병에따른기능 적인변화에대한많은연구가이루어져왔다. Andersson 등 8 은 STZ로유도된제1형당뇨쥐에서방광기능검사를한결과, 배뇨시작을유도하는요량이증가하고방광의유순도가증가한다고하였다. 그러나 Starer와 Libow 16 는이러한전형적인배뇨장애형태보다불수의적배뇨근수축의중요성을강조하는의견을제시하였다. Kaplan 등 17 도조사대상환자의 55% 에서불수의적배뇨근수축이있었다고보고하였다. 저자들의경우 40주 OLETF 당뇨쥐와 60주 OLETF 당뇨쥐에서각각의대조군에비해방광유순도가모두증가했으며, 60주 OLETF 당뇨쥐는 40주 OLETF 당뇨쥐에비해유순도가더욱증가하였다. 이는당뇨가진행될수록반복적인과팽창과배뇨근의대상부전으로인한방광근수축력의장애가더심해진것으로생각할수있으며일부개체에서발생한불수의적배뇨근수축에대한연구도필요할것으로생각한다. Longhurst와 Belis 9 는 2개월된당뇨쥐에서전기자극, acetylcholine 및 KCL에대한방광체부의배뇨근수축력이모두감소한다고하였다. 반면에 STZ로유도된당뇨쥐에서무스카린작용제를투여했을때그반응성이증가한다는보고도있으나작용기전에대해서는명확히밝혀지지않았다 주 OLETF 당뇨쥐의경우전기자극, bethanechol 및 ATP에대한방광근의수축력이대조군에비해감소하였으나그감소폭이작았으며, 60주 OLETF 당뇨쥐의경우에는전기자극, bethanechol 및 ATP에대한방광근의수축력이의미있게감소하는현상을나타냈다. 따라서방광근의수축력의감소도당뇨가진행될수록더욱더심해진다는것을알수있었으며, 이와같은것을확인하기위해서조직염색을통한방광근의상태및수용체에대한연구가병행되어야할것으로생각한다. 최근당뇨병성방광병증의원인을세포학적인또는분자생물학적인수준에서알아보고자하는노력이이루어지고있다. 또한당뇨병성방광병증은당뇨의흔한합병증인말초신경병증의하나로알려져있으며이러한말초신경병증에 NGF가중요한역할을하는것으로알려져있다. Koo 등 3 은 STZ에의해유도된인슐린의존성당뇨쥐에서 NGF가 4주까지증가한후다시감소하는현상을나타냈다고하였다. 이러한당뇨병에따른초기현상은세포비대, 성장및재형성 (remodeling) 에따른현상이라고보았으며 NGF의증가는당뇨병에서계속적인신경의분포와공급및혈관재생에따른보상작용의결과라고하였다. Steinbacher와 Nadelhaft 4 는제1형당뇨쥐에서방광과배근신경절에서 NGF가증가하였다고하였으며, 실험첫주에 NGF가증가한후천천히감소하는현상을관찰하였다. 이와같이당뇨병에따른방광의기능장애에있어서 NGF의중요성이강조되고있으며최근이에대한연구가많이진행되고있다.

8 394 Korean Journal of Urology vol. 50, , April 2009 NGF는말초교감신경과신경릉에서기원한감각신경계가분포된조직에서생산된다. 생산된 NGF는그조직에분포된신경말단의수용체에의해결합되며, 역행성으로운반되어그기능을나타내게된다. 따라서모든병리적인현상은이러한 NGF 기능결핍이나직, 간접적인역행성축삭운반 (retrograde axonal transport) 의장애에따라나타날수있다. 이와같이당뇨병이존재시여러조직에서의 NGF 단백질및 NGF mrna의감소가보고되었고 여러신경에서의 NGF의감소및 NGF의역행성축삭운반의감소 가일어난다고알려졌다. 반면에 Hellweg와 Hartung 25 은당뇨병을유도한후수주뒤대부분의말초신경지배조직에서최대 % 까지 NGF의양의증가를관찰하였다. 그리고그이유를 NGF에민감한신경의퇴화에의해 NGF의생산증가가일어나거나또는퇴화된신경에의한 NGF 제거감소에따른것이라고보고하였다. 이와같이 NGF 변화에차이가나는것은조직의종류나당뇨발생후그측정시기에따라그양이달라질수있기때문이며, 당뇨병성방광병증의경우방광내 NGF 생산의감소와역행성축삭운반의장애가발생한다고알려져왔다. 26,27 저자들의경우에도 OLETF 당뇨쥐에서방광근내에 NGF mrna의발현감소를보였는데이는 NGF의합성감소, 수용체와결합장애로인한 NGF mrna의발현감소가일어났다고생각되며, 이를확인하기위해서는 NGF와수용체의결합장애와역행성축삭운반장애의문제에대해좀더연구해볼필요성이있다고생각한다. 결론제2형당뇨병을가진 OLETF 당뇨쥐의당뇨병성방광은그시기에따라형태학적, 기능적그리고분자생물학적변화에차이가있다. 당뇨병초기 (40주 OLETF 당뇨쥐 ) 에는정상대조군에비해변화가크지않았지만, 시간이지날수록당뇨가진행되어 60주 OLETF 당뇨쥐에서는정상대조군과큰차이를나타냈다. 따라서당뇨는오랜시간에걸쳐미세혈관및말초신경의장애를일으켜방광의변화를유발시켰으며, 그변화를관찰함으로써시기에따른당뇨병성방광의형태적, 기능적변화와 RT-PCR을이용한 NGF mrna의변화를알수있었다. 이러한실험을통해서자연발생적인제2형당뇨병의시기에따른방광병변을이해하는데많은도움을줄수있을것이며, 추후제2형당뇨병성방광의기초적인실험자료로사용될수있을것이다. REFERENCES 1. Frimodt-Moller C. Diabetic cystopathy: epidemiology and related disorders. Ann Intern Med 1980;92: Yoshimura N, Chancellor MB, Andersson KE, Christ GJ. Recent advances in understanding the biology of diabetes-associated bladder complications and novel therapy. BJU Int 2005;95: Koo HP, Santarosa RP, Buttyan R, Shabsigh R, Olsson CA, Kaplan SA. Early molecular changes associated with streptozotocin-induced diabetic bladder hypertrophy in the rat. Urol Res 1993;21: Steinbacher BC Jr, Nadelhaft I. Increased levels of nerve growth factor in the urinary bladder and hypertrophy of dorsal root ganglion neurons in the diabetic rat. Brain Res 1998;782: Kim NS, Moon OR, Kang JH, Lee SY, Jeong BG, Lee SJ, et al. Increasing prevalence of obesity related disease for Koreans associated with overweight and obesity. Korean J Prev Med 2001;34: Kawano K, Hirashima T, Mori S, Natori T. OLETF (Otsuka Long-Evans Tokushima Fatty) rat: a new NIDDM rat strain. Diabetes Res Clin Pract 1994;24(Suppl):S Kim JC, Seo SI, Park YH, Hwang TG. Changes of detrusor contractility and growth factors in streptozotosin-induced NIDDM rat. Korean J Urol 2000;41: Andersson PO, Malmgren A, Uvelius B. Cystometrical and in vivo evaluation of urinary bladder function in rats with streptozotocin-induced diabetes. J Urol 1988;139: Longhurst PA, Belis JA. Abnormalities of rat bladder contractility in streptozotocin-induced diabetes mellitus. J Pharmacol Exp Ther 1986;238: Eika B, Levin RM, Longhurst PA. Collagen and bladder function in streptozotocin-diabetic rats: effects of insulin and aminoguanidine. J Urol 1992;148: Lincoln J, Crockett M, Haven AJ, Burnstock G. Rat bladder in the early stages of streptozotocin-induced diabetes: adrenergic and cholinergic innervation. Diabetologia 1984;26: Steers WD, Mackway AM, Ciambotti J, de Groat WC. Effects of streptozotocin-induced diabetes on bladder function in the rat. J Urol 1990;143: Longhurst PA, Kauer J, Levin RM. The ability of insulin treatment to reverse or prevent the changes in urinary bladder function caused by streptozotocin-induced diabetes mellitus. Gen Pharmacol 1991;22: Chung YG, Yoo HG, Kwon YH, Park CS, Lim WS, Ryu JK, et al. The significance of periurethral fibrosis and the change of nitric oxide synthase containing nerves in the urethra of diabetic rats. Korean J Urol 2007;48: Kang DI, Kim SH, Lee SD, Kwak HS, Choi SH, Kim DR,

9 Jun Ha Lee et al:functional and Molecular Changes of Bladder in OLETF Diabetic Rat 395 et al. Effects of Alpha-lipoic acid on nitric oxide synthase expression and ultrastructural changes in the bladder of rats with streptozotocin-induced diabetes. Korean J Urol 2007;48: Starer P, Libow L. Cystometric evaluation of bladder dysfunction in elderly diabetic patients. Arch Intern Med 1990;150: Kaplan SA, Te AE, Blaivas JG. Urodynamic findings in patients with diabetic cystopathy. J Urol 1995;153: Kanda M, Eto K, Tanabe N, Sugiyama A, Hashimoto K, Ueno A. Effects of ONO-2235, an aldose reductase inhibitor, on muscarinic receptors and contractile response of the urinary bladder in rats with streptozotocin-induced diabetes. Jpn J Pharmacol 1997;73: Ordonez G, Fernandez A, Perez A, Sotelo J. Low contents of nerve growth factor in serum and submaxillary gland of diabetic mice. A possible etiological element of diabetic neuropathy. J Neurol Sci 1994;121: Fernyhough P, Diemel LT, Brewster WJ, Tomlinson DR. Deficits in sciatic nerve neuropeptide content coincide with a reduction in target tissue nerve growth factor messenger RNA in streptozotocin-diabetic rats: effects of insulin treatment. Neuroscience 1994;62: Fernyhough P, Diemel LT, Brewster WJ, Tomlinson DR. Altered neurotrophin mrna levels in peripheral nerve and skeletal muscle of experimentally diabetic rats. J Neurochem 1995;64: Jakobsen J, Brimijoin S, Skau K, Sidenius P, Wells D. Retrograde axonal transport of transmitter enzymes, fucose-labeled protein, and nerve growth factor in streptozotocin-diabetic rats. Diabetes 1981;30: Schmidt RE, Modert CW, Yip HK, Johnson EM Jr. Retrograde axonal transport of intravenously administered 125 I-nerve growth factor in rats with streptozotocin-induced diabates. Diabetes 1993;32: Hellweg R, Raivich G, Hartung HD, Hock C, Keutzberg GW. Axonal transport of endogenous nerve growth factor (NGF) and NGF receptor in experimental diabetic neuropathy. Exp Neurol 1994;130: Hellweg R, Hartung HD. Endogenous levels of nerve growth factor (NGF) are altered in experimental diabetes mellitus: a possible role for NGF in the pathogenesis of diabetic neuropathy. J Neurosci Res 1990;26: Sasaki K, Yoshimura N, Chancellor MB. Implications of diabetes mellitus in urology. Urol Clin North Am 2003;30: Pittenger G, Vinik A. Nerve growth factor and diabetic neuropathy. Exp Diabesity Res 2003;4:271-85

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University