슬라이드 1
|
|
|
- 미려 왕
- 6 years ago
- Views:
Transcription
1 NGS Analysis using Galaxy 2013 한국유전체학회동계심포지엄생물정보분석교육워크샵 김형용, 이규열, 이성찬 _ ~ R&D Center, Insilicogen, Inc.
2 Index NGS Analysis using Galaxy 목차있을시간지 01 Galaxy introduction 02 Galaxy examples 1,2 03 Galaxy installation 04 Galaxy function details 05 Galaxy examples 3,4 06 Galaxy tools 07 Galaxy on Grid 08 Galaxy on Cloud
3 Agenda 구분시간강의내용비고 15:00 ~ 15:20 Galaxy 소개진행김형용 1 부 : Introduction and Application 15:20 ~ 15:50 Galaxy 분석예제시연 1. Human exon 가운데가장 SNP 많은 ex on 찾기 2. NGS QC and assembly 예제 16:00 ~ 16:20 Galaxy 설치진행이성찬 16:20 ~ 17:10 Galaxy 설치및분석예제실습 1. Galaxy 설치실습 2. Human exon 가운데가장 SNP 가많은 exon 찾기실습 3. NGS QC and assembly 예제실습 2 부 : Custom operation 17:20 ~ 17:50 Galaxy 세부기능에대한설명진행김형용 09:00 ~ 09:20 Galaxy 분석예제시연진행김형용 1. RNA-seq 분석예제 2. NGS 분석예제 2 19:20 ~ 09:50 Galaxy 분석예제실습 1. RNA-seq 분석예제 2. NGS 분석예제 2 10:00 ~ 10:20 Galaxy tool의이해진행김형용 10:20 ~ 11:00 Galaxy tool 작성실습 1. Primer design 11:10 ~ 11:30 Galaxy on Grid 진행이규열 1. 그리드의이해 2. 분산작업시연 11:30 ~ 11:50 Galaxy on Cloud 진행김형용 1. 클라우드의이해 2. Galaxy on Amazon EC2 3
4 NGS Technologies
5 Sequencer Comparison Illumina 454 SOLiD Read length HiSeq 2000 HiSeq 1000 HiScan SQ GAIIx GS FLX 2X100 bp 2X150 bp 400 bp 5500 microbeads 5500xl microbeads Mate pair : 60 bp X60 bp Paired-end : 75 bp X35 bp Fragment : 75 bp 5500xl nanobeads Gb/day h Yield 600Gb 300Gb 150Gb 95Gb 35Mb 90Gb 180Gb 300Gb Required input Accuracy 50 ng with Nextera 100 ng 1 μg with TruSeq 85% (2X50 bp, >Q30) 80% (2X100 bp, >Q30) 99% (>Q20) 99.99% Illumina 의 Gb/day 는 2X100 bp run 결과 Illumina read length : 1X35, 2X50, 2X100 GA : 1X35, 2X50, 2X100, 2X150 Copyrightc Insilicogen, Inc All rights reserved. 5
6 Applications Application of NGS Technique Personal Genomics Microbiology Personal Genomics Environmentology Toxicology Chemical Biology Mutation Detection Structure Variation Transcriptional Control Interaction of DNA and Protein 6
7 Issue of New Genomic Era. many researchers, having invested in next generation sequencing instruments, now face a computational bottleneck in their research work-flow. BGI 7
8 Most Significant Improvement to Your Next Generation Sequencing Workflow ( 출처 : The Global Outlook for Next Generation Sequencing: Usage, Platform Drivers & Workflow, October 31, BioInformatics, LLC) Copyrightc Insilicogen, Inc All rights reserved. 8
9 Issue of New Genomic Era. DNA shearing Insert into high and /or low copy number vectors Big Dye ABI 3730 Data compliation Gene prediction BLAST search FTP Web browser Commercial software Bioinformatics Library construction Sequence delineation Sequence annotation Data delivery Template purification Finishing & Assembly Secondary annotation PCR Amplicons BACs Cosmids/ Fosmids Primer walking Transposon insertion methods Proprietary & commercial assembly SNP Comparative genomics Expression analysis Cost Process 9
10 Application of Next Genomic Data 10
11 Practical Software Platforms for NGS data analysis
12 What kind of? Biological Features Framework (Enterprise/Informatics) Features Service Price
13 List of NGS Frameworks Copyrightc Insilicogen,Inc All rights reserved. 13
14 유전변이추출전문파이프라인 HugeSeq Copyrightc Insilicogen,Inc All rights reserved. 14
15 사용자친화적 GUI 환경을제공하는 CLC Genomics Server 1 CLC Genomics Server - 3계층시스템구조의데이터분석및공유, 관리를위한엔터프라이즈솔루션 CLC Bioinformatics Database - 데이터의중앙집중방식의저장및공유관리를위한데이터베이스 3 CLC Assembly Cell - NGS 데이터의초고속 assembly 분석솔루션 ( 커맨드라인기반 ) CLC Genomics Workbench - NGS 데이터의다양한생물정보분석솔루션 (GUI 기반 ) 5 CLC Developer Kit - 사용자가원하는생물정보분석툴과워크플로우커스터마이징솔루션 Copyrightc Insilicogen,Inc All rights reserved. 15
16 16
17 30x Human genome 1 sample (150G) 500 만원 (1 년저장 ) 17
18 구글로부터투자받아 NCBI SRA 서비스연동 온라인에서실험없이곧바로분석가능 18
19 GALAXY
20 20
21 21
22 What is Galaxy Galaxy, a web-based genome analysis platform An open-source framework for integrating various computational tools and databases into a cohesive workspace A web-based service we provide, integrating many popular tools and resources for comparative genomics A completely self-contained application for building your own Galaxy style sites 22
23 Galaxy Usage One of the fastest growing open source bioinformatics projects, a highly successful high throughput data analysis platform for Life Sciences with over 15,000 users worldwide Annual Galaxy Community Conference 23
24 Galaxy visualization External Genome Browser UCSC Ensembl GBrowse Trackster Track/data viewer in web browser HTML5 Canvas, jquery Renders in browser, not on server 24
25 Galaxy visualization 25
26 Trackster 26
27 Trackster 27
28 Trackster 28
29 Galaxy 구성요소 Galaxy 주요구성요소 Datasources : 입력데이터지정. 별도의지역시스템이나, 외부웹사이트의데이터를등록가능 Tool : 기본적인분석의최소단위, 지역설치시원하는툴을만들어넣을수있음 History : 입력데이터가 Tool의조합을거쳐얻어진중간결과물목록 Workflow : History 는입력데이터및파라메터만바꾸면새로운데이터결과를얻을수있다. 이를별도로프로세스등록 Visualization : 분석결과를가시화도구와연결 Page : 위요소들을종합한보고서작성기능 Eprimer3 tool 을별도로만들어등록한예제 29
30 Galaxy tool 은 입력포맷 Tool 출력포맷 입력데이터를 ( 포맷에맞게 ) 작업하여 ( 포맷에맞게 ) 출력데이터를만드는역할 조합하면 Workflow 가된다 30
31 Galaxy formats Auto-detect Ab1 Axt Bam Bed Fasta FastqSolexa Gff Gff3 Interval (Genomic Intervals) Lav MAF Scf Sff Tabular (tab delimi ted) Wig Other text type 데이터가어떤형식인지자동으로인식 A binary sequence file in 'ab1' format with a '.ab1' file extension. You must manually select this 'File Format' when uploadi ng the file. blastz pairwise alignment format. Each alignment block in an axt file contains three lines: a summary line and 2 sequence li nes. Blocks are separated from one another by blank lines. The summary line contains chromosomal position and size infor mation about the alignment. It consists of 9 required fields. A binary file compressed in the BGZF format with a '.bam' file extension. Tab delimited format (tabular). Does not require header line A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 characters Illumina (Solexa) variant of the Fastq format, which stores sequences and quality scores in a single file GFF lines have nine required fields that must be tab-separated. The GFF3 format addresses the most common extensions to GFF, while preserving backward compatibility with previous fo rmats. Tab delimited format (tabular) Lav is the primary output format for BLASTZ. The first line of a.lav file begins with #:lav.. TBA and multiz multiple alignment format. The first line of a.maf file begins with ##maf. This word is followed by white-sp ace-separated "variable=value pairs". There should be no white space surrounding the "=". A binary sequence file in 'scf' format with a '.scf' file extension. You must manually select this 'File Format' when uploading the file. A binary file in 'Standard Flowgram Format' with a '.sff' file extension. Any data in tab delimited format (tabular) The wiggle format is line-oriented. Wiggle data is preceded by a track definition line, which adds a number of options for controlling the default display of this track. Any text file 31
32 Galaxy 특징한번더 최근 Galaxy 사용추세 NGS 관련분석기능탑재 Amazon Cloud 이용 논문에 Galaxy URL 제공 Transparent analysis Biologist Bioinformatician Galaxy 특징한번더 파이썬으로만들어져있으나, 확장시파이썬이아니어도됨 투명한 분석플로우를만들고공유하고확장할수있다. 거의모든생물정보분석을 Galaxy 로할수있다. Galaxy만잘써도뽑겠다 (NCBI) 32
33 GALAXY Examples 1
34 Example 1. Finding Human Exons with the highest number of SNPs 1. Download all Human Exons from NCBI or Ensembl BioMart or UCSC TableBrowser 2. Download all Human SNPs from 3. Scripting Join 1, 2 according to position Group by Exon id Sort by SNP count Filter Exon which has more than 10 SNPs Have to do programming! (Python, Perl, ) 34
35 On Galaxy 35
36 On Galaxy Get data UCSC main : Exon 데이터가져오기 Get data UCSC main : SNP 데이터가져오기 Operate on Genomic Interval Join : 영역이겹치는 Exon 추출하기 Join, Substract and Group Group : Exon 이름으로그룹핑하고 SNP 세기 Filter and Sort Sort : SNP 개수로 Exon 정렬하기 Text Manipulation Select first : SNP 개수가많은 top 5 exon 추출하기 Join, Substract and Group Compare two Datasets : 잃어버린 exon 정보회복하기 36
37 GALAXY Examples 2
38 Example 2. Human NGS data QC and assembly 1. NGS Quality Control 2. NGS Single End Mapping 3. SNP Calling 4. Compare with dbsnp Have to do in Unix and need programming! (Python, Perl, ) 38
39 On Galaxy 39
40 On Galaxy NGS 분석을위해서는프로그램추가설치해야함 ( ) 프로그램 사용되는곳 설치방법 Fastx-toolkit NGS QC Ubuntu apt-get Gnuplot NGS QC boxplot Ubuntu apt-get Bowtie2 Reference assembly 복사후 PATH 설정 SAMTools SNP calling Ubuntu apt-get 40
41 On Galaxy Get data Upload File : human illumina fastq 파일업로드 NGS: QC and minipulation FASTQ Groomer : fastsanger 포맷을변경 NGS: QC and minipulation Compute quality statistics : fastq quality 통계정보보기 NGS: QC and minipulation Draw quality score boxplot : fastq quality 통계정보로 boxplot 그리기 NGS: QC and minipulation FASTQ Trimmer, Quality Trimer, Masker : 의미없는부분잘라내기, 가리기 41
42 On Galaxy Get data Upload File : Reference assembly 를위한레퍼런스서열입력 NGS: Mapping Bowtie2 : Bowtie2 를이용한 assembly NGS: SAM Tools MPileup : BAM 파일에서 SNP, indel 정보추출하기 NGS: SAM Tools Filter pileup : 추출된 SNP, indel 가운데높은점수추출하기 NGS: SAM Tools Pileup-to-interval : Genomic interval 형식으로변경 Get data UCSC Main : dbsnp 정보가져오기 Operate on Genomic Interval Join : 영역이겹치는 SNP 추출하기 42
43 Galaxy Installation
44 Install Virtualbox - Ubuntu 1. USB 에서 Virtualbox 와 Galaxy 폴더를복사합니다. 2. Virtualbox 를설치합니다. 3. Virtualbox 를실행한후, Galaxy 이미지를 Import 합니다. 4. 설정에서네트워크를브릿지 (Bridge) 로변경합니다. 5. Ubuntu 실행후, Network 설정파일을삭제합니다. rm /etc/udev/rules.d/70-persistent-net.rules 6. Linux(ubuntu) 를재시작합니다. sudo shutdown h now 44
45 Creating your own Galaxy 45
46 Running Galaxy in an production environment By default, Galaxy uses SQLite database Built-in HTTP server for all tasks Local job runnser Single process Simplest error-proof configuration Change configuration for service Disable the developer settings use_interactive = False, use_debug = False Get a real database PostgresSQL Offload the menial tasks: Proxy Nginix, Apache Let your tools free: Cluster Move intensive processing to other host, TORQUE, GRID, DRMAA Other advanced settings 46
47 Galaxy on Cluster Intensive processes to other hosts TORQUE GRID DRMAA Working with Galaxy on the Cloud 47
48 Virtualization
49 Virtualization 가상화 컴퓨터자원의추상화를일컫는말 가상의물리적리소스를만들어냄. 물리적인 1 대의하드웨어자원을논리적으로여러개로나누어사용하거나, 여러대의하드웨어자원을논리적으로통합하여이용하는기술 하드웨어관리, 재난에대한시스템복구등여러문제를해결할수있는방법으로최근각광 받고있음
50 Virtualization 비용절감 서버한대를분할하여여러대의서버를구성할수있음 서버구입비용절감, 전기, 상면비용, 서버관리비용이절감 자원의효율적인사용 서버의비활용되는자원을이용하여가상머신을만듬으로써효율적인자원사용이가능 안정적인운영 가상화의장점!! 서버를이미지로백업, 손쉬운서버이전으로장애에대한신속한대처가능 SW 의지속적인운영 서버 HW의수명주기가끝나면 OS 벤더는장치드라이버지원이중단됨 -> 마이그레이션문제가발생 가상머신에기존의시스템을가상머신에올리기때문에장치드라이버에대한문제가발생하지않음 50
51 클라우드서비스에기본적으로활용 51
52 Public Galaxy environment 52
53 Example of Cloud 출처 : isc 2012 Amazon HPC session Copyrightc Insilicogen,Inc All rights reserved. 53
54 Running Galaxy Web server 1. 자신의컴퓨터의 IP Address 를확인합니다. ifconfig 2. Galaxy 폴더로이동합니다. cd galaxy-dist 3. Galaxy web server 를실행합니다. sh run.sh 4. 자신의호스트 OS (windows) 에서웹브라우저에서주소창에다음을입력합니다. IP Address:8080 ( 예, :8080) 54
55 Galaxy Detail functions
56 Get Data 56
57 Get Data / Send Data 57
58 Text Manipulation 58
59 Convert Format 59
60 FASTA manipulation 60
61 Filter and Sort 61
62 Join, Subtract and Group 62
63 Operate on Genomic Intervals 63
64 NGS Toolbox 64
65 Galaxy Examples 3
66 Example 3. Human RNA-seq 1. RNA-seq result: adrenal_1,2.fastq, brain_1,2.fastq 2. Reference: igenome UCSC hg19, chr19 gene notation (GTF format) Have to do in Unix and need programming! (Python, Perl, ) 66
67 On Galaxy 67
68 On Galaxy RNA-seq 분석을위해서는프로그램추가설치해야함 ( ) 프로그램 사용되는곳 설치방법 java FastQC Ubuntu apt-get install openjdk-7-jre FastQC NGS QC tool-data/shared/jars/ 로복사 Tophat RNA-seq mapping ( 다음페이지참고 ) Cufflinks RNA-seq assembly Ubuntu apt-get install cufflinks 68
69 Tophat install in Ubuntu $ cp samtools tar.gz2 ~/work $ bzip2 d samtools tar.gz2 $ tar xvf samtools tar $ cd samtools $ make $ cd.. $ cp tophat tar.gz ~/work $ tar zxvf tophat tar.gz $ cd tophat $ apt-get install libboost libbam libboost-thread-dev $ cp../samtools /libbam.a /usr/local/lib $ sudo mkdir /usr/local/include/bam $ cp../samtools /*.h /usr/local/include/bam $ configure $ make $ make install 69
70 On Galaxy Get data Upload File : fastq, chr19.fa, gtf 파일업로드 NGS: QC and minipulation FASTQ Groomer : fastqsanger 포맷으로변경 NGS: QC and minipulation FastQC:Read QC : fastq quality 통계정보보기 NGS: RNA Analysis Tophat for Illumina : RNA-seq fastq 데이터에서 splice junction 찾기레퍼런스로 chr19.fa 이용 NGS: RNA Analysis Cufflinks : Transcript assembly, FPKM 추정 70
71 On Galaxy NGS: RNA Analysis Cuffmerge : brain, adrenal 데이터를 reference 에맞게합치기 NGS: RNA Analysis Cuffdiff : 유의한발현변화찾기 71
72 Galaxy Tools
73 Galaxy tool 은 입력포맷 Tool 출력포맷 입력데이터를 ( 포맷에맞게 ) 작업하여 ( 포맷에맞게 ) 출력데이터를만드는역할 조합하면 Workflow 가된다 73
74 Galaxy formats Auto-detect Ab1 Axt Bam Bed Fasta FastqSolexa Gff Gff3 Interval (Genomic Intervals) Lav MAF Scf Sff Tabular (tab delimi ted) Wig Other text type 데이터가어떤형식인지자동으로인식 A binary sequence file in 'ab1' format with a '.ab1' file extension. You must manually select this 'File Format' when uploadi ng the file. blastz pairwise alignment format. Each alignment block in an axt file contains three lines: a summary line and 2 sequence li nes. Blocks are separated from one another by blank lines. The summary line contains chromosomal position and size infor mation about the alignment. It consists of 9 required fields. A binary file compressed in the BGZF format with a '.bam' file extension. Tab delimited format (tabular). Does not require header line A sequence in FASTA format consists of a single-line description, followed by lines of sequence data. The first character of the description line is a greater-than (">") symbol in the first column. All lines should be shorter than 80 characters Illumina (Solexa) variant of the Fastq format, which stores sequences and quality scores in a single file GFF lines have nine required fields that must be tab-separated. The GFF3 format addresses the most common extensions to GFF, while preserving backward compatibility with previous fo rmats. Tab delimited format (tabular) Lav is the primary output format for BLASTZ. The first line of a.lav file begins with #:lav.. TBA and multiz multiple alignment format. The first line of a.maf file begins with ##maf. This word is followed by white-sp ace-separated "variable=value pairs". There should be no white space surrounding the "=". A binary sequence file in 'scf' format with a '.scf' file extension. You must manually select this 'File Format' when uploading the file. A binary file in 'Standard Flowgram Format' with a '.sff' file extension. Any data in tab delimited format (tabular) The wiggle format is line-oriented. Wiggle data is preceded by a track definition line, which adds a number of options for controlling the default display of this track. Any text file 74
75 Creating your own Galaxy 75
76 Primer design tool 76
77 Primer3 Primer3 Primer design program Download from er tar.gz make & copy to PATH eprimer3 Wrapper for Primer3, it s used in EMBOSS package Easy command line interface eprimer3.html apt-get install emboss 77
78 erimer3 $ eprimer3 sequence INPUT_FASTA_FILE outfile PRIMER_DESIGN_RESULT -osize OSIZE -gcclamp GCCLAMP # EPRIMER3 RESULTS FOR GL # Start Len Tm GC% Sequence 1 PRODUCT SIZE: 199 FORWARD PRIMER CTTGCCAATAGCGAATGGAT REVERSE PRIMER GACGGCGTAGATCTTCAAGC 2 PRODUCT SIZE: 199 FORWARD PRIMER TAACACCACTGCTCCTGCTG REVERSE PRIMER CATTGCATGGTCAGAACCAC 이결과형식을수정하여다른 Galaxy tool 의입력으로쓰고싶다. 3 PRODUCT SIZE: 200 FORWARD PRIMER GGGGTTGATTTTCATTGTGG REVERSE PRIMER GTTTGCACCAACCTGGTTTT 4 PRODUCT SIZE: 200 FORWARD PRIMER CTGATGTGCTCTGTGGGAAA REVERSE PRIMER CCGTGTATGTAGCCCGAGTT 직접 Primer design Galaxy tool 만들기 5 PRODUCT SIZE: 197 FORWARD PRIMER ATGTGCTCTGTGGGAAAACC REVERSE PRIMER CCGTGTATGTAGCCCGAGTT 78
79 erimer3.xml 79
80 erimer3.py 80
81 tool_conf.xml <section name="vcf Tools" id="vcf_tools"> <tool file="vcf_tools/intersect.xml" /> <tool file="vcf_tools/annotate.xml" /> <tool file="vcf_tools/filter.xml" /> <tool file="vcf_tools/extract.xml" /> </section> <section name= MyTools" id= mytools"> <tool file= mytools/eprimer3.xml" /> </section> </toolbox> 81
82 EMBOSS eprimer3 tool added 82
83 실습 Install Primer3 : make 명령으로컴파일후, primer3_core PATH 설정 Install EMBOSS : sudo apt-get install emboss Install Biopython : sudo apt-get install python-biopython Copy eprimer3.py, eprimer3.xml to galaxy-dist/tools/mytools/ : mytools 디렉토리는직접생성 Edit tool_conf.xml : mytools/eprimer3.xml 설정 83
84 Galaxy on Grid
85 Grid vs Cluster 공통점 대용량데이터에대한연산을작은소규모연산들로나누어작은여러대의컴퓨터로분산시켜수행 차이점 WAN 상에서서로다른기종의머신들을연결다양한플랫폼을서로연결함연결대수에제한이없음 85
86 Grid 86
87 Globus Toolkit 대표적인계산그리드미들웨어 Open source toolkit for building computing grids developed and provided by Globus Alliance Standards implementation Open Grid Service Architecture (OGSA) Open Grid Service Infrastructure (OGSI) Web Services Resource Framework (WSRF) Job Submission Description Language (JSDL) Distributed Resource Management Application API (DRMAA) SOAP WSDL Grid Security Infrastructure 87
88 High level Open Grid Forum API specification for submission and control of jobs to a Distributed Resource Management (DRM, Job scheduler) system, such as a Cluster or Grid computing infrastructure 88
89 PBS (Portable Batch System) Computer software that performs job scheduling in Unix cluster environment A component of the Globus Toolkit Originally developed by NASA Following versions OpenPBS TORQUE a fork of OpenPBS PBS Professional (PBS pro) - commercial 89
90 TORQUE Distributed resource manager providing control over batch jobs and distributed compute node It stands for Terascale Open Source Resource and QUEue Manager Slave 노드의 CPU 개수, core 개수, RAM 사이즈, 임시저장소등의설정정보를가지고스케줄러에의해요청이왔을때클러스터리소스를분배함 Slave 1 Master Slave 2 NFS Slave 3 > qsub a.sh a.sh 명령을스케줄러에따라 slave로넘김 90
91 Virtualized Galaxy (Test-bed) 91
92 Galaxy on Cloud
93 Cloud computing Delivery of computing and storage capacity as a service to a heterogeneous community of end-recipients. 93
94 94
95 VPS (Virtual Private Server) Internet hosting services to refer a virtual machine in a cloud 95
96 Amazon EC2 (Amazon Elastic Compute Cloud) Virtualization + Grid(Cluster) computing in a Cloud 96
97 Amazon EC2 (Amazon Elastic Compute Cloud) 97
98 Amazon EC2 (Amazon Elastic Compute Cloud) 98
99 Amazon EC2 (Amazon Elastic Compute Cloud) 99
100 Amazon S3 (Amazon Simple Storage Service) 100
101 Galaxy on Cloud Using Amazon EC2 + S3 Select AMIs in Community AMIs 101
102 Galaxy on Cloud 102
103 Galaxy on Cloud 103
104 Galaxy on Cloud 104
105 Galaxy on Cloud 105
106 Galaxy on Cloud 106
107 Galaxy on Insilicogen Galaxy localization on cluster Tool development Workflow development 107
108 Tel Fax
109 Tel ,1009 Fax
DE1-SoC Board
실습 1 개발환경 DE1-SoC Board Design Tools - Installation Download & Install Quartus Prime Lite Edition http://www.altera.com/ Quartus Prime (includes Nios II EDS) Nios II Embedded Design Suite (EDS) is automatically
APOGEE Insight_KR_Base_3P11
Technical Specification Sheet Document No. 149-332P25 September, 2010 Insight 3.11 Base Workstation 그림 1. Insight Base 메인메뉴 Insight Base Insight Insight Base, Insight Base Insight Base Insight Windows
Interstage5 SOAP서비스 설정 가이드
Interstage 5 Application Server ( Solaris ) SOAP Service Internet Sample Test SOAP Server Application SOAP Client Application CORBA/SOAP Server Gateway CORBA/SOAP Gateway Client INTERSTAGE SOAP Service
Portal_9iAS.ppt [읽기 전용]
![Portal_9iAS.ppt [읽기 전용]](/thumbs/104/163081918.jpg "Portal_9iAS.ppt [읽기 전용]")
Application Server iplatform Oracle9 A P P L I C A T I O N S E R V E R i Oracle9i Application Server e-business Portal Client Database Server e-business Portals B2C, B2B, B2E, WebsiteX B2Me GUI ID B2C
김기남_ATDC2016_160620_[키노트].key
![김기남_ATDC2016_160620_[키노트].key](/thumbs/85/91488855.jpg "김기남_ATDC2016_160620_[키노트].key")
metatron Enterprise Big Data SKT Metatron/Big Data Big Data Big Data... metatron Ready to Enterprise Big Data Big Data Big Data Big Data?? Data Raw. CRM SCM MES TCO Data & Store & Processing Computational
PowerPoint 프레젠테이션
Reasons for Poor Performance Programs 60% Design 20% System 2.5% Database 17.5% Source: ORACLE Performance Tuning 1 SMS TOOL DBA Monitoring TOOL Administration TOOL Performance Insight Backup SQL TUNING
FMX M JPG 15MB 320x240 30fps, 160Kbps 11MB View operation,, seek seek Random Access Average Read Sequential Read 12 FMX () 2
FMX FMX 20062 () wwwexellencom sales@exellencom () 1 FMX 1 11 5M JPG 15MB 320x240 30fps, 160Kbps 11MB View operation,, seek seek Random Access Average Read Sequential Read 12 FMX () 2 FMX FMX D E (one
<C0CCBCBCBFB52DC1A4B4EBBFF82DBCAEBBE7B3EDB9AE2D313939392D382E687770>
i ii iii iv v vi 1 2 3 4 가상대학 시스템의 국내외 현황 조사 가상대학 플랫폼 개발 이상적인 가상대학시스템의 미래상 제안 5 웹-기반 가상대학 시스템 전통적인 교수 방법 시간/공간 제약을 극복한 학습동기 부여 교수의 일방적인 내용전달 교수와 학생간의 상호작용 동료 학생들 간의 상호작용 가상대학 운영 공지사항,강의록 자료실, 메모 질의응답,
28 THE ASIAN JOURNAL OF TEX [2] ko.tex [5]
![28 THE ASIAN JOURNAL OF TEX [2] ko.tex [5]](/thumbs/91/105270926.jpg "28 THE ASIAN JOURNAL OF TEX [2] ko.tex [5]")
The Asian Journal of TEX, Volume 3, No. 1, June 2009 Article revision 2009/5/7 KTS THE KOREAN TEX SOCIETY SINCE 2007 2008 ko.tex Installing TEX Live 2008 and ko.tex under Ubuntu Linux Kihwang Lee * kihwang.lee@ktug.or.kr
ORANGE FOR ORACLE V4.0 INSTALLATION GUIDE (Online Upgrade) ORANGE CONFIGURATION ADMIN O
Orange for ORACLE V4.0 Installation Guide ORANGE FOR ORACLE V4.0 INSTALLATION GUIDE...1 1....2 1.1...2 1.2...2 1.2.1...2 1.2.2 (Online Upgrade)...11 1.3 ORANGE CONFIGURATION ADMIN...12 1.3.1 Orange Configuration
PCServerMgmt7
Web Windows NT/2000 Server DP&NM Lab 1 Contents 2 Windows NT Service Provider Management Application Web UI 3 . PC,, Client/Server Network 4 (1),,, PC Mainframe PC Backbone Server TCP/IP DCS PLC Network
solution map_....
SOLUTION BROCHURE RELIABLE STORAGE SOLUTIONS ETERNUS FOR RELIABILITY AND AVAILABILITY PROTECT YOUR DATA AND SUPPORT BUSINESS FLEXIBILITY WITH FUJITSU STORAGE SOLUTIONS kr.fujitsu.com INDEX 1. Storage System
vm-웨어-앞부속
VMware vsphere 4 This document was created using the official VMware icon and diagram library. Copyright 2009 VMware, Inc. All rights reserved. This product is protected by U.S. and international copyright
0125_ 워크샵 발표자료_완성.key
WordPress is a free and open-source content management system (CMS) based on PHP and MySQL. WordPress is installed on a web server, which either is part of an Internet hosting service or is a network host
CD-RW_Advanced.PDF
HP CD-Writer Program User Guide - - Ver. 2.0 HP CD-RW Adaptec Easy CD Creator Copier, Direct CD. HP CD-RW,. Easy CD Creator 3.5C, Direct CD 3.0., HP. HP CD-RW TEAM ( 02-3270-0803 ) < > 1. CD...3 CD...5
Orcad Capture 9.x
OrCAD Capture Workbook (Ver 10.xx) 0 Capture 1 2 3 Capture for window 4.opj ( OrCAD Project file) Design file Programe link file..dsn (OrCAD Design file) Design file..olb (OrCAD Library file) file..upd
untitled
Push... 2 Push... 4 Push... 5 Push... 13 Push... 15 1 FORCS Co., LTD A Leader of Enterprise e-business Solution Push (Daemon ), Push Push Observer. Push., Observer. Session. Thread Thread. Observer ID.
Solaris Express Developer Edition
Solaris Express Developer Edition : 2008 1 Solaris TM Express Developer Edition Solaris OS. Sun / Solaris, Java, Web 2.0,,. Developer Solaris Express Developer Edition System Requirements. 768MB. SPARC
Service-Oriented Architecture Copyright Tmax Soft 2005
Service-Oriented Architecture Copyright Tmax Soft 2005 Service-Oriented Architecture Copyright Tmax Soft 2005 Monolithic Architecture Reusable Services New Service Service Consumer Wrapped Service Composite
ecorp-프로젝트제안서작성실무(양식3)
(BSC: Balanced ScoreCard) ( ) (Value Chain) (Firm Infrastructure) (Support Activities) (Human Resource Management) (Technology Development) (Primary Activities) (Procurement) (Inbound (Outbound (Marketing
Backup Exec
(sjin.kim@veritas.com) www.veritas veritas.co..co.kr ? 24 X 7 X 365 Global Data Access.. 100% Storage Used Terabytes 9 8 7 6 5 4 3 2 1 0 2000 2001 2002 2003 IDC (TB) 93%. 199693,000 TB 2000831,000 TB.
1217 WebTrafMon II
(1/28) (2/28) (10 Mbps ) Video, Audio. (3/28) 10 ~ 15 ( : telnet, ftp ),, (4/28) UDP/TCP (5/28) centralized environment packet header information analysis network traffic data, capture presentation network
PowerChute Personal Edition v3.1.0 에이전트 사용 설명서
PowerChute Personal Edition v3.1.0 990-3772D-019 4/2019 Schneider Electric IT Corporation Schneider Electric IT Corporation.. Schneider Electric IT Corporation,,,.,. Schneider Electric IT Corporation..
chapter4
Basic Netw rk 1. ก ก ก 2. 3. ก ก 4. ก 2 1. 2. 3. 4. ก 5. ก 6. ก ก 7. ก 3 ก ก ก ก (Mainframe) ก ก ก ก (Terminal) ก ก ก ก ก ก ก ก 4 ก (Dumb Terminal) ก ก ก ก Mainframe ก CPU ก ก ก ก 5 ก ก ก ก ก ก ก ก ก ก
CRM Fair 2004
easycrm Workbench ( ) 2004.04.02 I. CRM 1. CRM 2. CRM 3. II. easybi(business Intelligence) Framework 1. 2. - easydataflow Workbench - easycampaign Workbench - easypivot Reporter. 1. CRM 1.?! 1.. a. & b.
LXR 설치 및 사용법.doc
Installation of LXR (Linux Cross-Reference) for Source Code Reference Code Reference LXR : 2002512( ), : 1/1 1 3 2 LXR 3 21 LXR 3 22 LXR 221 LXR 3 222 LXR 3 3 23 LXR lxrconf 4 24 241 httpdconf 6 242 htaccess
Output file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
10X56_NWG_KOR.indd
디지털 프로젝터 X56 네트워크 가이드 이 제품을 구입해 주셔서 감사합니다. 본 설명서는 네트워크 기능 만을 설명하기 위한 것입니다. 본 제품을 올바르게 사 용하려면 이 취급절명저와 본 제품의 다른 취급절명저를 참조하시기 바랍니다. 중요한 주의사항 이 제품을 사용하기 전에 먼저 이 제품에 대한 모든 설명서를 잘 읽어 보십시오. 읽은 뒤에는 나중에 필요할 때
Intro to Servlet, EJB, JSP, WS
! Introduction to J2EE (2) - EJB, Web Services J2EE iseminar.. 1544-3355 ( ) iseminar Chat. 1 Who Are We? Business Solutions Consultant Oracle Application Server 10g Business Solutions Consultant Oracle10g
15_3oracle
Principal Consultant Corporate Management Team ( Oracle HRMS ) Agenda 1. Oracle Overview 2. HR Transformation 3. Oracle HRMS Initiatives 4. Oracle HRMS Model 5. Oracle HRMS System 6. Business Benefit 7.
04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
The Self-Managing Database : Automatic Health Monitoring and Alerting
The Self-Managing Database : Automatic Health Monitoring and Alerting Agenda Oracle 10g Enterpirse Manager Oracle 10g 3 rd Party PL/SQL API Summary (Self-Managing Database) ? 6% 6% 12% 55% 6% Source: IOUG
강의10
Computer Programming gdb and awk 12 th Lecture 김현철컴퓨터공학부서울대학교 순서 C Compiler and Linker 보충 Static vs Shared Libraries ( 계속 ) gdb awk Q&A Shared vs Static Libraries ( 계속 ) Advantage of Using Libraries Reduced
Assign an IP Address and Access the Video Stream - Installation Guide
설치 안내서 IP 주소 할당 및 비디오 스트림에 액세스 책임 본 문서는 최대한 주의를 기울여 작성되었습니다. 잘못되거나 누락된 정보가 있는 경우 엑시스 지사로 알려 주시기 바랍니다. Axis Communications AB는 기술적 또는 인쇄상의 오류에 대해 책 임을 지지 않으며 사전 통지 없이 제품 및 설명서를 변경할 수 있습니다. Axis Communications
ODS-FM1
OPTICAL DISC ARCHIVE FILE MANAGER ODS-FM1 INSTALLATION GUIDE [Korean] 1st Edition (Revised 4) 상표 Microsoft, Windows 및 Internet Explorer는 미국 및 / 또는 다른 국가에서 Microsoft Corporation 의 등록 상표입 Intel 및 Intel Core
Something that can be seen, touched or otherwise sensed
Something that can be seen, touched or otherwise sensed Things about an object Weight Height Material Things an object does Pen writes Book stores words Water have Fresh water Rivers Oceans have
목차 1. 제품 소개... 4 1.1 특징... 4 1.2 개요... 4 1.3 Function table... 5 2. 기능 소개... 6 2.1 Copy... 6 2.2 Compare... 6 2.3 Copy & Compare... 6 2.4 Erase... 6 2
유영테크닉스( 주) 사용자 설명서 HDD014/034 IDE & SATA Hard Drive Duplicator 유 영 테 크 닉 스 ( 주) (032)670-7880 www.yooyoung-tech.com 목차 1. 제품 소개... 4 1.1 특징... 4 1.2 개요... 4 1.3 Function table... 5 2. 기능 소개... 6 2.1 Copy...
J2EE & Web Services iSeminar
9iAS :, 2002 8 21 OC4J Oracle J2EE (ECperf) JDeveloper : OLTP : Oracle : SMS (Short Message Service) Collaboration Suite Platform Email Developer Suite Portal Java BI XML Forms Reports Collaboration Suite
Microsoft Word - KSR2014S042
2014 년도 한국철도학회 춘계학술대회 논문집 KSR2014S042 안전소통을 위한 모바일 앱 서비스 개발 Development of Mobile APP Service for Safety Communication 김범승 *, 이규찬 *, 심재호 *, 김주희 *, 윤상식 **, 정경우 * Beom-Seung Kim *, Kyu-Chan Lee *, Jae-Ho
슬라이드 1
웹 2.0 분석보고서 Year 2006. Month 05. Day 20 Contents 1 Chapter 웹 2.0 이란무엇인가? 웹 2.0 의시작 / 웹 1.0 에서웹 2.0 으로 / 웹 2.0 의속성 / 웹 2.0 의영향 Chapter Chapter 2 3 웹 2.0 을가능케하는요소 AJAX / Tagging, Folksonomy / RSS / Ontology,
ETL_project_best_practice1.ppt
ETL ETL Data,., Data Warehouse DataData Warehouse ETL tool/system: ETL, ETL Process Data Warehouse Platform Database, Access Method Data Source Data Operational Data Near Real-Time Data Modeling Refresh/Replication
02 C h a p t e r Java
02 C h a p t e r Java Bioinformatics in J a va,, 2 1,,,, C++, Python, (Java),,, (http://wwwbiojavaorg),, 13, 3D GUI,,, (Java programming language) (Sun Microsystems) 1995 1990 (green project) TV 22 CHAPTER
1.장인석-ITIL 소개.ppt
HP 2005 6 IT ITIL Framework IT IT Framework Synchronized Business and IT Business Information technology Delivers: Simplicity, Agility, Value IT Complexity Cost Scale IT Technology IT Infrastructure IT
Web Application Hosting in the AWS Cloud Contents 개요 가용성과 확장성이 높은 웹 호스팅은 복잡하고 비용이 많이 드는 사업이 될 수 있습니다. 전통적인 웹 확장 아키텍처는 높은 수준의 안정성을 보장하기 위해 복잡한 솔루션으로 구현
02 Web Application Hosting in the AWS Cloud www.wisen.co.kr Wisely Combine the Network platforms Web Application Hosting in the AWS Cloud Contents 개요 가용성과 확장성이 높은 웹 호스팅은 복잡하고 비용이 많이 드는 사업이 될 수 있습니다. 전통적인
AGENDA 01 02 03 모바일 산업의 환경변화 모바일 클라우드 서비스의 등장 모바일 클라우드 서비스 융합사례
모바일 클라우드 서비스 융합사례와 시장 전망 및 신 사업전략 2011. 10 AGENDA 01 02 03 모바일 산업의 환경변화 모바일 클라우드 서비스의 등장 모바일 클라우드 서비스 융합사례 AGENDA 01. 모바일 산업의 환경 변화 가치 사슬의 분화/결합 모바일 업계에서도 PC 산업과 유사한 모듈화/분업화 진행 PC 산업 IBM à WinTel 시대 à
Copyright 2004 Sun Microsystems, Inc Network Circle, Santa Clara, CA U.S.A..,,. Sun. Sun. Berkeley BSD. UNIX X/Open Company, Ltd.. Sun, Su
Java Desktop System 2 Sun Microsystems, Inc. 4150 Network Circle Santa Clara, CA 95054 U.S.A. : 817 7757 10 2004 9 Copyright 2004 Sun Microsystems, Inc. 4150 Network Circle, Santa Clara, CA 95054 U.S.A..,,.
bn2019_2
arp -a Packet Logging/Editing Decode Buffer Capture Driver Logging: permanent storage of packets for offline analysis Decode: packets must be decoded to human readable form. Buffer: packets must temporarily
목차 개요 3 섹션 1: 해결 과제 4 APT(지능형 지속 위협): 이전과 다른 위협 섹션 2: 기회 7 심층 방어 섹션 3: 이점 14 위험 감소 섹션 4: 결론 14 섹션 5: 참조 자료 15 섹션 6: 저자 소개 16 2
백서 표적 공격 2012년 7월 APT(지능형 지속 위협) 차단을 위한 전면적인 철저한 방어 Russell Miller CA Technologies 보안 관리 사업부 agility made possible 목차 개요 3 섹션 1: 해결 과제 4 APT(지능형 지속 위협): 이전과 다른 위협 섹션 2: 기회 7 심층 방어 섹션 3: 이점 14 위험 감소 섹션
example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
ARMBOOT 1
100% 2003222 : : : () PGPnet 1 (Sniffer) 1, 2,,, (Sniffer), (Sniffer),, (Expert) 3, (Dashboard), (Host Table), (Matrix), (ART, Application Response Time), (History), (Protocol Distribution), 1 (Select
Remote UI Guide
Remote UI KOR Remote UI Remote UI PDF Adobe Reader/Adobe Acrobat Reader. Adobe Reader/Adobe Acrobat Reader Adobe Systems Incorporated.. Canon. Remote UI GIF Adobe Systems Incorporated Photoshop. ..........................................................
<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
PRO1_04E [읽기 전용]
![PRO1_04E [읽기 전용]](/thumbs/91/104875613.jpg "PRO1_04E [읽기 전용]")
Siemens AG 1999 All rights reserved File: PRO1_04E1 Information and S7-300 2 S7-400 3 EPROM / 4 5 6 HW Config 7 8 9 CPU 10 CPU : 11 CPU : 12 CPU : 13 CPU : / 14 CPU : 15 CPU : / 16 HW 17 HW PG 18 SIMATIC
MAX+plus II Getting Started - 무작정따라하기
무작정 따라하기 2001 10 4 / Version 20-2 0 MAX+plus II Digital, Schematic Capture MAX+plus II, IC, CPLD FPGA (Logic) ALTERA PLD FLEX10K Series EPF10K10QC208-4 MAX+plus II Project, Schematic, Design Compilation,
PowerPoint 프레젠테이션
Web Browser Web Server ( ) MS Explorer 5.0 WEB Server MS-SQL HTML Image Multimedia IIS Application Web Server ASP ASP platform Admin Web Based ASP Platform Manager Any Platform ASP : Application Service
SchoolNet튜토리얼.PDF
Interoperability :,, Reusability: : Manageability : Accessibility :, LMS Durability : (Specifications), AICC (Aviation Industry CBT Committee) : 1988, /, LMS IMS : 1997EduCom NLII,,,,, ARIADNE (Alliance
Analyst Briefing
. Improve your Outlook on Email and File Management iseminar.. 1544(or 6677)-3355 800x600. iseminar Chat... Improve your Outlook on Email and File Management :, 2003 1 29.. Collaboration Suite - Key Messages
초보자를 위한 C++
C++. 24,,,,, C++ C++.,..,., ( ). /. ( 4 ) ( ).. C++., C++ C++. C++., 24 C++. C? C++ C C, C++ (Stroustrup) C++, C C++. C. C 24.,. C. C+ +?. X C++.. COBOL COBOL COBOL., C++. Java C# C++, C++. C++. Java C#
SMB_ICMP_UDP(huichang).PDF
SMB(Server Message Block) UDP(User Datagram Protocol) ICMP(Internet Control Message Protocol) SMB (Server Message Block) SMB? : Microsoft IBM, Intel,. Unix NFS. SMB client/server. Client server request
06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
Microsoft PowerPoint Android-SDK설치.HelloAndroid(1.0h).pptx
To be an Android Expert 문양세강원대학교 IT 대학컴퓨터학부 Eclipse (IDE) JDK Android SDK with ADT IDE: Integrated Development Environment JDK: Java Development Kit (Java SDK) ADT: Android Development Tools 2 JDK 설치 Eclipse
untitled
3 IBM WebSphere User Conference ESB (e-mail : ljm@kr.ibm.com) Infrastructure Solution, IGS 2005. 9.13 ESB 를통한어플리케이션통합구축 2 IT 40%. IT,,.,, (Real Time Enterprise), End to End Access Processes bounded by
감각형 증강현실을 이용한
대한산업공학회/한국경영과학회 2012년 춘계공동학술대회 감각형 증강현실을 이용한 전자제품의 디자인 품평 문희철, 박상진, 박형준 * 조선대학교 산업공학과 * 교신저자, hzpark@chosun.ac.kr 002660 ABSTRACT We present the recent status of our research on design evaluation of digital
<31332DB9E9C6AEB7A2C7D8C5B72D3131C0E528BACEB7CF292E687770>
보자. 이제 v4.6.2-1 로업데이트됐다. 그림 F-15의하단처럼 msfupdate를입력해 root @bt:~# msfudpate 그림 F-16 과같이정상적으로업데이트가진행되는것을볼수있다. 이후에는 msfupdate를입력하면최신업데이트모듈과공격코드를쉽게유지할수있다. 그림 F-16 msfupdate의진행확인 G. SET 업데이트문제해결 백트랙을기본설치로운영을할때에는
Sena Technologies, Inc. HelloDevice Super 1.1.0
HelloDevice Super 110 Copyright 1998-2005, All rights reserved HelloDevice 210 ()137-130 Tel: (02) 573-5422 Fax: (02) 573-7710 E-Mail: support@senacom Website: http://wwwsenacom Revision history Revision
Voice Portal using Oracle 9i AS Wireless
Voice Portal Platform using Oracle9iAS Wireless 20020829 Oracle Technology Day 1 Contents Introduction Voice Portal Voice Web Voice XML Voice Portal Platform using Oracle9iAS Wireless Voice Portal Video
PowerPoint 프레젠테이션
Synergy EDMS www.comtrue.com opyright 2001 ComTrue Technologies. All right reserved. - 1 opyright 2001 ComTrue Technologies. All right reserved. - 2 opyright 2001 ComTrue Technologies. All right reserved.
PRO1_02E [읽기 전용]
![PRO1_02E [읽기 전용]](/thumbs/90/102160748.jpg "PRO1_02E [읽기 전용]")
Siemens AG 1999 All rights reserved File: PRO1_02E1 Information and 2 STEP 7 3 4 5 6 STEP 7 7 / 8 9 10 S7 11 IS7 12 STEP 7 13 STEP 7 14 15 : 16 : S7 17 : S7 18 : CPU 19 1 OB1 FB21 I10 I11 Q40 Siemens AG
HTML5가 웹 환경에 미치는 영향 고 있어 웹 플랫폼 환경과는 차이가 있다. HTML5는 기존 HTML 기반 웹 브라우저와의 호환성을 유지하면서도, 구조적인 마크업(mark-up) 및 편리한 웹 폼(web form) 기능을 제공하고, 리치웹 애플리케이 션(RIA)을
동 향 제 23 권 5호 통권 504호 HTML5가 웹 환경에 미치는 영향 이 은 민 * 16) 1. 개 요 구글(Google)은 2010년 5월 구글 I/O 개발자 컨퍼런스에서 HTML5를 통해 플러 그인의 사용이 줄어들고 프로그램 다운로드 및 설치가 필요 없는 브라우저 기반 웹 플랫폼 환경이 점차 구현되고 있다고 강조했다. 그리고 애플(Apple)은 2010년
학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
Social Network
Social Network Service, Social Network Service Social Network Social Network Service from Digital Marketing Internet Media : SNS Market report A social network service is a social software specially focused
05Àå
CHAPTER 05 NT,, XP,. NT NTFS, XP. D,,. XP x NT,,, ( x, x ). NT/ /XP,.. PC NT NT. + Guide to Software: Understanding and Installing Windows 2000 and Windows NT + SOFTWARE Guide to Software 3/e SOFTWARE
04_오픈지엘API.key
4. API. API. API..,.. 1 ,, ISO/IEC JTC1/SC24, Working Group ISO " (Architecture) " (API, Application Program Interface) " (Metafile and Interface) " (Language Binding) " (Validation Testing and Registration)"
PowerPoint 프레젠테이션
Deep Learning 작업환경조성 & 사용법 ISL 안재원 Ubuntu 설치 작업환경조성 접속방법 사용예시 2 - ISO file Download www.ubuntu.com Ubuntu 설치 3 - Make Booting USB Ubuntu 설치 http://www.pendrivelinux.com/universal-usb-installer-easy-as-1-2-3/
Cloud Friendly System Architecture
-Service Clients Administrator 1. -Service 구성도 : ( 좌측참고 ) LB(LoadBlancer) 2. -Service 개요 ucloud Virtual Router F/W Monitoring 개념 특징 적용가능분야 Server, WAS, DB 로구성되어 web service 를클라우드환경에서제공하기위한 service architecture
K7VT2_QIG_v3
1......... 2 3..\ 4 5 [R] : Enter Raid setup utility 6 Press[A]keytocreateRAID RAID Type: JBOD RAID 0 RAID 1: 2 7 " RAID 0 Auto Create Manual Create: 2 RAID 0 Block Size: 16K 32K
SK IoT IoT SK IoT onem2m OIC IoT onem2m LG IoT SK IoT KAIST NCSoft Yo Studio tidev kr 5 SK IoT DMB SK IoT A M LG SDS 6 OS API 7 ios API API BaaS Backend as a Service IoT IoT ThingPlug SK IoT SK M2M M2M
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
thesis
( Design and Implementation of a Generalized Management Information Repository Service for Network and System Management ) ssp@nile nile.postech.ac..ac.kr DPE Lab. 1997 12 16 GMIRS GMIRS GMIRS prototype
Sun Java System Messaging Server 63 64
Sun Java System Messaging Server 6.3 64 Sun Java TM System Communications Suite Sun Microsystems, Inc. 4150 Network Circle Santa Clara, CA 95054 U.S.A. : 820 2868 2007 7 Copyright 2007 Sun Microsystems,
IPAK 윤리강령 나는 _ 한국IT전문가협회 회원으로서 긍지와 보람을 느끼며 정보시스템 활용하 자. 나는 _동료, 단체 및 국가 나아가 인류사회에 대하여 철저한 책임 의식을 가진 다. 나는 _ 활용자에 대하여 그 편익을 증진시키는데 최선을 다한다. 나는 _ 동료에 대해
IPAK 윤리강령 나는 _ 한국IT전문가협회 회원으로서 긍지와 보람을 느끼며 정보시스템 활용하 자. 나는 _동료, 단체 및 국가 나아가 인류사회에 대하여 철저한 책임 의식을 가진 다. 나는 _ 활용자에 대하여 그 편익을 증진시키는데 최선을 다한다. 나는 _ 동료에 대해서 도의와 성실과 지식을 바탕으로 서로 우애하고 경애한다. 나는 _ 단체와 국가에 대해서 그
Copyright 2012, Oracle and/or its affiliates. All rights reserved.,.,,,,,,,,,,,,.,...,. U.S. GOVERNMENT END USERS. Oracle programs, including any oper
Windows Netra Blade X3-2B( Sun Netra X6270 M3 Blade) : E37790 01 2012 9 Copyright 2012, Oracle and/or its affiliates. All rights reserved.,.,,,,,,,,,,,,.,...,. U.S. GOVERNMENT END USERS. Oracle programs,
Intra_DW_Ch4.PDF
The Intranet Data Warehouse Richard Tanler Ch4 : Online Analytic Processing: From Data To Information 2000. 4. 14 All rights reserved OLAP OLAP OLAP OLAP OLAP OLAP is a label, rather than a technology
1
1 1....6 1.1...6 2. Java Architecture...7 2.1 2SDK(Software Development Kit)...8 2.2 JRE(Java Runtime Environment)...9 2.3 (Java Virtual Machine, JVM)...10 2.4 JVM...11 2.5 (runtime)jvm...12 2.5.1 2.5.2
°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
13 Who am I? R&D, Product Development Manager / Smart Worker Visualization SW SW KAIST Software Engineering Computer Engineering 3
13 Lightweight BPM Engine SW 13 Who am I? R&D, Product Development Manager / Smart Worker Visualization SW SW KAIST Software Engineering Computer Engineering 3 BPM? 13 13 Vendor BPM?? EA??? http://en.wikipedia.org/wiki/business_process_management,
슬라이드 1
Pairwise Tool & Pairwise Test NuSRS 200511305 김성규 200511306 김성훈 200614164 김효석 200611124 유성배 200518036 곡진화 2 PICT Pairwise Tool - PICT Microsoft 의 Command-line 기반의 Free Software www.pairwise.org 에서다운로드후설치
chapter1,2.doc
JavaServer Pages Version 08-alpha copyright2001 B l u e N o t e all rights reserved http://jspboolpaecom vesion08-alpha, UML (?) part1part2 Part1 part2 part1 JSP Chapter2 ( ) Part 1 chapter 1 JavaServer
클라우드컴퓨팅확산에따른국내경제시사점 클라우드컴퓨팅확산에따른국내경제시사점 * 1) IT,,,, Salesforce.com SaaS (, ), PaaS ( ), IaaS (, IT ), IT, SW ICT, ICT IT ICT,, ICT, *, (TEL)
클라우드컴퓨팅확산에따른국내경제시사점 클라우드컴퓨팅확산에따른국내경제시사점 * 1) IT,,,, Salesforce.com SaaS (, ), PaaS ( ), IaaS (, IT ), IT, SW ICT, ICT IT ICT,, ICT, *, (TEL) 02-570-4352 (e-mail) jjoon75@kisdi.re.kr 1 The Monthly Focus.
, N-. N- DLNA(Digital Living Network Alliance).,. DLNA DLNA. DLNA,, UPnP, IPv4, HTTP DLNA. DLNA, DLNA [1]. DLNA DLNA DLNA., [2]. DLNA UPnP. DLNA DLNA.
![, N-. N- DLNA(Digital Living Network Alliance).,. DLNA DLNA. DLNA,, UPnP, IPv4, HTTP DLNA. DLNA, DLNA [1]. DLNA DLNA DLNA., [2]. DLNA UPnP. DLNA DLNA.](/thumbs/90/102511563.jpg ", N-. N- DLNA(Digital Living Network Alliance).,. DLNA DLNA. DLNA,, UPnP, IPv4, HTTP DLNA. DLNA, DLNA [1]. DLNA DLNA DLNA., [2]. DLNA UPnP. DLNA DLNA.")
http://dx.doi.org/10.5909/jeb.2012.17.1.37 DLNA a), a), a) Effective Utilization of DLNA Functions in Home Media Devices Ki Cheol Kang a), Se Young Kim a), and Dae Jin Kim a) DLNA(Digital Living Network
Open Cloud Engine Open Source Big Data Platform Flamingo Project Open Cloud Engine Flamingo Project Leader 김병곤
Open Cloud Engine Open Source Big Data Platform Flamingo Project Open Cloud Engine Flamingo Project Leader 김병곤 (byounggon.kim@opence.org) 빅데이터분석및서비스플랫폼 모바일 Browser 인포메이션카탈로그 Search 인포메이션유형 보안등급 생성주기 형식
Special Theme _ 모바일웹과 스마트폰 본 고에서는 모바일웹에서의 단말 API인 W3C DAP (Device API and Policy) 의 표준 개발 현황에 대해서 살펴보고 관 련하여 개발 중인 사례를 통하여 이해를 돕고자 한다. 2. 웹 애플리케이션과 네이
모바일웹 플랫폼과 Device API 표준 이강찬 TTA 유비쿼터스 웹 응용 실무반(WG6052)의장, ETRI 선임연구원 1. 머리말 현재 소개되어 이용되는 모바일 플랫폼은 아이폰, 윈 도 모바일, 안드로이드, 심비안, 모조, 리모, 팜 WebOS, 바다 등이 있으며, 플랫폼별로 버전을 고려하면 그 수 를 열거하기 힘들 정도로 다양하게 이용되고 있다. 이
歯CRM개괄_허순영.PDF
CRM 2000. 8. KAIST CRM CRM CRM CRM :,, KAIST : 50%-60%, 20% 60%-80%. AMR Research 10.. CRM. 5. Harvard Business review 60%, 13%. Michaelson & Associates KAIST CRM? ( ),,, -,,, CRM needs,,, dynamically
OZ-LMS TM OZ-LMS 2008 OZ-LMS 2006 OZ-LMS Lite Best IT Serviece Provider OZNET KOREA Management Philosophy & Vision Introduction OZNETKOREA IT Mission Core Values KH IT ERP Web Solution IT SW 2000 4 3 508-2
GEAR KOREA
GEAR Original Equipment Manufacturing Gears Support your various needs with our world class engineering skill and the newest manufacturing facilities. 1 2 Nissei creates high-quality high-precision gears
소프트웨어개발방법론
사용사례 (Use Case) Objectives 2 소개? (story) vs. 3 UC 와 UP 산출물과의관계 Sample UP Artifact Relationships Domain Model Business Modeling date... Sale 1 1..* Sales... LineItem... quantity Use-Case Model objects,
歯I-3_무선통신기반차세대망-조동호.PDF
KAIST 00-03-03 / #1 1. NGN 2. NGN 3. NGN 4. 5. 00-03-03 / #2 1. NGN 00-03-03 / #3 1.1 NGN, packet,, IP 00-03-03 / #4 Now: separate networks for separate services Low transmission delay Consistent availability
Domino Designer Portal Development tools Rational Application Developer WebSphere Portlet Factory Workplace Designer Workplace Forms Designer
Domino, Portal & Workplace WPLC FTSS Domino Designer Portal Development tools Rational Application Developer WebSphere Portlet Factory Workplace Designer Workplace Forms Designer ? Lotus Notes Clients
Analytics > Log & Crash Search > Unity ios SDK [Deprecated] Log & Crash Unity ios SDK. TOAST SDK. Log & Crash Unity SDK Log & Crash Search. Log & Cras
![Analytics > Log & Crash Search > Unity ios SDK [Deprecated] Log & Crash Unity ios SDK. TOAST SDK. Log & Crash Unity SDK Log & Crash Search. Log & Cras](/thumbs/101/151500399.jpg "Analytics > Log & Crash Search > Unity ios SDK [Deprecated] Log & Crash Unity ios SDK. TOAST SDK. Log & Crash Unity SDK Log & Crash Search. Log & Cras")
Analytics > Log & Crash Search > Unity ios SDK [Deprecated] Log & Crash Unity ios SDK. TOAST SDK. Log & Crash Unity SDK Log & Crash Search. Log & Crash Unity SDK... Log & Crash Search. - Unity3D v4.0 ios
PowerPoint 프레젠테이션
EBC (Equipment Behaviour Catalogue) - ISO TC 184/SC 5/SG 4 신규표준이슈 - 한국전자통신연구원김성혜 목차 Prologue: ISO TC 184/SC 5 그룹 SG: Study Group ( 표준이슈발굴 ) WG: Working Group ( 표준개발 ) 3 EBC 배경 제안자 JISC (Japanese Industrial