헌혈혈액에서 Transfusion-transmitted virus 유전자그룹의 분포 117 이 알려져 있다[17]. 그룹 4에는 9개, 그룹 5에는 4개의 유전자형 이 알려져 있다[14]. 현재에도 TTV의 새로운 유전자형이 계속 발견되고 있다[14, 18]. 국내에서
|
|
- 재순 누
- 7 years ago
- Views:
Transcription
1 대한진단검사의학회지 : 제25권 제2호 2005 Korean J Lab Med 2005; 25: 수혈의학 헌혈혈액에서 Transfusion-transmitted Virus 유전자그룹의 분포 정주영 성희경 1 한태희 1 인제대학교 의과대학 상계백병원 소아과, 진단검사의학과 1 Distribution of Transfusion-transmitted Virus Genomic Groups in Blood Products Ju Young Chung, M.D., Hee Kyung Seong, Ph.D. 1, and Tae Hee Han, M.D. 1 Departments of Pediatrics and Laboratory Medicine 1, Inje University Sanggye Paik Hospital, Seoul, Korea Background : Transfusion-transmitted virus (TTV) is a small DNA virus with single-stranded, closed circular, antisense genome infecting humans. The TTV has been classified into five major genomic groups 1-5. There have been a few studies on TTV prevalence in blood donors and blood products in Korea. However there have been no reports on the TTV genomic groups in Korea. The aim of this study was to gain information on TTV genomic groups in blood products in Korea. Methods : A total of 50 plasma samples from blood products (25 units each of red blood cell and whole blood) were tested. The samples are obtained from the segments of the blood products. TTV DNA was detected using polymerase chain reaction (PCR) with two sets of universal primers (A set and B set), and TTV genomic groups were determined using PCR with group specific primer sets. Results : TTV DNA was detected in 96% (48/50) of the blood products: the TTV genomic group 3 was found the most frequently (52%, 26/50), followed by group 4 (46%, 23/50), group 1 (20%, 10/50), group 5 (10%, 5/20), and group 2 (2%, 1/50). There were seven blood products (14%) infected with TTVs but their genomic groups were not identified with group specific primer sets. Among the blood products, 44% (22/50) were infected with a unique TTV genomic group; 38% (19/50) were coinfected with TTV from 2 (28%, 14/50) or 3 (10%, 5/50) genomic groups. Conclusions : Blood products are frequently infected with TTV and all five known genomic groups are detected in Korea. (Korean J Lab Med 2005; 25: ) Key Words : Transfusion-transmitted virus (TTV), Genomic group, Polymerase chain reaction (PCR), Blood product 서 1997년 Nishizawa 등이 수혈 후 간염이 발생한 환자에서 처음으 로 transfusion transmitted virus (TTV)를 발견하였다[1]. TTV 는 무외피 단일가닥 DNA 바이러스로 Circroviridae에 속하는 것 으로 여겨지고 있으나 아직 명확하게 분류되지 않았다[2-4]. 일부 연구에서 TTV가 건강인에서도 비교적 높은 비율로 검출되어 접 수 : 2004년 10월 21일 접수번호 : KJLM1805 수정본접수 : 2005년 1월 20일 교신저자: 한태희 우 서울시 노원구 상계7동 상계백병원 진단검사의학과 전화: , Fax: kscosby@sanggyepaik.ac.kr 론 TTV와 간질환이 관련이 없다는 의견을 제기하고 있다[5-10]. 국 내의 건강인(혹은 헌혈자)을 대상으로 한 연구에서도 TTV는 높은 감염률을 보였다[11, 12]. 현재 TTV에 대한 많은 연구들이 이루 어져 역학(주로 분자역학), 전파경로 등에 대해 많은 사실들이 밝 혀졌다. 하지만 TTV 배양이 잘되는 적절한 세포가 없어 TTV의 분리가 어렵고 TTV의 생물학적 측면과 병인론 연구에도 제한점 이 있다[13]. TTV는 DNA 바이러스이나 유전적으로 매우 다양 하여 현재 30개 이상의 유전자형이 발견되었으며 크게 다섯 개의 유전자그룹(genomic group 1-5)으로 나뉘어 진다[13-15]. 그룹 1은 6개의 유전자형이 있고 TA278이 대표적인 유전자형이며 그룹 2는 5개의 유전자형이 있고 PMV가 대표적 유전자형이다[16]. 그 룹 3에는 11개의 유전자형이 있고 SANBAN, TUS01, TYM9 등 116
2 헌혈혈액에서 Transfusion-transmitted virus 유전자그룹의 분포 117 이 알려져 있다[17]. 그룹 4에는 9개, 그룹 5에는 4개의 유전자형 이 알려져 있다[14]. 현재에도 TTV의 새로운 유전자형이 계속 발견되고 있다[14, 18]. 국내에서도 헌혈자와 간염환자를 대상으로 TTV의 유전자형에 대한 연구가 이루어지긴 하였으나 TTV 그 룹 1의 일부 유전자형만이 분석되었다[7]. TTV는 유전자 변이가 심하여 유전자의 일부분만을 분석하여 유전자형을 결정하는 방법이 신뢰성이 없다는 연구 보고들이 있다[13, 19, 20]. 하지만 정확한 유전자형 분석을 위해 TTV의 전체 혹은 여러 유전자를 분석하는 것은 많은 시간과 노력이 필요하다. 이런 문제점을 극복하기 위해 최근 Devalle과 Maggi 등이 유전자그룹 특이 시발체를 이용하여 TTV를 우선 유전자그룹으로 나눈 후 유전자형을 확인하는 방법 을 개발하였다[15, 21]. 이에 본 연구에서는 이들이 개발한 TTV 유전자그룹 특이 시발체를 이용하여 혈액제제를 대상으로 TTV 유 전자그룹의 분포를 분석하여 국내에서 TTV 유전자형 연구의 토 대를 마련하고자 하였다. 대상 및 방법 1. 대상 2002년 3월부터 2003년 2월까지 적십자혈액원에서 본원에 공 급된 제조 3일 이내의 전혈, 농축적혈구 각각 25 단위를 무작위로 선발하여 혈액백 분절에서 혈장을 채취하였다. 혈장은 DNA 추출 전까지 -70 에서 냉동 보관하였다. 2. 방법 1) 검체에서 DNA의 추출 혈장 200 L로부터 QIAamp DNA Blood Mini Kit (QIA- GEN GmbH, Hilden, Germany)를 이용하여 DNA를 추출하였 다. 추출된 DNA는 중합효소연쇄반응 검사 전까지 -70 냉동 보 관하였다. 2) TTV 검출을 위한 중합효소연쇄반응 Takahashi 등[22]이 고안한 TTV 검출용 시발체 A (T801, T935)와 시발체 B (T801, T836, T855, T888)를 이용하여 중합 효소연쇄반응을 실시하였다(Table 1). PCR 반응액 구성은 Accu- Power PCR PreMix (Bioneer, Daejeon, Korea)에 DNA와 시 발체 각각 20 pmol씩을 넣어 총량 20 L로 맞추었다. 시발체 A 를 이용한 경우 94 40초 변성반응, 60 40초 결합반응, 72 50초 연장반응을 55회 실시하여 199 bp의 DNA를 증폭하였다. 시발체 B를 이용한 경우 1차로 T801과 T836을 시발체로 1.2 kb 의 DNA를 증폭한 후 증폭산물 2 L를 이용하여 시발체 T855 Table 1. Universal and group-specific primers for TTV amplification Primer name Sequence (5-3 ) Localization Orientation Universal primers A primers T801 ( GCTACGTCACTAACCACGTG 6-25 (TA2785) sense T935 ( CTBCGGTGTGTAAACTCACC (TA2785) antisense B primers T801 (1st) GCTACGTCACTAACCACGTG 6-25 (TA2785) sense T836 (1st) AKGCCTGGGTGTATGCTAGG (TA2785) antisense T855 (2nd) GTCAAGGGGCAATTCGGGCTC (TA2785) sense T888 (2nd) CGTCTGAGTGTGTGGCATAG (TA2785) antisense Group specific primers Group 1 TTV3 (1st) CACACAGAIATTACAGCCCC (AB017610) sense TTV2 (1st) CAGTTAGTGGTGAGCCGAA (AB017610) antisense TTV5 (2nd) ACAGCCCCCAGCATACATCC (AB017610) sense TTV6 (2nd) GTGGTGGCATAGACCGTTAG (AB017610) antisense Group 2 PMV1 (1st) ACAIAGATGTCCCTGGAGTAGA (AF261761) sense PMV2 (1st) AGAGGCACTGATGTTTACTGGC (AF261761) antisense PMV3 (2nd) TGGAGTAGATCGAACGAAGA (AF261761) sense PMV4 (2nd) CTGTAAATAGAGTGGGGG (AF261761) antisense Group 3 SS1 (1st, 2nd) GACCARCTAGACCTGGCCAGATA (AB028669) sense SS2 (1st) GTTTGTGGTGAGCMGAAYGG (AB028669) antisense SS4 (2nd) GTACCASTKGTCTWCAAA (AB028669) antisense Group 4 PY1 (1st) CCATTTTGTRCAGCCCGCCA (AB038624) sense PY2 (1st) ACGGCATGACTTTGTGTYCTG (AB038624) antisense PY3 (2nd) AGCCCGCCAATTTCTGTTC (AB038624) sense PY4 (2nd) GGAGAACAGAGCRRGGGAAT (AB038624) antisense Group 5 T1S (1st) CCGDAGGTGAGUTTACACACCG (TA278) sense T1A (1st) AGGCCYTATGGCGAAGTCTGG (TA278) antisense T2S (2nd) AGTCAAGGGGCAATTCGGGC (CT39F) sense T2G5A (2nd) TCYGCGAACTCKGCCACGGGT (CT39F) antisense Abbreviations: I, inosine; B, G or T or C; K, G or T; M, A or C; S, G or C; W, A or T; Y, C or T.
3 118 정주영 성희경 한태희 와 T888로 710 bp의 DNA를 증폭하였다. 증폭기는 Gene Amp PCR System 9600 (Perkin-Elmer, Branchburg, NJ, USA)을 사용하였고 증폭된 DNA 산물은 2% agarose gel에서 100 V, 30분 동안 전기영동 후 ethidium bromide (0.5 g/ml)로 염색 하여 판독 후 사진 촬영하였다(Fig. 1). 초 연장반응을 35회 실시하였고 2차에서 94 40초 변성반응, 60 40초 결합반응, 72 1분 연장반응을 35회 실시하여 485 bp 의 산물을 증폭하였다(Fig. 2). PCR 반응액의 구성, 사용한 핵 산증폭기, 증폭된 DNA산물의 전기영동 등은 TTV 검출을 위한 중합효소 연쇄반응과 동일하였다. 3) TTV 유전자그룹 1-5 특이 중합효소연쇄반응(TTV genomic group 1-5 specific PCR) 그룹 1-4에 특이적인 중합효소연쇄반응은 Maggi 등[21]이 고 안한 시발체를 그룹 5는 Devalle 등[15]이 고안한 시발체를 사용 하였다(Table 1). 그룹 1-4는 1차로 94 40초 변성반응, 60 40초 결합반응, 72 50초 연장반응을 35회 실시하였고 2차로 동 일한 온도 조건으로 35회 실시하여 그룹 1-4 각각 191 bp, 259 bp, 255 bp, 그리고 273 bp의 산물을 증폭하였다(Fig. 2). 그룹 5는 1차에서 94 40초 변성반응, 60 40초 결합반응, 72 3분 30 4) 통계 통계프로그램은 SPSS for Window 10.0 (SPSS Inc, Chicago, IL, USA)를 사용하였다. Fisher's exact test, chi-square test를 이용하여 TTV 감염과 연령의 상관관계, TTV 유전자그 룹 간의 상관관계, 그리고 성별과 TTV 유전자그룹 간의 상관관 계를 검증하였다. 얼마나 많은 TTV 유전자그룹에 감염되었는지 와 연령 혹은 성별의 상관관계를 검증하기 위해 score test for trend를 사용하였다. P 값이 0.05 미만이면 통계적으로 유의한 것으로 판단하였다. 200 bp 199 bp 700 bp 710 bp A B Fig. 1. TTV polymerase chain reaction with A and B primers. Lane 1, DNA ladder marker; lane 2, positive control; lane 3, negative control; lane 4-5, test samples. Group 1 Group 2 Group bp 259 bp 255 bp Group 4 Group bp 485 bp Fig. 2. TTV genomic group 1-5 specific polymerase chain reactions. Lane 1, DNA ladder marker; lane 2, positive control; lane 3, negative control; lane 4-6, test samples.
4 헌혈혈액에서 Transfusion-transmitted virus 유전자그룹의 분포 119 결 과 1. 혈액제제 헌혈자의 특성 혈액제제의 헌혈자는 남성 35명, 여성 15명이었다. 전체 연령 (median±sd)은 25.0±6.9 (18-52세)이었다 여성의 연령은 24.3±3.9 (20-32세), 남성의 연령은 25.3±7.9 (18-52세)였다. 2. TTV DNA 검출 (5/50)였고 4개 이상의 유전자그룹에 검출된 경우는 없었다(Table 2). 동시에 감염된 경우 그룹 3과 4에 동시에 감염된 혈액제제가 20% (10/50)로 제일 많았다. 감염된 TTV의 유전자그룹과 성별 혹은 나이와 상관관계가 없 었으며 감염된 유전자그룹들 간에 서로 유의한 상관관계가 없었 다. 다만 그룹 1, 3, 4는 여러 개의 유전자그룹에 동시에 감염된 검체에서 보다 통계적으로 유의하게 많이 검출되는 경향을 보였 다(Table 3). 동시에 감염된 그룹의 수와 연령, 성별은 통계적으 로 유의한 관계가 없었다(Table 4). 시발체 A를 사용한 경우 76% (38/50)에서 TTV를 검출하였 고 시발체 B를 이용한 경우 58% (29/50)에서 TTV DNA를 검 출하였다. A혹은 B 시발체에서 하나라도 TTV DNA가 검출된 경우는 88% (44/50)였다. TTV의 5 -UTR을 표적으로 한 universal primer (시발체 A, 시발체 B)를 이용하여 TTV DNA가 검출되지 않았던 경우에서 유전자그룹 특이 시발체를 사용하여 TTV가 검출된 경우가 8% (4/50)로 TTV는 96% (48/50)에 서 검출되었다(Table 2), 3. TTV 유전자그룹(genomic groups) 그룹 1은 20% (10/50), 그룹 2는 2% (1/50), 그룹 3은 52% (26/50), 그룹 4는 46% (23/50), 그룹 5는 10% (5/50) 검출되 었다. Universal primer를 이용하여 DNA가 검출되었으나 5종류 의 유전자그룹 특이 시발체를 모두 사용하여도 증폭산물이 나오 지 않는 경우는 14% (7/50)였다(Table 2). 한 개의 유전자그룹 에 감염된 경우는 44% (22/50), 두 개의 유전자그룹에 감염된 경우는 28% (14/50), 세 개의 유전자그룹에 감염된 경우는 10% Table 2. Single and mixed infections with transfusion transmitted viruses from different genomic groups in blood products Genomic groups Blood products numbers (%) Negative with PCR systems using universal primers (A or B primers) 6 (12.0) Group 2 1 (2.0) Group 4 1 (2.0) Group 3, 4 1 (2.0) Group 3, 5 1 (2.0) None 2 (4.0) Positive with PCR systems using universal primers (A or B primers) 44 (88.0) Group 1 2 (4.0) Group 3 9 (18.0) Group 4 6 (12.0) Group 5 3 (6.0) Group 1, 3 1 (2.0) Group 1, 4 1 (2.0) Group 1, 5 1 (2.0) Group (18.0) Group 1, 3, 4 5 (10.0) None 7 (14.0) 고 TTV 감염은 전 세계적이며 사용한 시발체와 지역에 따라 TTV 감염률에 차이가 있다[7, 8, 13, 23]. TTV 감염은 영아기부터 발생하여 나이에 따라 감염이 증가하여 청소년기에 성인 수준의 감염률에 도달한다[13, 20]. TTV 감염률은 성별차이가 없으며 다회수혈자, 혈우병 환자, 혈액투석환자, 마약중독자 및 HIV감염 환자에서 감염률이 높다[13]. 5 -UTR이 표적인 universal primer 를 이용한 경우 우리나라 0-9세 소아의 27%[24], 헌혈혈액의 84%[12]에서 TTV가 검출되었다. 이번 연구에서 5 -UTR을 표 적으로 두 종류의 시발체를 이용하여 혈액제제의 88%에서 TTV 가 검출되었고 유전자그룹에 특이적인 시발체를 더불어 이용한 경우 혈액제제의 96%에서 TTV가 검출되었다(Table 2). 이번 연구에서 유전자그룹 특이 시발체로 TTV가 검출되나 universal primer (시발체 A, 시발체 B)로 증폭되지 않은 4예(8%)가 있 었다. 이는 Takashi 등[22]이 개발한 시발체 A (T801/935)와 시발체 B (T801, T836, T855, T888)가 모든 TTV를 검출하지 Table 3. Correlation of the numbers of coinfected TTV groups and genomic groups Numbers of coinfected TTV genomic groups Group 1* Group 2 찰 Group 3* Group 4* Group *significant in score test for trend (P<0.05). Table 4. Correlation of the numbers of coinfected TTV groups and sex (or age) Numbers of coinfected TTV genomic groups Female Sex Male Age
5 120 정주영 성희경 한태희 못하기 때문으로 판단된다. Devalle 등은 분리된 TTV 59주(strain) 의 염기서열을 분석하여 T935의 경우 모든 TTV 주와 동일한 염기서열을 보였으나 T801의 경우 염기서열이 일치하지 않은 TTV 주가 있는 것을 발견하여 universal primer로 모든 TTV 가 증폭되지 않을 수 있다고 보고하였다[15]. TTV는 DNA 바이러스지만 유전적 다양성이 높아 유전자형 분류에 어려움을 겪어 왔으나 1999년 Okamoto 등[25]이 그 동안 밝혀진 TTV 염기서열을 계통발생학적으로 분석하여 TTV를 4 개의 그룹으로 분류하였고 2002년 Peng 등[14]이 그룹 5를 추가 하여 TTV 유전자형 분류의 기준으로 제시하였다. TTV 유전자 그룹 각각에는 4-11개의 유전자형이 포함되어 있다. 기존의 TTV 유전자형 확인에 가장 많이 이용되는 N22 혹은 UTR에서 계통 발생학적 분류를 시행할 경우 동일한 유전자그룹 내에서는 다른 유전자형을 잘 구별할 수 있으나 다른 유전자그룹에 속한 유전자 형은 잘 구별되지 않는다는 보고들이 있어[19, 26] TTV 유전자 형을 연구할 때 TTV를 유전자그룹으로 분류하여 분석할 필요가 있다는 의견이 제시되었다[15]. 이 분류체계(5개의 유전자그룹) 를 이용한 연구는 많이 이루어지지 않아 전 세계적으로 TTV 유 전자그룹의 분포 양상에 대한 정보는 아직은 충분하지 못하다[15, 21]. 이번 연구에 사용된 혈액제제에서 TTV 유전자그룹이 그룹 3 (52%), 그룹 4 (46%), 그룹 1 (20%), 그룹 5 (10%), 그룹 2 (2%)의 빈도로 검출되었다. 그룹 2의 감염률은 2%로 다른 지 역의 연구[15, 21]와 마찬가지로 매우 낮은 비율로 검출되었다. 하지만 나머지 그룹의 분포는 타 지역의 연구와 명백한 차이를 보였다. 브라질 헌혈자에서 그룹별 감염 빈도는 그룹 5, 3, 4, 1, 2 (25%, 25%, 8%, 0%)의 순서였고[15], 호흡기질환이 있는 소아를 대상으로 이탈리아에서 이루어진 연구에서는 감염빈도는 그룹 1, 3, 4, 2 (58%, 25%, 13%, 0%)의 순서였다[21]. 일본 과 중국에서는 유전자그룹에 대한 연구가 별로 없으나 소아에서 분리된 TTV를 대상으로 그룹 4와 5에 대해서 연구하여 감염률 이 각각 53%, 15%라고 보고한 연구가 있었다[14]. 이번 연구에서 universal primer로 TTV가 검출되었으나 유전 자그룹 특이시발체로 TTV가 증폭되지 않은 경우가 14% (7/50) 였는데 새로운 유전자그룹이거나 알려진 유전자그룹에 속하는 새 로운 유전자형의 TTV가 존재할 가능성이 있어 추후 연구가 필요 할 것으로 판단하였다. 이탈리아 10% (2/18), 브라질 24% (17/ 72)에서 이런 경우가 있었고[15, 21] 브라질에서는 이들 중 기존 그룹으로 분류되지 않는 TTV가 4예 확인되었다[21]. 연령, 성별, 감염경로에 따라 어떤 TTV 유전자형(혹은 유전 자그룹)의 감염률이 높다는 연구는 아직 충분히 이루어지지는 않 았다[13, 15]. 브라질에서 학동기전 아동, 청소년, 성인의 TTV 다발감염(multiple infection) 비율이 67%, 94%, 92%로 학동기 전 아동과 청소년기에 유의한 차이가 있었으나[20] 헌혈자에서 성별, 연령에 따라 감염된 TTV 유전자그룹의 종류 그리고 수 (number)는 차이가 없었다[15]. 이번 연구에서도 성별 혹은 연 령(20-30대와 40대 이후)에 따라 감염된 TTV 유전자그룹의 종 류 혹은 수의 차이는 발견할 수 없었다. 한 사람이 몇 가지 유전자형(혹은 유전자그룹)의 TTV 바이 러스에 동시에 감염된 사례는 많이 보고 되었다[13, 20, 25, 26]. 동시에 여러 유전자형에 감염되는 경우 어떤 임상적 의의가 있는 지에 대한 연구는 앞으로 이루어져야 하나 건강한 인구집단에서 여러 유전자형에 동시에 감염된 비율이 매우 높아(60-90%) 여 러 유전자형에 감염된 것이 감염자의 건강 혹은 질환과 관련이 없을 것이라는 의견이 제시되었다[13, 20, 26]. 국내에서는 여러 TTV 유전자형에 동시에 감염된 사례에 대한 보고가 없었는데 이번 연구에서 두 개 이상의 TTV 유전자그룹에 감염된 혈액제 제는 38% (19/50)로 밝혀졌다. 여러 유전자그룹에 동시감염된 혈액제제가 많아 TTV의 동시감염이 헌혈자의 건강상태와 관련 이 없을 가능성이 높다고 판단된다. 두 개 이상의 유전자그룹에 감염된 혈액제제에서 감염된 TTV 유전자그룹 간 유의한 상관관 계가 없었는데 이는 한 유전자형에 감염되어도 다른 유전자형에 쉽게 감염이 되는 TTV의 특성[13] 때문에 감염이 무작위로 일 어나는 것으로 판단된다. 두 개 이상의 유전자그룹에 감염된 혈 액제제에서 그룹 1, 3, 4가 많이 검출되었는데 이들 3개 그룹의 빈도가 높기 때문에 발생한 현상으로 여겨진다. 브라질의 경우 헌혈자의 21%가 두 개 이상의 TTV 유전자그룹에 감염되었고 발생빈도가 높은 그룹 5와 그룹 3이 동시에 감염된 사례가 제일 많았다[15]. 이번 연구를 통해 국내 혈액제제의 TTV 감염률이 매우 높은 것을 다시 확인할 수 있었고 다양한 TTV 유전자그룹에 혈액제제 가 감염되어있음을 확인하였다. 혈액제제에 감염된 TTV의 유전 자그룹 분포도 알 수 있었는데 한국에서 혈액제제에 감염된 TTV 유전자그룹의 분포는 타 지역[15, 21]과 차이를 보여 TTV 감염 의 지역별 차이를 확인할 수 있었다. 요 약 배경 : Transfusion-transmitted virus (TTV)는 무외피 단일 가닥 DNA 바이러스로 수혈을 통해 전파될 수 있다. 국내에서 헌 혈자와 혈액제제에서 TTV 감염률이 조사된 적이 있으나 혈액제 제에 감염된 TTV의 유전자 그룹(1-5)에 대한 연구가 이루어지 지 않아 저자들은 그 분포를 조사하고자 하였다. 방법 : 전혈, 농축적혈구 각각 25단위의 혈액백 분절에서 혈장 을 채취하여 DNA를 추출한 후 TTV에 대한 두 종류의 시발체 (A, B)와 유전자그룹 1-5 특이 시발체를 이용하여 중합효소연쇄 반응을 시행하여 유전자그룹을 분석하였다. 결과 : 모든 시발체를 이용하여 혈액제제의 96% (48/50)에서 TTV가 검출되었다. 혈액제제에 감염된 TTV의 유전자그룹은 그룹 3 (52%), 그룹 4 (46%), 그룹 1 (20%), 그룹 5 (10%), 그룹 2 (2%)였다. 혈액제제의 14% (7/50)에서 TTV가 시발체 A 혹은 B 검출되었으나 유전자그룹 특이 시발체로는 증폭되지
6 헌혈혈액에서 Transfusion-transmitted virus 유전자그룹의 분포 121 않았다. 한 개의 유전자그룹에 감염된 경우는 44% (22/50), 두 개의 유전자그룹에 감염된 경우는 28% (14/50), 세 개의 유전자 그룹에 감염된 경우는 10% (5/50)이고 네 개 이상의 유전자그 룹에 감염된 경우는 없었다. 결론 : 국내에서는 대부분의 혈액제제에서 TTV가 검출되었으 며 그룹 1에서 그룹 5까지의 모든 유전자그룹이 검출되었다. 감사의 글 본 연구에 많은 도움을 준 인제대학교 상계백병원 중앙연구실 에 감사드립니다. 참고문헌 1. Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, Miyakawa Y, Mayumi M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun 1997; 241: Hino S. TTV, a new human virus with single stranded circular DNA genome. Rev Med Virol 2002; 12: Mushahwar IK, Erker JC, Muerhoff AS, Leary TP, Simons JN, Birkenmeyer LG, et al. Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proc Natl Acad Sci USA 1999; 96: Takahashi K, Hijikata M, Samokhvalov EI, Mishiro S. Full or near full length nucleotide sequences of TT virus variants (Types SAN- BAN and YONBAN) and the TT virus-like mini virus. Intervirology 2000; 43: Abe K, Inami T, Asano K, Miyoshi C, Masaki N, Hayashi S, et al. TT virus infection is widespread in the general populations from different geographic regions. J Clin Microbiol 1999; 37: Huang LY, Oystein Jonassen T, Hungnes O, Grinde B. High prevalence of TT virus-related DNA (90%) and diverse viral genotypes in Norwegian blood donors. J Med Virol 2001; 64: Nakano T, Park YM, Mizokami M, Choi JY, Orito E, Ohno T, et al. TT virus infection among blood donors and patients with non-b, non-c liver diseases in Korea. J Hepatol 1999; 30: Jeon MJ, Shin JH, Suh SP, Lim YC, Ryang DW. TT virus and hepatitis G virus infections in Korean blood donors and patients with chronic liver disease. World J Gastroenterol 2003; 9: Niel C, de Oliveira JM, Ross RS, Gomes SA, Roggendorf M, Viazov S. High prevalence of TT virus infection in Brazilian blood donors. J Med Virol 1999; 57: Kato T, Mizokami M, Orito E, Nakano T, Tanaka Y, Ueda R, et al. High prevalance of TT virus infection in Japanese patients with liver diseases and in blood donors. J Hepatol 1999; 31: Park SH, Byun KS, Song JW, Yeon JE, Park CK, Lee CH. Transfusion-transmitted virus infection in Korean patients with acute and chronic liver disease of unknown etiology and healthy control: Influence of PCR primers on the detection of Transfusion-transmitted virus. Korean J Gastroenterol 2003; 41: (박상훈, 변관수, 송진원, 연종은, 박충기, 이창홍. 한국인원인미상의급, 만성간질환환자와건강대 조군에서 Transfusion-transmitted Virus 감염률-PCR 시발체에따른 검출율의차이. 대한소화기학회지 2003; 41: ) 12. Chung JY, Han TH, Seong HK, Paik IK, Kim MJ. Transfusion-transmitted virus and TTV-like mini virus infection in blood products. Korean J Lab Med 2004; 24: (정주영, 한태희, 성희경, 백인기, 김 문정. 헌혈혈액에서 Transfusion-transmitted virus (TTV)와 TTV-like mini virus (TLMV)의감염. 대한진단검사의학회지 2004; 24: 71-7.) 13. Bendinelli M, Pistello M, Maggi F, Fornai C, Freer G, Vatteroni ML. Molecular properties, biology, and clinical implications of TT virus, a recently identified widespread infectious agent of humans. Clin Microbiol Rev 2001; 14: Peng YH, Nishizawa T, Takahashi M, Ishikawa T, Yoshikawa A, Okamoto H. Analysis of the entire genomes of thirteen TT virus variants classifiable into the fourth and fifth genetic groups, isolated from viremic infants. Arch Virol 2002; 147: Devalle S and Niel C. Distribution of TT virus genomic groups 1-5 in Brazilian blood donors, HBV carriers, and HIV-1-infected patients. J Med Virol 2004; 72: Hallett RL, Clewley JP, Bobet F, McKiernan PJ, Teo CG. Characterization of a highly divergent TT virus genome. J Gen Virol 2000; 81: Okamoto H, Nishizawa T, Ukita M, Takahashi M, Fukuda M, Iizuka H, et al. The entire nucleotide sequence of a TT virus isolate from the United States (TUS01): comparison with reported isolates and phylogenetic analysis. Virology 1999; 259: Liu Z, Luo K, Zheng R, Hu J, He H. Novel TTV variants isolated in an epidemic of hepatitis of unknown etiology. J Med Virol 2002; 67: Lemey P, Salemi M, Bassit L, Vandamme AM. Phylogenetic classification of TT virus groups based on the N22 region is unreliable. Virus Res 2002; 85: Saback FL, Gomes SA, Niel C. High frequency of mixed TT virus infections in healthy adults and children detected by a simplified heteroduplex mobility assay. J Virol Methods 2002; 101: Maggi F, Pifferi M, Fornai C, Andreoli E, Tempestini E, Vatteroni M, et al. TT virus in the nasal secretions of children with acute respiratory diseases: relations to viremia and disease severity. J Virol 2003; 77:
7 122 정주영 성희경 한태희 22. Takahashi K, Hoshino H, Ohta Y, Yoshida N, Mishiro S. Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers. Hepaol Res 1998; 12: Itoh K, Takahashi M, Ukita M, Nishizawa T, Okamoto H. Influence of primers on the detection of TT virus DNA by polymerase chain reaction. J Infect Dis 1999; 180: Chung JY, Han TH, Hwang ES. The prevalence of transfusion-transmitted virus infection in children. Korean J Pediatr 2004; 47: (정주영, 한태희, 황응수. 소아의 Transfusion-transmitted virus 감염유 병률. 소아과 2004: 47: ) 25. Okamoto H, Takahashi M, Nishizawa T, Ukita M, Fukuda M, Tsuda F, et al. Marked genomic heterogeneity and frequent mixed infection of TT virus demonstrated by PCR with primers from coding and noncoding regions. Virology 1999; 259: Niel C, Saback FL, Lampe E. Coinfection with multiple TT virus strains belonging to different genotypes is a common event in healthy Brazilian adults. J Clin Microbiol 2000; 38:
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information<30322EC6AFC1FD30342DC1A4B9AEC7F62E687770>
대한내과학회지: 제 77 권 제 2 호 2009 특 집(Special Review) - 신종 감염병의 최신 지견 뎅기열 인하대학교 의학전문대학원 내과학교실 감염내과 정 문 현 Dengue fever Moon-Hyun Chung, M.D. Division of Infectious Diseases, Department of Internal Medicine, College
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More information<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )
. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationKISEP Head and Neck Korean J Otolaryngol 2001;44: 만성편도염에서의 Epstein-Barr Virus 의검출률과유전자형분포 최영철 1 이숙경 2 권용순 2 강진한 3 박용수 1 전은주 1 Detection Rates of
KISEP Head and Neck Korean J Otolaryngol 2001;44:1171-6 만성편도염에서의 Epstein-Barr Virus 의검출률과유전자형분포 최영철 1 이숙경 2 권용순 2 강진한 3 박용수 1 전은주 1 Detection Rates of Epstein-Barr Virus from the Chronic Tonsillitis and
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information歯제7권1호(최종편집).PDF
********* (*, **, *** ).., 2002, 7, 1, 1-12. 2-5 80.,.,..,,... :,,. (naming).., (word finding), (lexical look- up), (lexical retrieval), (word recall) (Fried- Oken, 1987). (pause),,, (naming error) (Snyder
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information°Ç°�°úÁúº´6-13È£ÀÛ¾÷
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 13 www.cdc.go.kr 2013 3 29 6 13 ISSN: 2005-811X 10-years of Hepatitis B Perinatal Transmission Prevention
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information590호(01-11)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 7 10 13 28 29 30 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine Government
More information<BFCFBCBA30362DC0B1BFECC3B62E687770>
韓 國 保 健 看 護 學 會 誌 Journal of Korean Public Health Nursing Volume 26. No. 2, 248-257, August 2012 http://dx.doi.org/10.5932/jkphn.2012.26.2.248 중심단어 : 남자대학생, 성의식, 성태도 남자대학생의 성의식과 성태도 * 김 상 희 ** 윤 우 철 ***
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information歯채민병.PDF
Patient number Sex Age Animal contact 1 F 36 No 2 F 31 Cat scratch Result of biopsy/aspiration cytology of lymph nodes Chronic granulomatous inflammation with caseation necrosis, compatible with tuberculous
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information<B8F1C2F72E687770>
제1장 제17장 성홍열 및 사슬알균 감염증 사슬알균 (Streptococci)은 증식 중의 특징적으로 쌍 또는 사슬모양의 그람양성 알균 으로 catalase 음성, 통성혐기성균이며, 보통 한천배지에서는 발육이 어렵고 혈액이나 혈청 등을 첨가한 배지에서 잘 발육한다. 포도당이나 다른 탄수화물을 분해하나 포도당 을 분해하여 가스를 생성하지 않는다. 이들은 최소
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More informationProblem New Case RETRIEVE Learned Case Retrieved Cases New Case RETAIN Tested/ Repaired Case Case-Base REVISE Solved Case REUSE Aamodt, A. and Plaza, E. (1994). Case-based reasoning; Foundational
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information1
- MEDIC (MEDical Intelligent wheelchair ) MedicalIntelligent, Wheelchair MEDIC. MEDIC LG Global Challenger 2003 - 1. 3 2. 4 2.1 4 (1) 4 (2) 5 2.2 6 (1) 6 (2) 6 (3) 7 3. 8 3.1 8 3.2 10 3.3 11 4. 12 4.1
More information<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>
C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More information<303220BAAFB1A4BCAE2E687770>
한국민족문화 33, 2009. 3, 39~73쪽 임진왜란 직후 기장지역의 상황과 被 虜 人 沙 器 匠 1)변 광 석* 1. 머리말 2. 16세기 전후 기장현의 상황 3. 기장의 陶 瓷 와 沙 器 匠 4. 被 虜 人 사기장과 기장지역 1) 경상도 일원 주민의 납치 2) 주요 피로인 사기장들의 출신지역 문제 3) 回 答 兼 刷 還 使 의 피로인 송환시도와 현지의
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information03권동희(17-26)ok
Geographical Analysis of National Monument Topography* Kwon, Dong-Hi 1) Abstract : As of January 2010, 59 topography have been designated as national monuments. From the geographical point of view, these
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information@12호-end2
PUBLIC HEALTH WEEKLY REPORT, KCDC www.cdc.go.kr/phwr Revised national tuberculosis control programme in Korea Figure 1. Trend of new tuberculosis case notification rate 1) Case notification rate= Total
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More information7 1 ( 12 ) 1998 ( ) ( ) ( ) ( ) ( ). ( ) ( ). ( ) ( ) ( ). ( ). ( ) ( ) ( ) 3).., 16 ( ) ( ) ( ) ( ) ( ) ( ) ( ). 4). ( ) ( ) ( ),., 4-5, 6-7, 5) 6) (
7 1 ( 12 ) : 75-96, 1998 K orean J M ed H ist 7 : 75-96, 1998 ISSN 1225-505X (2)* ** *** ** 1. (4) 2. (5) (1) (6) (2) (7) (3) 5. 3. (1) ( ) 4. ( ) (2) (1) (3) (2). ( ) (3) 6. 4. ( ) 6 1). ( ), ( ).. (1)
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
More information±è¹ÎÁö
531 김민지 외: 미숙아에 발생한 의인성 식도천공과 기종격증 및 종격동염 A B C D E F Fig. 1. Chest radiographs and CT scans of a premature infant. Chest radiograph at 6 days after birth (A) shows left paravertebral radiolucency at the
More information한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More information대한간학회 한국인 간질환백서 2부 한국인의 간질환 각론 1장 / B형간염 2장 / C형간염 3장 / A형간염 4장 / 알코올 간질환 5장 / 비알코올 지방간질환 6장 / 간암 7장 / 간이식 01 B형간염 B형간염바이러스 감염의 국내 현황 B형간염의 자연경과 및 질병 부담 B형간염의 진단 및 선별검사 국내 B형간염 관리 및 치료의 현주소 개선과제 및 해결전략
More informationMinimally invasive parathyroidectomy
2013. 2. 2 대한간암연구학회 7차 심포지움 및 학술대회 Indication and Clinical Outcomes of Metachronous HCC Metastasectomy Shin Hwang Division of Liver Transplantation and Hepatobiliary Surgery, Department of Surgery, Asan
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<30352EB0A3BAB4B8AE2E687770>
The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and
More information뉴스지14호-칼라
2 3 4 5 6 TaKaRa Taq TM / TaKaRa Ex Taq TM / TaKaRa LA Taq TM / Pyrobest TM DNA Polymerase/ TaKaRa Z -Taq TM TaKaRa Taq TM TaKaRa Ex Taq TM TaKaRa LA Taq TM TaKaRa Z-Taq TM Pyrobest TM DNA Polymerase 7
More information- 서울지역 소아의 일본뇌염항체 보유상황에 관한 연구- 한국 주둔 미군환자의 부검 뇌조직에서 처음으로 일 본뇌염 바이러스가 분리되었다 2). 1949년 우리나라에 처음으로 대유행이 있어 5,616 명의 환자중 2,779명이 사망한 이후 매년 여름마다 이 질병이 유행되어
소아과 :제 39권 제 2호 1996 1) 서울지역 소아의 일본뇌염항체 보유상황에 관한 연구 울산의대 서울중앙병원 소아과 김진아 고태성 박영서 문형남 홍창의 국립보건원 신경성 바이러스과 조 해 월 목 적 :일본뇌염은 최근에는 발생율이 현저히 감소하였으나,저연령군에서는 발현율도 높으 며 치명적인 질환이다.이에 저자들은 서울지역 소아에서의 일본뇌염
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information- 최원희ㆍ 김명희: 중년후기 여성의 집단회상 경험과 효과에 대한 연구 - 에 직면하며 심리 사회적인 역할갈등, 고립, 위축, 상실 감 등을 경험하게 된다. 이 시기동안 위기에 잘 대처하 지 못하면 자신에 대하여 실망하며 두려움과 슬픔 등 을 겪으면서 자아존중감이 낮아
한국모자보건학회지 제15권 제1 호(2011년 1 월) J Korean Soc Matern Child Health 2011;15(1):48-59 E 1) 중년후기 여성의 집단회상 경험과 효과에 대한 연구 최 원 희ㆍ김 명 희 1 경남대학교 간호학과, 부산대학교 간호대학 1 = Abstract = The Experience and Effects of Group
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information