Kor. J. Aesthet. Cosmetol., B로서알려져있으며피부세포간질 (ECM) 성분들중 gelatin 과 collagen type IV와 V를분해한다고알려져있다 ( 소승호등, 2008; Fisher et al., 1996). 이들 MMPs의발현은자외선에의하여
|
|
- 경철 장
- 6 years ago
- Views:
Transcription
1 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Hesperidin 의 Ultraviolet B 에의한광노화억제효과 이현진건국대학교일반대학원생물공학과 Inhibitory Effects of Hesperidin on the Ultraviolet B-Induced Photo-Aging Hyunjin Lee Department of Bioengineering, Graduate School of Konkuk University Abstract Hesperidin is a flavanone glycoside found abundantly in citrus fruits. In vitro and in laboratory research, hesperidin has anti-inflammatory and anti-oxidant effects, reduced cholesterol and blood pressure. In this study, to investigate UVB- induced anti-oxidant and anti-aging effects of hesperidin, we measured ROS scavenging assay, matrix metalloproteinases (MMP) -1, 3, type 1 collagen (col1a1) gene expression in human dermal fibroblasts (HDFs) and NF-κB transcription activity in NIH 3T3 stable cell. Hesperidin at concentration of below 100 μm did not affect cell viability and in ROS scavenging activity, hesperidin had anti-oxidant activity in a dose-dependent manner. Futhermore hesperidin suppressed NF-κB transcription activity. To determine MMP-1, 3 and type 1 collagen gene expression is regulated by hesperidin, we performed Quantitative RTPCR (qrt-pcr) in HDFs. Levels of gene expression of MMP-1 and 3 were significantly decreased and col1a1 expression increased by hesperidin-dependently. From the above results, it is referred that hesperidin appears to have potent UVB-induced anti-oxidant and anti-anging activity. These finding suggest that hesperidin is useful ingredient for anti-aging effects of skin Keywords: Hesperidin, Anti-oxidant, Anti-aging, MMP, Collagen 의학의발전과사회, 경제, 문화의발달로인간의평균수명을 100 세그이상을바라보는현시대에성별과나이를불문하고 더젊고건강하게살아갈수있는방법에대한관심이급증하고 있다. 이러한사회적트렌드에맞춰미용산업역시항노화에 대해이슈화되고있고항노화화장품에대한소비자의관심뿐 만아니라국내외화장품산업에도영향을미치고있다 ( 박종숙, 2012). 피부노화는크게내인성노화와외인성노화로나누어지며, 내인성노화는시간의흐름에따라자연스럽게신체기능이저 하되는나타나는현상으로호르몬, 가족력, 유전자인자등을 Corresponding author: Hyunjin Lee, Department of Bioengineering, Graduate School of Konkuk University, 1 Hwayang-dong, Gwangjingu, Seoul , Republic of Korea suphia77@hanmail.net Received August 1, 2015; Revised October 10, 2015; Accepted October 19, 2015; Published October 30, 2015 포함하고, 외인성노화는햇빛에의한피부노화현상을가장주요요인으로간주하고흡연, 음주, 스트레스등의요인도포함하고있다 (Farage et al., 2008; 강태진, 2011). 피부노화를일으키는요인중일상생활에서가장노출이심한자외선은피부세포내신호전달체계에영향은미쳐 DNA 손상과유전자발현을변화시켜세포노화및세포사멸을일으킨다. 자외선이피부세포에지속적으로노출될경우, 진피층의섬유아세포에서는활성산소가증가하고사이토카인 (cytokine) transforming growth factor-beta (TGF-β) 와전사인자 activator protein 1 (AP-1) 의발현이활성화된다 (Lee et al., 2012; Saito et al., 2004; Varani et al., 2002). TGF-β는콜라겐의합성을촉진하는사이토카인으로서자외선에의해 TGF-β의발현이감소하여콜라겐합성이저해되고, AP-1은 matrix metalloproteinases (MMPs) 의조절하여콜라겐의분해를촉진하는전사인자로서자외선노출시세포내 AP-1의활성이증가하여콜라겐분해가촉진되어진다 (Yolanda et al., 2008). MMP 중 collagenase 1으로알려져있는 MMP-1은 type I 과 III collagen을기질로하며, MMP-2, 9는 gelatinase A, 631
2 Kor. J. Aesthet. Cosmetol., B로서알려져있으며피부세포간질 (ECM) 성분들중 gelatin 과 collagen type IV와 V를분해한다고알려져있다 ( 소승호등, 2008; Fisher et al., 1996). 이들 MMPs의발현은자외선에의하여발현이촉진되는데이들의발현을저해할경우피부주름이완화되는것으로일반적으로알려져있다 ( 이상명등, 2013). 또한자외선은세포내대표적인전사인자 NF-κB를활성화시켜 interleukin-1 (IL-1), tumor necrosis factoralpha (TNF-α) 와 collegn I의분해를촉진하는 collagenase MMP1 등다양한유전자의발현을유도하는데, 특히 NF-κB 로인한 MMP1의발현증가는콜라겐을분해를증가시켜자외선에의한피부노화를촉진시키는대표적인요인으로보고되고있다 (Oh et al., 2004; Wenk et al., 2004). Hesperidin은플라보노이드 (flavonoid) 에속하는플라본 (flavone) 배당체로서 hesperitin에 rutinose가결합된형태이며, 감귤류껍질속에많이함유한것으로알려져있다. 또한 hesperidin은 Rutin과함께 bioflavonoid 라고도불리는 vitamin P군에속하며항산화 (Hirata et al., 2005), 혈압 (Ohtsuki et al., 2003), 콜레스테롤 (Monforte et al., 1995), 항염증 (Emim et al., 1994; Galati et al., 1994) 에도탁월한효과가있는것으로보고되어지고있다. 따라서본연구는 UVB로인한피부세포의노화를억제함에있어 hesperidin의효능을입증하고, 향후 hesperidin의항노화화장품의소재로서의가치를연구하고자한다. 다. 배양된 well에 EZ-Cytox cell viability assay kit reagent 10 μl 첨가하여 1 h 배양후microplate reader (Bio-Rad, USA) 를이용하여 490 nm에서흡광도측정하였으며, 3회반복수행하여세포생존율평균값을도출하였다. 3. 세포내 ROS 변화량측정 HDFs를접종하여 24 h 배양후 hesperidin과 H 2 O 2 처리하여 2 h을배양하였다. Dichlorofluorescein diacetate (DCF- DA) 를 10 μm 첨가하여 30 min 배양후세포를수확하여 Flow cytometry (Becton Dickinson, USA) 를이용하여 ROS의변화량을측정하였다. 4. NF-κB luciferase assay NF-κB reporter NIH-3T3 stable cell 을 60 mm culture dish에 개의농도로접종하여 24 h 배양후 hesperidin 을적절한농도로각각처리하고 24 h을배양하였다. 배양된세포를수확하여 Passive lysis buffer (Promega, USA) 를첨가하고 ice에서 10 min간방치하여용해한다음 4 조건에서 12,000 rpm으로 30 min간원심분리하여상등액을회수하였다. Bradford assay로정량화된시료군을각각 80 μg 씩 black 96-well plate에넣은후 luciferin (Promega) 을첨가후 Luminometer (Veritas, USA) 를이용하여 luciferin의발광정도를측정하였다. 1. 세포배양본연구는진피층에분포하는 human dermal fibroblasts (HDFs) (Lonza, USA) 와 NF-κB 전사활성변화를확인하기위해 promoter에 luciferase 유전자가삽입된 NF-κB reporter NIH-3T3 stable cell line (Cell Biolabs, USA) 를사용하였다. HDFs와 NIH-3T3는 10% feta bovine serum (FBS) 과 1% penicillin/streptomycin이첨가된 DMEM 배지 (Welgene, korea) 를사용하여, 37, 5% CO 2 조건에서배양하였다. Hesperidin (Sigma, USA) 는 DMSO에 200 mm의농도로녹여사용하였고, UVB는 UV-B lamp (UVP, USA) 를이용하여 100 mj/cm 2 의강도로조사하였다. 2. 세포생존율측정세포생존율은 EZ-Cytox cell viability assay kit ( 주 ) 이츠바이오, Korea) 를이용하였으며, HDFs를 96-well plate에 cells/well 의농도로 100 μl씩접종하여 24 h 배양후 hesperidin과 UVB를적정농도처리하고 24 h 동안배양하였 5. mrna 추출및 cdna 합성 Hesperidin과 UVB가조사된세포눈 Trizol reagent (Invitrogen, USA) 를이용하여 mrna를추출하였으며, 추출된 mrna는 Nanodrop (Nanodrop, USA) 을이용하여순도를측정하여 260 nm/280 nm의 ratio 1.8 이상의 mrna만을실험에사용하였다. cdna는 1 μg의 RNA를대상으로 M-MLV reverse transcriptase (Enzynomics, Korea) 을이용하여합성하였다. 6. Quantitative real-time PCR (qrt-pcr) UV와 Hesperidin에의해 HDF 내에서일어나는 MMP1, MMP3, Col1A1 유전자변화를정량하기위하여 SYBR green (Invitrogen, USA) 을이용하였으며, Linegene K (BioER, Table 1. Lists of primers used in this study Gene Forward primer Reverse primer -actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG Col1A1 AGGGCCAAGACGAAGACATC AGATCACGTCATCGCACAACA MMP1 TCTGACGTTGATCCCAGAGAGCAG CAGGGTGACACCAGTGACTGCAC MMP3 ATTCCATGGAGCCAGGCTTTC CATTTGGGTCAAACTCCAACTGTG 632
3 Hesperidin 이 UVB 에의한광노화억제효과 Figure 1. Cytotoxicity of hesperidin on HDFs. Figure 2. The effect of hesperidin on cell viability in UVBinduces HDFs. China) 를사용하여 PCR을진행하였다. PCR 결과는각결과별 melting curve로검증하였고, 각유전자의발현은 β-actin의발현을표준화하여비교분석하였다. 실험에사용된유전자의 primer는 Table 1과같다. 1. 세포생존율저해억제효과 Hesperidin을농도별로 HDFs에처리하여세포독성을확인한결과 50 μm까지는생존율에영향을미치지않았으며, 100 μm에생존율이 87%, 200 μm에서는 77% 로생존율이감소하여 200 μm에서는세포독성이있는것으로판단하여이후실험에서는 hesperidin의농도를 100 μm로제한하였다 (Figure 1). HDFs에 hesperidin 20, 50, 100 μm의농도로전처리후 UVB 조사하여세포생존율을변화를확인하였다. HDFs는 UVB 100 mj/cm 2 을조사하였을때 68% 로생존율이감소하였으나 hesperidin 20 μm 전처리시 86%, 50 μm 전처리시 96%, 100 μm 전처리시 98% 로농도의존적으로세포생존율이증가하는것으로확인하였다 (Figure 2). 이러한결과는 UVB로인한세포사멸을 hesperidin이보호하여세포사멸을억제하는데도움을주는것으로판단된다. 2. ROS 억제효과자외선으로인한세포내 ROS의증가는교원섬유의합성을저해하고 MMP 합성을촉진하여교원섬유의분해를증가시켜노화를촉진시킨다 (Yolanda et al., 2008). 항산화작용에우수한효과가있다고보고되어진 (Patricia et al., 2003) hesperidis의자외선에의해세포내발생하는 ROS의억제효능을확인한결과 HDFs에 UVB 100 mj/cm 2 강도로조사하였을때 UVB를조사하지않았을때보다 ROS가 3배증가하였으나, hesperidin을 20, 50, 100 μm 처리시 ROS Figure 3. The effect of hesperidin on ROS scavenging in UVBinduced HDFs. 는 2.5, 1.7, 1.4 배로 hesperidin 의농도의존적으로억제하 였다. Hesperidin 100 μm 처리하였을때 ROS 억제효과는 NAC (ROS scavenger) 처리했을때와비슷한수치로감소시켜 hesperidin 이활성산소제거에탁월한효과가있다는것을확 인하였다 (Figure 3). 3. NF-κB 전사활성억제효과 자외선에의해세포내 ROS 가증가하면 NF-κB 의전사를활 성화시키고이는 collagnase 의발현을촉진시켜피부주름을 형성하는데기인한다 (Masamitsu et al., 2009). 자외선에의해 활성화된 NF-κB 를억제하기위한 hesperidin 의효능을검증 한결과 UVB 100 mj/cm 2 강도로조사하였을때 luciferin 의 발광이 3.3 배증가하여 UVB 조사시 NF-κB 의전사가활성되 는것을알수있었다. 그러나 hesperidin 을 20, 50, 100 μm 으 로처리하여측정한결과 luciferin 의발광정도는 UVB 를조사 하였을때보다 2.7, 1.9, 1.3 배로감소하여 hesperidin 의농도 633
4 Kor. J. Aesthet. Cosmetol., Figure 4. Inhibition of NF-κB activity by hesperidin in UVBinduced NIH 3T3. 가증가할수록 NF-κB의전사활성은감소하는것으로확인할수있었다. Hesperidin 100 μm을처리했을때는 UVB를조사하지않았을때와유사한수치로나타나 hesperidin이자외선으로부터 NF-κB 활성화되어노화를일으키는과정을억제하는것에효과가있는것으로판단된다 (Figure 4). 4. Hesperidin에의한 MMP1, MMP3, Col1A1 유전자발현변화노화를일으키는요인중외적인요인, 즉광노화에의해주름이형성될때 collagenase의발현을증가하고 collagen의합성을저해되어내인성노화와는달리더깊은주름을야기시킨다 ( 한영숙외, 2011). 자외선에의해생성되는주름형성을억제하기위해서는 collagen의합성을촉진시키고 collagenase 의합성을억제하여야한다. Hesperidin의이러한효과를확인한결과 UVB 100 mj/cm 2 강도로조사하였을때 MMP1의 mrna 발현양은 2.7로 UVB를조사하지않았을때보다 2배이상증가하는것으로나타났으나 hesperidin을 20, 50, 100 μ M으로처리하였을때 MMP1의 mrna 발현양은 2.2, 1.5, 1.2 로감소하였다 (Figure 5A). MMP3의 mrna 발현은 UVB 100 mj/cm 2 강도로조사하였을때 2.4, hesperidin을 20, 50, 100 μm으로처리하였을때는 2.1, 1.5, 1.1로 MMP1의 mrna 발현양과비슷한결과를보였다 (Figure 5B). 자외선을받으면 collagen 합성이저해되는데 hesperidin이 collagen 합성에영향을미치는지확인한결과 UVB 100 mj/cm 2 강도로조사하였을때 col1a1의 mran 발현은 0.61로 UVB를조사하지않은대조군에비해 40% 가량감소하였다. 그러나 hesperidin 을 20, 50, 100 μm으로처리하였을때 col1a1 mrna 발현양은 0.7, 0.8, 0.9로 UVB를조사하지않은대조군과유사한수치로증가하는것을확인할수있었다 (Figure 5C). 이러한결과는 hesperidin이자외선으로부터활성화된 collagenase의발현은억제하고비활성화되는 collagen의발현은활성화시킴으로 Figure 5. Quantification of mrna expression levels by qrt- PCR. (A) MMP-1, (B) MMP-3, (C) col1a1; *p<.05 자외선으로인한주름형성을지연시키는데도움을주는것으로 사료된다. 햇볕에지속적으로노출될경우자외선이피부에흡수되 634
5 Hesperidin 이 UVB 에의한광노화억제효과 어 ROS가발생되고이는산화적스트레스로인해세포막, 지질, 미토콘드리아, 그리고 DNA를손상시킨다 (Yolanda et al., 2008). 자외선에의한피부세포내 ROS 증가는 MAP kinase pathway에 cytokine의발현을조절하여콜라겐을분해하는 MMPs의발현은촉진하고 (Fisher et al., 1996), 콜라겐합성을촉진시키는유전자들의발현은감소되어콜라겐합성이저해된다 (Quan et al., 2002). 또한자외선은 NF-κB의활성이촉진시켜 MMPs의발현이증가되어콜라겐분해를야기시키는것으로보고되고있다 (Berneburg et al., 2000). 본연구는항산화와항염증으로탁월한효능이있는플라보노이드 hesperidin이자외선에의해피부세포에일으킬수있는노화의과정, 즉, 세포내 ROS, NF-κB, MMPs, collagen 의변화에영향을미치는지확인하였다. 결과는 hesperidin은 UVB에의해사멸되는 HDFs를 protection하여생존율을높여주었고, UVB를조사하였을때 HDFs 내에증가하는 ROS를 hesperidin이농도의존적으로감소시켰다. MMPs의발현을촉진시키는 NF-κB 발현또한 hesperidin 이저해시키는것을확인하였다. UVB에의해 MMPs 발현은증가되고, collagen 의합성은저해되어주름을야기하는데 hesperidin은세포내 MMP1, 3의 mrna 발현을감소시키고, col1a1의 mrna 발현을증가시키는것으로확인하였다. 본연구의결론은 hesperidin이 UVB으로인한피부세포의 ROS 증가를억제함으로서산화적손상을극복할수있고, 동시에 hesperidin이 UVB에의한 NF-κB의활성억제, MMPs 발현저해, collagen 합성이촉진함으로서광노화로부터피부세포를보호할수있는효과가있음을검증하였다. 이는항노화화장품의원료로써도충분한가치가있음을시사하고앞으로원료로서화장품에사용되어질방법을연구할필요성이있다고사료된다. 강태진. 피부노화의원인. BioWave, 박종숙. 국내외항노화스킨케어시장동향. 한국보건산업진흥원, 소승호, 이성계, 황의일, 구본석, 한경호, 정진호, 이민정, 김나미. 홍삼생약복합물 (KTNG0345) 의피부주름개선에관한작용기전. J. Ginseng. Res., 32: 39-47, 이상명, 임영호, 김석창, 최재환, 김진희. 홍삼에함유된프로토파낙사트리올계전환사포닌의피부주름개선효과. Kor. J. Aesthet. Cosmetol., 11: , 한영숙, 최태부, 이연희, 김춘자, 김주연, 장미혜. 피부학 3판, Berneburg M, Plettenberg H, Krutmann J. Photoaging of human skin. Photodermatol. Photoimmunol. Photomed., 16: , Emim JA, Oliveira AB, Lapa AJ. Pharmacological evaluation of the anti-inflammatory activity of a citrus bioflavonoid, hesperidin, and the isoflavonoids, duartin and claussequinone, in rats and mice. J. Pharm. Pharmacol., 46: , Farage MA, Miller KW, Elsner P, Maibach HI. Intrinsic and extrinsic factors in skin ageing: a review. Int. J. Cosmetic Sci., 30: 87 95, Fisher GJ, Datta SC, Talwar HS, Wang ZQ, Varani J, Kang S et al,. Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature, 379: , 1996 Galati EM, Monforte MT, Kirjavainen S, Forestieri AM, Trovato A, Tripodo MM. Biological effects of hesperidin, a citrus flavonoid. (Note I): antiinflammatory and analgesic activity". Farmaco, 40: , Hirata A, Murakami Y, Shoji M, Kadoma Y, Fujisawa S. Kinetics of radical-scavenging activity of hesperetin and hesperidin and their inhibitory activity on COX-2 expression. Anticancer Res., 25: , Lee YR, Noh EM, Han JH, Kim JM, Hwang JK, Hwang BM, Chung EY, Kim BS, Lee SH, Lee SJ. Brazilin inhibits UVB-induced MMP-1/3 expressions and secretions by suppressing the NF-κB pathway in human dermal fibroblasts. Eur. J. Pharmacol., 674: 80-86, Masamitsu I, Hideya A, Masaki Y, Yoko N, Mary M. Photoaging of the skin. Anti-Aging Med., 6: 46-59, Monforte MT, Trovato A, Kirjavainen S, Forestieri AM, Galati EM, Lo Curto RB. Biological effects of hesperidin, a Citrus flavonoid. (note II): hypolipidemic activity on experimental hypercholesterolemia in rat. Farmaco, 50: , Ohtsuki K, Abe A, Mitsuzumi H, et al,. Glucosyl hesperidin improves serum cholesterol composition and inhibits hypertrophy in vasculature. J. Nutr. Sci. Vitaminol., 49: , Oh JH, Chung AS, Steinbrenner H, Sies H, Brenneisen,. P. Thioredoxin secreted upon ultraviolet A irradiation 635
6 Kor. J. Aesthet. Cosmetol., modulates activities of matrix metalloproteinase-2 and tissue inhibitor of metalloproteinase-2 in human dermal fibroblasts. Arch. Biochem. Biophys., 423: , Patricia KW, Dalla SS, Mirian S. Antioxidant Activity of the Flavonoid Hesperidin in Chemical and Biological Systems. J. Agric. Food Chem., 53: , Quan TH, Kang S, Voorhees JJ, Fisher GJ. Ultraviolet irradiation alters transforming growth factor beta/ smad pathway in human skin in vivo. J. Invest. Dermatol., 119: Saito Y, Shiga A, Yoshida Y, Furuhashi T, Fugita Y, Niki E. Effects of novel gaseous antioxidative system containing a rosemary extract on the oxidation induced by nitrogen dioxide and ultraviolet radiation. Biosci. Biotechnol. Biochem., 68: , Varani J, Perone P, Fligiel SE, Fisher GJ, Voorhees JJ. Inhibition of type 1 procollagen production in photodamage: correlation between presence of high molecular weight collagen fragments and reduced procollagen synthesis. J. Invest. Dermatol., 119: , Wenk J, Schüller J, Hinrichs C, Syrovets T, Azoitei N, Podda M, Wlaschek M, Brenneisen P, Schneider LA, Sabiwalsky A, et al. Overexpression of phospholipidhydroperoxide glutathione peroxidase in human dermal fibroblasts abrogates UVA irradiationinduced expression of interstitial collagenase/ matrix metalloproteinase-1 by suppression of phosphatidylcholine hydroperoxidemediated NFkappaB activation and interleukin-6 release. J. Biol. Chem., 279: , Yolanda RH, Dana LS, John JV. Overview of Skin Aging and Photoaging. Dermatol. Nurs., 20: 177,
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationRESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 13 No. 6, , December 2015 Sericine 과 Alpha-Mangostin 의주름개선상승효과 김기쁨 1, 조아령 1, 차화준 2, 신상훈 2, 이정
RESEARCH ARTICLE Sericine 과 Alpha-Mangostin 의주름개선상승효과 김기쁨 1, 조아령 1, 차화준 2, 신상훈 2, 이정주 2, 이현경 2, 안인숙 1 * 1 한국피부임상과학연구소, 2 건국대학교생물공학과 Synergetic Effects of Sericin and Alpha-Mangostin on Anti-wrinkle Effects
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationKor. J. Aesthet. Cosmetol., 름이생성되고피부면역세포인랑게르한스세포와진피의교원섬유가감소한다는공통점이있으나 ( 한정선, 2013; Chiba et al., 1999), 자연노화에서는피부가얇아지는반면, 외인성노화의대부분을차지하는광노화의경우에는탄력섬유의변
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 알리인 (Alliin) 의인간진피섬유아세포보호효과및 Collagen 발현증가, MMP1 발현억제효과에관한연구 전소현, 이동희 건국대학교일반대학원생물공학과 Effects of Alliin on Cellular Protection, Up-regulation of Collagen and
More information(14) hwp
Journal of Life Science 2010 Vol. 20. No. 12. 1838~1843 ISSN : 1225-9918 DOI : 10.5352/JLS.2010.20.12.1838 Anti-Wrinkle Effects of Korean Rice Wine Cake on Human Fibroblast Jung-Min Yoo, Yeo-Jin Kang,
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information11권3호 인쇄book.indb
REVIEW Kor. J. Aesthet. Cosmetol., 자외선 차단제의 사용실태와 천연소재 개발에 관한 고찰 임은화 1, 황지영 2, 김현정 3 * 1 경복대학교 의료미용과, 2 정화예술대학 미용예술학부, 3 건국대학교 일반대학원 생물공학과 향장생물학전공 Study on the Current Use of Sunscreen and the Development
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationAging Tissue Bank κ κ κ κ (9 월호에계속...) 2
소식지 주소 : 부산광역시금정구장전동산30번지부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.agingbank.or.kr http://aging.pharm.pusan.ac.kr/ Content 6 월호 알기쉬운노화의기초지식
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information<BCF6C1A42DB3EBC8ADC1B6C1F7C0BAC7E0BCD2BDC4C1F62033BFF92E687770>
소식지 주소 : 부산광역시금정구장전동산 30 번지부산대학교약학대학약학연구동 435 호 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.agingbank.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More informationRESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 12 No. 6, , December 2014 인간진피섬유아세포에서 Nobiletin 이 Mitogen-Activated Protein Kinases 를통한 Matri
RESEARCH ARTICLE 인간진피섬유아세포에서 Nobiletin 이 Mitogen-Activated Protein Kinases 를통한 Matrix-Metalloprotease 1 발현조절에미치는영향 차화준 1, 김영주 2 * 1 건국대학교한국피부임상과학연구소, 2 오산대학교뷰티디자인계열 Mitogen-Activated Protein Kinases Mediated
More information394 김윤선 김유미 이상화 skin barrier. We found that ZE decreased the UVB-induced IL-6 and IL-8 in NHEK cells. In human study, ZE protected skin against UV-B i
1) pissn 1226-2587 J. Soc. Cosmet. Sci. Korea eissn 2288-9507 Vol. 42, No. 4, December 2016, 393-401 http://dx.doi.org/10.15230/scsk.2016.42.4.393 초피나무열매추출물의 COP1 및 PPAR-α 조절을통한자외선에대한피부보호효과 김윤선 김유미 이상화
More informationProduct Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot
EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : http://knrrb.knrrc.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More informationDBPIA-NURIMEDIA
백작약 열수추출물의 피부노화 억제 효과 (II) -주름형성 억제 효과를 중심으로- 권미화, 최소영 1, 김영철 1, J. ENVIRON. TOXICOL. Vol. 24, No. 2, 169~178 (2009) 국립독성과학원 독성병리과, 1 계명대학교 대학원 공중보건학과 Inhibitory Effects of Peonia japonica Water Extract
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationJNH 곽충실(K16-60).fm
Journal of Nutrition and Health (J Nutr Health) 2016; 49(6): 429 ~ 436 http://dx.doi.org/10.4163/jnh.2016.49.6.429 pissn 2288-3886 / eissn 2288-3959 Research Article 두릅순에탄올추출물의인간유래피부각질형성세포와피부섬유아세포에서의자외선에의한광노화억제효과
More information<33372DC7D7B3EBC8ADC8ADC0E5C7B02E687770>
논문접수일 : 2013.09.24 심사일 : 2013.10.06 게재확정일 : 2013.10.25 항노화화장품의 국내현황과 항노화관심도에 따른 자외선차단제소비성향조사 Status and anti-aging cosmetics Interest in accordance with anti-aging sunscreen Consumption Survey 주저자 : 김미영
More informationSheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:21~34 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/19, Published: 2016/12/30 [ABSTRACT] With the development of the Internet,
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information<38BFF93238C0CF28B1DDBFE4C0CF2920BFB9BBF3B9E8B4E72E786C7378>
[부산 ] 2009년 08월 28일 ( 金 ) 1경주 국 5(마령)1000M 발주 13:00 종합 인기도 출전 착순 출주 10 11 5 검은요정 국5 한2 암 김재섭 영준 53 3착 선행 5 5 5 15 1 6 3 0.3 주 10 랜드레이디 국5 한2 암 강형곤 현명 53 3착 선행 10 5 6.3 10 10 4 8 4 2 4 주 11 일맥상통 국5 한3 암
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More informationuntitled
Journal of Korean Medicine Rehabilitation Vol. 23 No. 3, July 2013 pissn 1229-1854 eissn 2288-4114 Original Article 봉독약침이 흰쥐의 국소뇌혈류량 및 평균혈압에 미치는 영향 민선정 염승룡 권영달 원광대학교 한의과대학 한방재활의학과교실 Effects of Bee Venom
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information노인의학200303.PDF
2 1. 2. 1) 2) 3) 3. 4. 1) 2) 3) Microcell 4) 5) 5. 6. 1.. (organism).,...?,??.,. 1935 McCay 27 . 1960 Hayflick. 10 (cytogerontology)... 2. 1),,,,.,,,.. (lipofuscin) (fluidity),., (microvilli)..,, (heat
More informationPowerPoint 프레젠테이션
Apr. 30. 2016. GBCC in JeJu Island Sensitization of breast cancer cells to chemotherapeutic drugs by metabolic regulation InChul Park, Ph. D. Korea Institute of Radiological & Medical Sciences (KIRAMS)
More information< C8B2C0E7BCBA2DB9DFC8BF20B5B7C5C2B9DDB0FA20B1D720C1D6BFE420B4D9C0CCC6E9C5B8C0CCB5E52E485750>
Journal of the Korea Academia-Industrial cooperation Society Vol. 19, No. 3 pp. 229-242, 2018 https://doi.org/10.5762/kais.2018.19.3.229 ISSN 1975-4701 / eissn 2288-4688 발효돈태반과그주요다이펩타이드섭취가 UVB 조사에의한무모생쥐의피부주름생성에미치는효과
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information박성민.fm
Korean Society for Biotechnology and Bioengineering Journal 28(2): 106-114 (2013) http://dx.doi.org/10.7841/ksbbj.2013.28.2.106 연구논문 콜라겐합성과 MMP-1 발현에대한생물전환지실추출물의효과 이계원 a, 박성민 1,a, 유영춘 2, 조영호 * Effect of
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationRESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 13 No. 1, 59-64, February 2015 과산화수소 (H 2 O 2 ) 에의해유도된인간각질형성세포주손상에대한키네틴 (Kinetin) 의항산화효과 김수연 1, 김민정
RESEARCH ARTICLE 과산화수소 (H 2 O 2 ) 에의해유도된인간각질형성세포주손상에대한키네틴 (Kinetin) 의항산화효과 김수연 1, 김민정 2, 안규중 2, 안인숙 3, 안성관 3 * 1 두원공과대학교뷰티아트과, 2 건국대학교의학전문대학원피부과학교실, 3 건국대학교한국피부임상과학연구소 Antioxidant Effects of Kinetin on
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information본초학표지
大韓本草學會誌제 29 권제 2 호 (2014 년 3 월 ) Kor. J. Herbology 2014;29(2):39-45 ISSN 1229-1765(Print), ISSN 2288-7199(Online) http://dx.doi.org/10.6116/kjh.2014.29.2.39. 한약재복합추출물의인간피부섬유아세포 HS68 에대한항노화효과 신동철 1#, 김귀철
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information슬라이드 1
Anti-aging Peptide Anti-wrinkle peptide Whitening peptide Anti-hair loss & hair growing peptide BF-Dynorphin Elastin essential peptide Cyclitol Anagen BF-Enkephalin Elastin anti-wrinkle peptide ElaX-MV
More information( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
More information노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : http://knrrb.knrrc.or.kr/ http://aging.pharm.pusan.ac.kr/ Content
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information11권 5호 내지.indd
RESEARCH ARTICLE 딸기식물체추출물의미백및주름개선효과 오봉윤 1, 이유석 1, 남승희 1, 이선경 1, 권승빈 2, 안인숙 2, 나해영 3, 정경주 1, 강정화 1 * 1 전남농업기술원식품경영연구소, 2 한국피부임상연구소, 3 목포대학교원예학과 Effects of Strawberry Plant Body Extracts on Whitening and
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More information02신현화
Yonsei Business Review Vol. 47, No. 1 (Fall 2010), 151-179 David vs. Goliath: M&A of HaiTai Confectionery and Foods Co. by Crown Confectionery Co. Hyun-Han Shin** 2004 10 Korea Confectionary Holdings NV
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationRESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., Vol. 13 No. 2, , April 2015 스피루리나추출물의항염증및항노화, 멜라닌합성억제효과 장혜진, 최은영 * 건국대학교일반대학원생물공학과 Effects of Spir
RESEARCH ARTICLE 장혜진, 최은영 * 건국대학교일반대학원생물공학과 Effects of Spirulina Platensis Extract, the Act of which are Antiinflammation, Anti-aging, As well as Suppressing Melanin Synthesis Hye-Jin Jang, Eun-Young Choi*
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationDBPIA-NURIMEDIA
Journal of Life Science 2010 Vol. 20. No. 2. 275~280 cjls / ISSN 1225-9918 Effect of Sulforaphane on LPS-Induced Matrix Metalloproteinase-9 (MMP-9) Expression Jung Tae Lee, Kyung Jin Woo and Taeg Kyu Kwon*
More informationSpring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터
Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr
More information354-03(07-52).fm
Kor. J. Microbiol. Biotechnol. Vol. 35, No. 4, 316 324(2007) 제니스테인에의한노화된피부세포활성화와콜라겐생성효과 양은순 1 홍란희 2 강상모 1,3* 1 건국대학교대학원생물공학과, 2 중앙대학교의과대학예방의학교실, 3 건국대학교미생물공학과 The Effect of Genistein on the Proliferation
More informationKaes010.hwp
갑상선자극호르몬이갑상선암세포의 VEGF, 신생혈관형성, 성장, 침윤및전이에미치는영향 Effects of TSH on the Production of VEGF, Angiogenesis, Growth, Invasion and Metastasis in Thyroid Cancer Cells Euy Young Soh, M.D., Hee Boong Park, M.D.,
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More informationMicrosoft Word - 0012006144.doc
KISEP Rhinology Korean J Otolaryngol 2006;49:786-90 상악동 후비공 비용과 비용에서의 Matrix Metalloproteinase-2/-9의 발현 한림대학교 의과대학 이비인후-두경부외과학교실, 1 병리학교실 2 2 김진영 1 전진형 1 홍현정 1 김해영 1 김현수 1 박혜림 2 민수기 Expression of Matrix
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More informationOverview -ingredient - mechanism 2. Biomarker 3. In vitro study 4. In vivo study 5. Human study 6. 기능성 인정서 7.기준규격 인정서
*CJ standard Mw 40500 standard Mw 8000 CJ CJ Chitosan 1. 70g Sprague Dawley 1 2. Stainless steel cage 3. Ingredient Basal Control CJ Sucrose Starch Casein DL-methionine Corn oil Lard Choline bitartarate
More information저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information207.fm
Lab. Anim. Res. 2010: 26(2), 173-180 Aspectual Comparison of the Skin Changes in Hairless Mice According to the Aging Type Kyoung-Hwa Choi, Young-Chul Kim* and Bae-Hwan Kim* Department of Public Health,
More information07-1960(JH)
한국두피모발미용학회지 제5권 제1호 2009 The Journal of Beauty & Trichology 5(1), 00~00(2008) 1960년대 뷰티 및 패션트렌드 분석 - 모델 트위기 (Twiggy) 를 중심으로 - 김희선* 안양과학대학 뷰티디자인학부 Analysis of Beauty and Fashion trends in the 1960 s - Focusing
More information본초학표지
大韓本草學會誌제 28 권제 6 호 (2013 년 11 월 ) Kor. J. Herbology 2013;28(6):95-100 ISSN 1229-1765 http://dx.doi.org/10.6116/kjh.2013.28.6.95. 황칠나무, 산수유, 구기자복합초임계유체추출물의항산화및항노화효과 신동철 1#, 김귀철 2, 송시영 1, 김희진 2, 양재찬 3, 김보애
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationuntitled
理 葉 CNFH-88-04 行 87 年 9 1 88 年 6 30 類 葉 Staphylococcus aureus Staphylococcus epidermidis Streptococcus mutans Streptococcus sanguis Escherichia coli Klebsiella pneumoniae Pseudomonas aeruginosa Candida
More information3Å׸¶(12¿ùÈ£)3053.ok
THEME 바이오 재료 담당위원 : 조종두 교수(인하대) THEME 01 약물전달과 생체 조직공학용 바이오 재료의 소개 및 연구 동향 THEME 02 외부힘과 상체의 각도가 요추 운동학에 미치는 영향에 관한 연구(오일러 빔 모델링) THEME 03 박막니티놀 생체재료의 혈액적합성 및 소형혈관계 스텐트 연구 THEME 04 조직공학에 사용되는 세포지지체의 기계적
More information<3136C1FD31C8A35FC3D6BCBAC8A3BFDC5F706466BAAFC8AFBFE4C3BB2E687770>
부동산학연구 제16집 제1호, 2010. 3, pp. 117~130 Journal of the Korea Real Estate Analysts Association Vol.16, No.1, 2010. 3, pp. 117~130 비선형 Mankiw-Weil 주택수요 모형 - 수도권 지역을 대상으로 - Non-Linear Mankiw-Weil Model on Housing
More information