Table 1. Bacterial strains and plasmids used in this study Strain and plasmids Description Source B. pseudomallei strains H0901 Clinical isolate (wild
|
|
- 경선 허
- 6 years ago
- Views:
Transcription
1 연구단신, Brief report 2 이중표지유비저균제작을통한생체내추적시스템구축 질병관리본부감염병분석센터고위험병원체분석과신용우, 박덕범, 최명민, 전정훈, 이기은 * 연세대학교생명시스템대학생명공학과 성백린 * 교신저자 : gerhie@korea.kr, Construction of luminescence and fluorescence tagged Burkholderia pseudomallei for pathogen tracking in a mouse model Shin Yong-woo, Park Deok-bum, Choi Myung-min, Chun Jeong-hoon, Rhie Gi-eun Division of High-risk Pathogens, Center for Laboratory Control of Infectious Diseases, KCDC Seong Baik-lin Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University Molecular imaging of pathogens causing infectious diseases, at both cell and whole organism levels, is crucial to studying the pathogenesis mechanisms of infectious diseases. In this study, we have produced a luminescence and fluorescence duallabeled form of Burkholderia pseudomallei, a high-risk pathogen, which can be used to study pathogenesis and the immune responses at live organism, isolated organ, tissue and cell levels simultaneously. Using this method, we could trace B. pseudomallei in mice, and visualize bacterial replication in cells. The method is highly applicable to other pathogens, and could be an extremely useful tool to study the pathogenesis and host immune responses of a variety of infectious diseases. Keywords: Burkholderia pseudomallei, Molecular imaging, Luminescence, Fluorescence 들어가는말 최근세포의특정인자위치를영상화하는기술과함께살아있는개체내에서특정인자의위치를실시간으로시각화하여위치정보를확인하는분자영상기술이급속도로발전하고있다. 생체분자영상기법은다양한분야에서적극적으로활용되고있지만, 감염병분야, 특히고위험병원체연구분야에있어서의적용은아직미흡한실정이다. 병원체의분자영상분석은개체전체뿐만아니라세포수준에서의병원체분포분석과감염기작및면역반응의 상세한메커니즘조사연구에이용될수있다 [1,2]. 현재의병원체영상화기술은항체를사용하는형광인자 (fluorescence) 및발광인자 (luminescence) 관련된시각화를통하여동물의생체내병원체를추적하고있다 [3,4]. 그러나대다수고위험병원체의경우적절한항체가존재하지않으며 [5,6], 또한일반적으로형광신호는생체가가지고있는배경신호 (background signal) 및생체조직의투과성등의단점으로항체기반의형광신호를이용한면역염색방법은살아있는동물이나세포내의병원체추적연구에적용할수없다. 이러한문제로인해여러병원체의생체내
2 Table 1. Bacterial strains and plasmids used in this study Strain and plasmids Description Source B. pseudomallei strains H0901 Clinical isolate (wild type) [13] H0901-M2GFP-Lux H0901, containing pt7-m2gfp-lux This study Plasmids pbhr1 Broad-host range vector (ori 6k, mobrp4, rep, Cm r, Kan r ) MoBiTec GmbH ptopo-m2gfp-lux Genes for M2GFP and lux operon cloned into pcr2.1-topo This study pt7-m2gfp-lux Genes for T7promoter, M2GFP, and lux operon cloned into pbhr1 This study PCR primers EcoRI-F EcoRI-R Primer sequences (5'-3') a AGCGAATTCCCCTATAGTGAGTCGTATTACATGAGTAAAG AGCGAATTCTCAACTATCAAACGCTTCGGTTAAG a Restriction enzyme sites are underlined;boldface indicates T7 promoter sequence. 기작에대한연구는암과같은잘특징지어지는질병과비교하여어렵다는것이입증되었다 [7,8]. 병원체의감염메커니즘을정확하게분석하기위해서는생체내장기, 조직및세포수준에서동시에시공간적으로분석되어야한다. 이연구에서는생체내에서일어나는병원체증식현상에대한영상화를목적으로형광인자와발광인자이중표지유비저균을개발하여감염병연구를위한생체분자영상추적시스템을구축하였다. 및발광인자표지화를위한유비저균용벡터를제작하였다. 형광신호를발현하는 M2GFP 유전자와세포내에서효소-기질작용에의해발광신호를유도하는발광인자유전자군 (lux operon) 이포함된 pt7-m2gfp-lux 벡터를사용하여형광및발광인자가발현하는유비저균 (H0901-M2GFP-Lux) 을제조하였다 (Figure 1A, Table 1). 유비저균의형광및발광인자발현이세균수가증가함에따라영상신호가증가함을정량적으로관찰할수있었다 (Figure 1B). 이후제작된 H0901-M2GFP-Lux 균주를실제마우스에 몸말 유비저균 (Burkholderia pseudomallei) 은그람음성균이며사람에게유비저 (Melioidosis) 라는감염병을일으키는고위험병원체이다 [9]. 또한적은양으로도병원성을일으키기때문에생물학적무기로도사용될수있다 [10]. 효과적인백신과치료법은아직개발되지않았으며기초연구를위한병원체분포및감염된숙주의면역반응에대한정보가필요하다 [11,12]. 이연구에서는생체내에서일어나는유비저균의숙주내병원체추적과단일세포영상화를위한목적으로이중표지유비저균을제작하였다. 이연구에사용된유비저균은국내발생유비저환자로부터분리되었고 [13], 유전자재조합기법을이용하여형광 감염시켜생체분자영상분석을위한동물실험을수행하였다. 이연구에서진행된모든실험은질병관리본부지침에따라생물안전 3등급시설 (BL3) 에서수행되었으며, 동물실험윤리위원회 (Institutional Animal Care and Use Committee, IACUC) 의실험기준에따라진행되었다. 6주령의 BALB/c 마우스에 1x10 7 또는 1x10 8 (CFU/mL) 의 H0901-M2GFP-Lux 균주를정맥주사한후, 생체영상분석장비 IVIS Lumina III(PerkinElmer, MA, USA) 로영상신호를분석하여감염유비저균의생체내분포양상을관찰하였다. 마우스생체내에서의유비저균의발광인자발현을확인하였고 (Figure 2A), 발광신호는 PBS 대조군에비해현저하게증가됨을확인하였다 (Figure 2B). 마우스장기의경우, 정맥주사한후감염된장기를적출하여병원체가감염된장기에서의발광신호를정량화하였다. 감염 6시간후비장을비롯한타장기로병원균이전파됨을확인할
3 Figure 1. Construction of Burkholderia pseudomallei H0901-M2GFP-Lux A. Construct of pt7-m2gfp-lux. M2GFP is a GFP variant of increased fluorescence. The T7 promoter gene was inserted upstream of the M2GFP and lux operon genes for constitutive expression. B. Fluorescent (top panel) and luminescent (lower panel) signals from H0901-M2GFP-Lux. Differences in fluorescent and luminescent signal intensities were analyzed by one-way ANOVA and Tukey s post-hoc test. ***P < 수있었고, 대조군에비해폐, 간, 비장에병원체분포가크게증가하였다. 또한공초점형광현미경 (Confocal microscopy, Olympus FV1000) 을사용하여마우스비장조직내의병원체감염양상을확인하였다 (Figure 3A). 세포수준에서의관찰을위해마우스대식세포 J774A.1 세포에 10 MOI로감염시켰다. 2시간후공초점형광현미경을사용하여유비저균이세포질에위치하는것을확인하였다 (Figure 3B). 맺는말 생체분자영상분석기법을이용한감염병연구는개체수준에서감염병원체의실시간위치정보를제공할수있다. 이번연구의결과는유비저균감염이후의시간에따른생체내각기관별조직및세포수준에서시공간적정보를영상화할수있음을나타낸다. 기존의일반적인동물실험기법은시간별, 위치별로분석결과를 얻기위해많은개체의소모가필요하지만이연구를통해확립된 이중표지영상균주기법은한개체에서반복적인관찰이가능하고
4 Figure 2. In vivo distribution of Burkholderia pseudomallei H0901-M2GFP-Lux A. Mice were intravenously infected with or CFU/ml of H0901-M2GFP-Lux, and in vivo analysis was performed 6 h later. The photon counts (photons/sec/cm 2 ) of labeled bacteria are represented colorimetrically from red (high concentration) to violet (low concentration). Images are representative of three replicate experiments, and representative animals are shown. B. Differences in bioluminescent signal intensities were analyzed by one-way ANOVA and Tukey s post hoc test. ***P < Figure 3. Dual image analyses of Burkholderia pseudomallei H0901-M2GFP-Lux-infected mice A. Mice were intravenously inoculated with either PBS or H0901-M2GFP-Lux for 6 h. The animals were sacrificed and organs were harvested for ex vivo imaging using IVIS Lumina III and bacterial load determination (left). Fluorescent confocal microscopic analysis of H0901-GFP-Lux infected spleen tissue was also conducted (right). B. Analysis and visualization of bacteria at the cellular level using fluorescence. J774A.1 macrophages were infected with H0901-M2GFP-Lux at an MOI of 10 for 2 h. DIC, differential interference contrast
5 실험에사용되는개체수를최소화할수있어동물윤리적측면에서도바람직한방법이라할수있다. 또한이중표지균주를이용한영상분석은숙주의감염과정을연구하는효율적인방법을제공할수있다. 병원균특이적항체없이도살아있는숙주장기조직및세포에서동시에추적할수있어병원체감염현상에대한자세한정보제시가가능하다. 이중표지를이용한이번연구의분석연구에응용은유비저균에국한되지않고다른병원균으로확대될수있다. 특정병원체내에서복제가가능한벡터및활성화프로모터의교체를통해다른고위험병원체에적용하여시각화하고추적할수있다. 또한영상신호의높은발현양으로낮은농도의병원균검출및분석에도활용될수있다. 이연구결과는생체분자영상분석을통한고위험병원체의감염양상연구에활용이가능할것으로기대된다. 참고문헌 1. Massey S, Johnston K, Mott TM, Judy BM, Kvitko BH, Schweizer HP, Estes DM, Torres AG. In vivo bioluminescence imaging of Burkholderia mallei respiratory infection and treatment in the mouse model. 2. Warawa JM, Long D, Rosenke R, Gardner D, Gherardini FC. Bioluminescent diagnostic imaging to characterize altered respiratory tract colonization by the Burkholderia Pseudomallei capsule mutant. Front Microbiol. 2011;2: Nham T, Filali S, Danne C, Derbise A, Carniel E. Imaging of bubonic plague dynamics by in vivo tracking of bioluminescent Yersinia pestis. PLoS One. 2012;7:e Revelli DA, Boylan JA, Gherardini FC. A non-invasive intratracheal inoculation method for the study of pulmonary melioidosis. Front Cell Infect Microbiol. 2012;2: Louie M, Read S, Simor AE, Holland J, Louie L, Ziebell K, Brunton J, Hii J. Application of multiplex PCR for detection of non-o157 verocytotoxin-producing Escherichia coli in bloody stools: identification of serogroups O26 and O111. J Clin Microbiol. 1998;36: Rajwa B, Dundar MM, Akova F, Bettasso A, Patsekin V, Hirleman ED, Bhunia AK, Robinson JP. Discovering the unknown: detection of emerging pathogens using a label-free light-scattering system. Cytometry A. 2010;77: Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW. MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature. 2004;431: Burton JB, Johnson M, Sato M, Koh SB, Mulholland DJ, Stout D, Chatziioannou AF, Phelps ME, Wu H, Wu L. Adenovirus-mediated gene expression imaging to directly detect sentinel lymph node metastasis of prostate cancer. Nat Med. 2008;14: Wiersinga WJ, Currie BJ, Peacock SJ. Melioidosis. N Engl J Med. 2012;367: Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM. Public health assessment of potential biological terrorism agents. Emerg Infect Dis. 2002;8: Limmathurotsakul D, Peacock SJ. Melioidosis: a clinical overview. Br Med Bull. 2011;99: Patel N, Conejero L, De Reynal M, Easton A, Bancroft GJ, Titball RW. Development of vaccines against Burkholderia Pseudomallei. Front Microbiol. 2011;2: Shin YW, Cho MH, Chun JH, Kim CM, Oh HB, Rhie GE, Yoo, CK. The Laboratory Diagnosis of Melioidosis in a Korean Patient. J Bacteriol Virol. 2011;41:
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information975_983 특집-한규철, 정원호
Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology
More informationMicrosoft Word - Cell-based High Content Analysis_KOS_
Introduction to Cell-based High Content Analysis system (BD Pathway 855) Background 세포는각각의기능과장소그리고외부물질로인해많은성장. 분화와변화등을거치기도합니다. 세포의기본적연구와의료목적의연구, 더나아가신약개발목적을위해생명과학연구자및신약개발연구자들은세포내에서일어나는일련의생명현상들을좀더명확히관찰하고자합니다.
More information항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationTable 1. Allelic profiles of 194 C. jejuni analyzed in this study Gene locus Fragment length (bp) No. of alleles No. of polymorphic sites (%) Ave. p d
연구논문, Research article 국내설사환자분리캄필로박터제주니의유전형분석 질병관리본부감염병분석센터세균분석과정수미, 강병학, 홍사현, 김재옥 * * 교신저자 : kimjo70@korea.kr, 043-719-8110 Genetic analysis of Campylobacter jejuni isolates from diarrheal patients in
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information°Ç°�°úÁúº´6-13È£ÀÛ¾÷
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 13 www.cdc.go.kr 2013 3 29 6 13 ISSN: 2005-811X 10-years of Hepatitis B Perinatal Transmission Prevention
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More informationMicrosoft Word - KSR2016S168
2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin
More information<38BFF93238C0CF28B1DDBFE4C0CF2920BFB9BBF3B9E8B4E72E786C7378>
[부산 ] 2009년 08월 28일 ( 金 ) 1경주 국 5(마령)1000M 발주 13:00 종합 인기도 출전 착순 출주 10 11 5 검은요정 국5 한2 암 김재섭 영준 53 3착 선행 5 5 5 15 1 6 3 0.3 주 10 랜드레이디 국5 한2 암 강형곤 현명 53 3착 선행 10 5 6.3 10 10 4 8 4 2 4 주 11 일맥상통 국5 한3 암
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information지원연구분야 ( 코드 ) LC0202 과제번호 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 소속위암연구과직위책임연구원
지원연구분야 ( 코드 ) LC0202 과제번호 1110550 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 1 2 3 소속위암연구과직위책임연구원 성명류근원전공외과 세부과제명 세부과제책임자 성명 소속 ( 직위 ) 전공 총연구기간 2011
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More informationSpecial Issue
Special Issue Trends of Bacterial Zoonoses in Humans in Korea Chul Soon Choi, D.V.M. Department of Microbiology ChungAng University College of Medicine Email : cschoi@cau.ac.kr Abstract Out of national
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<30382EC0C7C7D0B0ADC1C22E687770>
대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information°Ç°�°úÁúº´6-24È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 24 www.cdc.go.kr 2013 6 14 6 24 ISSN: 2005-811X Animal bite cases in high-risk region of rabies, 2011-2012
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More informationA
2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More information2017.09 Vol.255 C O N T E N T S 02 06 26 58 63 78 99 104 116 120 122 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2017.9 3 4 2017.9 6 2017.9 7 8 2017.9 13 0 13 1,007 3 1,004 (100.0) (0.0) (100.0)
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More information<30322EC6AFC1FD30342DC1A4B9AEC7F62E687770>
대한내과학회지: 제 77 권 제 2 호 2009 특 집(Special Review) - 신종 감염병의 최신 지견 뎅기열 인하대학교 의학전문대학원 내과학교실 감염내과 정 문 현 Dengue fever Moon-Hyun Chung, M.D. Division of Infectious Diseases, Department of Internal Medicine, College
More information45-51 ¹Ú¼ø¸¸
A Study on the Automation of Classification of Volume Reconstruction for CT Images S.M. Park 1, I.S. Hong 2, D.S. Kim 1, D.Y. Kim 1 1 Dept. of Biomedical Engineering, Yonsei University, 2 Dept. of Radiology,
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More information395-402Ȳ¼º¼ö
395 Fig. 1. Flow diagram showing selection of options for adequate screen recording on the CamStudio 396 Fig. 2 Flow diagram showing the menu buttons on the CamStudio and the process of recording after
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More information( )Kju225.hwp
비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationMinimally invasive parathyroidectomy
2013. 2. 2 대한간암연구학회 7차 심포지움 및 학술대회 Indication and Clinical Outcomes of Metachronous HCC Metastasectomy Shin Hwang Division of Liver Transplantation and Hepatobiliary Surgery, Department of Surgery, Asan
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationnonpara6.PDF
6 One-way layout 3 (oneway layout) k k y y y y n n y y K yn y y n n y y K yn k y k y k yknk n k yk yk K y nk (grand mean) (SST) (SStr: ) (SSE= SST-SStr), ( 39 ) ( )(rato) F- (normalty assumpton), Medan,
More information조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a
조사연구 권 호 연구논문 한국노동패널조사자료의분석을위한패널가중치산출및사용방안사례연구 A Case Study on Construction and Use of Longitudinal Weights for Korea Labor Income Panel Survey 2)3) a) b) 조사연구 주제어 패널조사 횡단면가중치 종단면가중치 선형혼합모형 일반화선형혼 합모형
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More informationSystem Biology Core
System Biology Core 연세의생명연구원연구지원부 _ 연세유전체센터 The RNAi Consortium (TRC) shrna 안내 Ⅰ. MISSION shrna 의설계 MIT 와 Harvard 의 Broad Institute 의 The RNAi Consortium (TRC) 에서설계하고개발한 MISSION shrna clones 는 21 base
More information보건사회연구-25일수정
30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More information노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
More information63-69±è´ë¿µ
Study on the Shadow Effect of 3D Visualization for Medical Images ased on the Texture Mapping D.Y. Kim, D.S. Kim, D.K. Shin, D.Y. Kim 1 Dept. of iomedical Engineering, Yonsei University = bstract = The
More information보도자료 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 ( ) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1
보도자료 http://www.motie.go.kr 2013 년 5 월 16 일 ( 목 ) 조간부터보도하여주시기바랍니다. 문의 : 에너지환경표준과최철우과장, 류지영연구사 (509-7272) 화장품에도국제표준이...? - 화장품도이젠표준선점으로세계시장선도를 - [ 붙임 1 참조 ] [ 붙임 2 참조 ] [ 붙임 3, 4 참조 ] 이보도자료와관련하여보다자세한내용이나취재를원하시면산업통상자원부기술표준원에너지환경표준과류지영연구사
More information<C5EBC0CFB0FA20C6F2C8AD2E687770>
한국의 북한 핵개발에 대한 인식과 대응 3 한국의북한핵개발에대한인식과대응: 3 차 핵실험 이후* 1)박영호 ( 통일연구원) 국문요약 2013년 2월 12일 북한의 3 차 핵실험은 국내외에 커다란 충격을 주었다. 북한의 핵능 력이 진전되고 북한은 경제건설과 함께 핵 무력건설을 김정은 시대의 발전전략으로 채택 했다. 북핵문제의 패러다임이 변화했다. 한국 사회에서의
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More information12¾ÈÇö°æ1-155T304®¶ó153-154
Journal of Fashion Business Vol. 8, No. 4, pp.141~155(2004) A Research for the hair Style Image making Chart Manufacturing Depends on Fashion Feeling + - through the analysis of the actress hair styles
More information서강대학원123호
123 2012년 12월 6일 발행인 이종욱 총장 편집인 겸 주간 임종섭 편집장 김아영 (우편번호 121-742) 주소 서울시 마포구 신수동1번지 엠마오관 B133호 대학원신문사 전화 705-8269 팩스 713-1919 제작 일탈기획(070-4404-8447) 웃자고 사는 세상, 정색은 언행 총량의 2%면 족하다는 신념으로 살았습니다. 그 신념 덕분인지 다행히
More information식물병연구 Research Article Open Access Res. Plant Dis. 24(3): (2018) Incidence Rates of Major Diseases o
식물병연구 Research Article Open Access Res. Plant Dis. 24(3): 175-181 (2018) https://doi.org/10.5423/rpd.2018.24.3.175 Incidence Rates of Major Diseases on Green-Fleshed Kiwifruit cv. Hayward and Yellow-Fleshed
More information