untitled
|
|
- 다해 위
- 5 years ago
- Views:
Transcription
1 원 저 J Korean Neurol Assoc / Volume 22 / June, 2004 Cx32 유전자돌연변이를보인 CMTX 와 PMP22 유전자중복을보인 CMT1A 환자들의임상및전기생리학적특성비교 이화여자대학교의과대학신경과학교실, 공주대학교생명과학과 *, 연세대학교의과대학신경과학교실 최병옥정기화 * 박기덕김승민 신상희 * 선우일남 Comparison of Clinical and Electrophysiological Characteristics between CMTX with Cx32 Missense Mutation and CMT1A with PMP22 Duplication Byung-Ok Choi, M.D., Ki Wha Chung, Ph.D.*, Kee Duk Park, M.D., Seung-Min Kim, M.D., Sang Hee Shin*, Il Nam Sunwoo, M.D. Department of Neurology, Ewha Womans University College of Medicine, Seoul; Department of Biological Science, Kongju National University*, Gongju; Department of Neurology, Yonsei University College of Medicine, Seoul, Korea Background: Charcot-Marie-Tooth (CMT) disease is a clinically and genetically heterogeneous disorder. Connexin32 (Cx32) gene mutations on Xq13.1 cause the X-linked form of CMT disease, and PMP22 gene duplication on 17p11.2-p12 causes CMT1A. The aim of the present study is to determine the clinical and electrophysiological characteristics between X-linked CMT patients with Cx32 missense mutations and CMT1A patients with PMP22 duplications. Methods: We screened for 17p11.2-p12 duplication, and for point mutations in Cx32 genes of 48 Korean CMT families. Both neurological examination and nerve conduction studies were performed in all patients. Results: Frequency of CMTX (6.3%) in our study was similar to Japanese, and was lower than those in European peoples. CMTX patients displayed man-to-man transmission, and had cranial nerve involvement. CMTX patients showed more wide range of motor and sensory nerve conduction velocities than CMT1A patients. We found one family with axonal neuropathy and two families with demyelinating neuropathy in CMTX patients. Conclusions: Our findings suggest that mutations in Cx32 are probably less frequent in Asian CMT patients than European patients, and CMTX neuropathy is intermediary between CMT1 and CMT2. In addition, inheritance pattern and cranial nerve involvement are useful in differentiating CMTX from CMT1A with duplication. J Korean Neurol Assoc 22(3):226~234, 2004 Key Words: Charcot-Marei-Tooth disease, Cx32, PMP22, CMTX, Mutation 서론 Received October 1, 2003 Accepted January 15, 2004 *Address for correspondence Il Nam Sunwoo, M.D. Department of Neurology, Yonsei University College of Medicine C.P.O. Box 8044, Seoul, Korea Tel: Fax: neuro@yumc.yonsei.ac.kr * 본논문은 2003년도한국학술진흥재단의지원에의하여연구되었음 (KRF E00179). Charcot-Marie-Tooth (CMT) 질환은유전학적으로뿐만아니라임상적, 전기생리학적으로상당히이질적이다. 1 CMT1A 는 CMT 중에서가장높은비율을차지하며, 말초신경수초단백질을만드는데관여하는 PMP22 (peripheral myelin protein 22) 유전자를포함하는염색체 17p11.2-p12 의중복 (duplication) 이원인으로알려져있다. 2 CMT1A 다음으로높은빈도를차지하는것은 226
2 Cx32 유전자돌연변이를보인 CMTX 와 PMP22 유전자중복을보인 CMT1A 환자들의임상및전기생리학적특성비교 간극결합 (gap junction) 을형성하는 connexin32 (Cx32; gap junction protein β1, GJB1) 유전자의점상돌연변이에의해발생하는 X-linked Charcot-Marie-Tooth (CMTX) 질환으로 1889 년 Herringham 3 에의해처음으로보고되었고, 1993 년에 Bergoffen 등 4 에의해유전자변이가보고되었다. CMTX 는유전자변이가 X 염색체에위치하므로아버지에서아들로는유전되지않으며, 남자는여자환자보다신경전도속도의저하및임상양상이심하다는특징이있다. 5,6 또한 CMTX 질환이근본적으로축삭형신경병증 (axonal neuropathy) 인지혹은탈수초성신경병증 (demyelinating neuropathy) 인지에대해서는서로다른의견들이존재하고있다. 7,8 아직까지우리나라 CMT1A 와 CMTX 환자들을대상으로특성을비교한논문은없었다. 이에저자들은임상적진찰소견및전기생리학적검사상 CMT 로진단된 48 가족을대상으로하여유전자검사를하였고, 이들중 Cx32 유전자의과오돌연변이 (missense mutation) 가발견된 CMTX 환자들과 PMP22 유전자의중복이확인된 CMT1A 환자들을대상으로하여임상및전기생리학적특성들을비교해보고자하였다. 대상과방법 1. 대상 신경학적진찰소견, 전기생리학적검사및비복신경조직검사등을하여 CMT 으로진단된 48 가족 (207 명의한국인환자및가족구성원 ) 을대상으로하였다. 이들중상염색체우성유전을하며전기생리학적검사소견상정중신경의전도속도가 38 m/s 이하인 CMT 1 형은 23 가족, 상염색체우성유전을하며정중신경의전도속도가 38 m/s 이상인 CMT 2 형은 14 가족, Dejerine- Sottas syndrome 으로생각되고태생시부터증상이시작되었으며정중신경의전도속도가 8 m/s 이하인 CMT 3 형은 3 가족, 상염색체열성유전을하는 CMT 4 형 3 가족, 그리고 X 염색체우성유전을하는 CMTX 는 3 가족이었으며명확하게분류하기어려운경우가 2 가족이있었다. 정상대조군으로는임상소견및전기생리학적검사상 CMT 에합당한신경병증의소견이없으면서동시에 CMT 의가족력이없는 105 명 ( 남자 43 명, 여자 62 명 ) 을선택하여대조군으로하였다. 임상양상을비교하기위해서발병연령, 질병기간, CMT 로인한기능저하척도 (functional disability scale; FDS), 근육위축, 발모양변형, 척추측만증등을조사하였다. 발병연령은운동이나감각의저하, 혹은발모양변형등, CMT 의증상이처음으로나타났던시기로하였으며, 질병기간은환자가병원을방문한시점과발병연령사이의기간으로하였다. 저자들은 CMTX 의심한정도를측정하기위하여 9 단계로된기능저하척도를사용하였는데기준은다음과같다. 7 0; 정상, 1; 정상이지만피로감이나통증이있는경우 (rmal but with cramps and fatigability), 2; 달리기를할수없는경우 (inability to run), 3; 걷기가어렵지만도움없이걷는것이가능한경우 (walking difficulty but still possible unaided), 4; 지팡이를가지고걸을수있는경우 (walk with cane), 5; 목발을가지고걸을수있는경우 (walk with crutches), 6; 보조기를착용하고걸을수있는경우 (walk with a walker), 7; 휠체어를타고다녀야하는경우 (wheelchair bound), 8; 누워서생활하는경우 (bedridden). 모든연구대상에대해서는면접을하고본질환에대하여충분히설명하였으며유전자검사에대한동의를구하였다. 동의한환자및가족구성원들과정상대조군들을대상으로채혈을통한유전자검사를하였다. 2. 전기생리학적검사 모든연구대상에서정중신경, 척골신경의운동및감각신경과비골신경, 후경골신경의운동신경, 비복신경의감각신경을검사하였다. 청각장애가의심되는모든환자들을대상으로전정신경의이상유무를검사하기위하여뇌간청각유발전위검사 (brainstem auditory evoked potential; BAEP) 를하였다. 또한안면마비증상을보인환자를대상으로안면신경전도검사및순목반사 (blink reflex) 를하였다. 3. PMP22 유전자중복검사 CMT 가계의환자및가족구성원들과정상대조군들로부터말초혈액 10 ml를 EDTA가처치된튜브에모은후, DNA 정제장치 (Promega, USA) 를사용하여 geme DNA를추출하였다. 추출된환자및가족의 gemic DNA에서염색체 17p 부위에위치하며 short tandem repeats polymorphism을보이는 marker 를사용하여유전자형의중복여부를검사하였다 (Table 1). PCR은 32-P- labelled primer 및 antisense primer 각 20 pmole, 1X PCR buffer, dntp 250 µm, template 50 ng, Taq polymerase (Takara) 1 unit를첨가하였으며최종부피는 25 µl로하였다. PCR program 은 7분간의 initial denaturation후, 94 에서 1분, 60 에서 1분, 72 에서 30초로하여 35회반복하였다. 반응이끝난후, PCR 산물의 2 µl를취해 gel loading buffer 1 µl를첨가하여 6% acrylamide/8m urea denaturation gel에 35 watt로약 2시간 30분간전기영동하였다. 전기영동이끝난후 gel을 15% acetic acid 용액에서고정한후헤어드라이어로건조시키고 X-ray 필름을붙여 -70 에서약 12~15시간노출시킨다음이를현상하여결과를판독하였다. 22 권 3 호대한신경과학회지 227
3 최병옥정기화박기덕김승민신상희선우일남 Table 1. Microsatellite markers and PCR conditions used for the analysis of CMT patients with chromosome 17p11.2-p12 duplication Marker PCR condition Name (Locus) Map* (cm) Duplex PCR Size (bp) Temp ( ) Primer sequences (5' 3') D17S I F: GTGTTGTATTAGGCAGAGTTCTCC R: CACCATAATCATGTCAGACAATCC D17S II F: GGTTGGGTGTCCTTGGCCTAC R: ACTGGTGCATCCATGAGCATGC D17S F: AGCACCATGCCGGGCCACAC R: AGATGGATAAGATGATCATGTTAC D17S II F: CAACAACAGCGAAACTCTGTCTC R: AGACCCTGGAAGATCAACTACC D17S122 I F: AGAACCACAAAAATGTCTTGCATTC R: GGCCAGACAGACCAGGCTCTGC D17S F: CTAGGCACTGAAGCCAGGAAG R: TTCTGGAAACCTACTCCTGAGC *Marshfield's genetic distance (centi-morgan from the end of short arm). Table 2. Primer sequences for PCR amplification of Connexin32 gene Exons Primers Sequences (5' 3') Promoter P1 and exon 1A Promoter P2 and exon 1B Exon 2 Cx1AF Cx1AR Cx1BF Cx1BR Cx2AF Cx2AR Cx2BF Cx2BR Cx2CF Cx2CR GCAGCTTGCCCGCACTGTGGATC CCGGCCCACTGTGCCACATCAGC TCCCCTCTTCACATCCACCT GCTCCTTAACTCCAGACCTG CTACTGGCTCTTGGAAGAGTTGA TGCTGGTGAGCCACGTGCATGGC TGTGGTCCCTGCAGCTCATCCTA CGGATGATGAGGTACACCACCTC CTTCACCGTCTTCATGCTAGCTG AGGCAGAGGCCTGTGCACCGGCA BigDye Terminator Cycle Sequencing Kit 를이용하여양방향의염기서열을결정하고, 서열의판독은 CHROMAS (Ver. 2.23) 프로그램을이용하였다. 여자환자에서우성돌연변이는정상서열 (wild allele) 과돌연변이서열 (mutant allele) 이혼합되어있어염기서열판독상의오류를범할수있으므로, 새로운변이가관찰된해당 DNA 단편을 TA PCR 클로닝벡터 (Promega, USA) 에삽입시킨후 10 개이상의독립적콜로니로부터추출된플라스미드의 DNA 단편의염기서열을분석하여정상서열과돌연변이서열이모두검출되는지를재확인하였다. 결과 4. Cx32 유전자 sequencing Cx32 유전자의돌연변이를관찰하기위해서 Cx32 유전자의 promoter (P1 및 P2), exon 및인접 intron 부위를 PCR 방법으로증폭한후, sequencing 을하여구체적인돌연변이를검색하였다. Cx32 유전자의해당부위를증폭하기위한 PCR 반응은주형 DNA 30~50 ng, 각 primer 10 pmol, dntps 200 µm, MgCl mm, Taq polymerase 0.5 unit 및 1X reaction buffer (Promega, USA) 가포함된 50 µl 의반응용액을이용하여 PCR 증폭장치 (Perkin Elmer PE2700, USA) 에서 32 회싸이클링으로실시하였다. 각부위의 PCR 을위해사용된 primer 는 Table 2 와같다. PCR 실시후증폭된 DNA 는정제한후자동염기서열분석기 (ABI 3700, USA) 에서 1. 유전자검사 신경학적진찰소견및전기생리학적검사상 CMT 질환으로진단된 48 가족 207 명과정상대조군 105 명을대상으로하여 PMP22 유전자와 Cx32 유전자의돌연변이에대한분석을실시하였다. PMP22 유전자의중복은 13 가족 34 명에서확인할수있었다. 그리고 1 가족에서 PMP22 유전자의새로운 (vel) 점상돌연변이를발견하여 CMT1A 로진단할수있었으나중복변이가아니므로이번분석에서는제외하였다 (unpublished data). PMP22 유전자의중복이있는경우는 CMT 1 형환자 23 가족중의 57% 에해당하였다. CMT1A 환자가족 (Family ID: FC-9) 의예를 Fig. 1 에서보여주고있다. 환자 (II-5: 화살표로표시 ) 에서 short tandem repeats polymorphism 을보이는 6 개 marker 를사용한이형성 228
4 Cx32 유전자돌연변이를보인 CMTX 와 PMP22 유전자중복을보인 CMT1A 환자들의임상및전기생리학적특성비교 Figure 1. Pedigree of a CMT1A family (family ID; FC-59) with PMP22 duplication in chromosome 17p11.2-p12. The open symbols stand for unaffected males ( ) and unaffected females ( ). The filled symbols represent affected males ( ) and affected females ( ). The symbols ( ) indicate persons whose DNA is used for the analysis with 6 microsatellites. Alleles of the individuals within parentheses are inferred. The arrow indicates the proband. The duplication of the six-marker region responsible for CMT1A is indicated by the shadowed box. 단형 (hemizygous haplotype) 은 2/5 (D17S921) - 2/4 (D17S955) - 1/2 (D17S1358) - 9/10 (D17S839) - 11/12 (D17S122) - 5/5 (D17S261) 였으며그의둘째아들 (III-4) 로전달되었으며, 이가족에서환자인구성원 (I-2, II-3, II-11) 에서모두관찰되었고, 환자가아닌경우 (II-6, II-13, III-3) 에는관찰되지않았다. Cx32 유전자의과오돌연변이 (missense mutation) 가 3 가족 (6.3%) 에서발견되었다. 이와함께무증상돌연변이 (silent mutation) 를가진경우도 3 가족에서발견되었다 (Table 3). 저자들이발견한돌연변이인 Val136Ala 은 X 염색체상의 Cx32 유전자의 2 번째 exon 의 136 번단백질을합성하는부분에서 GTC 가 GCC 로변하여발린 (valine; Val) 이알라닌 (alanine; Ala) 으로치환된것을확인하여진단할수있었다. 9 Arg164Gln 은 164 번째단백질을합성하는부분에서 CGG 가 CAG 로변하여아르기닌 (arginine; Arg) 이글루타민 (glutamine; Gln) 으로치환된것을확인하여진단할수있었다 (Fig. 2). 그리고 Cys168Arg 은 X 염색체상의 Cx32 유전자의 168 번단백질을합성하는부분에서 TGC 가 CGC 로변하여시스테인 (cysteine; Cys) 이아르기닌 (arginine; Arg) 으로치환된것을확인하여 CMTX 로진단할수있었다. 10 무증상돌연변이는 Leu10Leu 과 Ser198Ser 으로각각 CTC 가 CTT 로치환되고 TCT 가 TCA 로치환된것을확인할수있었다. 위 의모든경우에정상대조군인남자 53 명과여자 62 명을대상으로같은돌연변이부위에대하여검사하였으나이상이있는경우는한예도없었다. 돌연변이판정의정확성을기하기위하여 PCR 산물을 TA 벡터에삽입한후염기서열을알아보는이중검증을실시하였는데, 4 개의클론이모두돌연변이형을보여해당과오돌연변이및무증상돌연변이의상태를재확인하였다. 그리고한국인환자들을대상으로 Cx32 유전자검사를하였을때, 저자들은이제까지보고되지않았던새로운돌연변이들을발견하게되었다. Val136Ala 및 Cys168Arg, Ser198Ser 의 3 가지변이형이새로운 (vel) 돌연변이임을확인할수있었으며기존의변이형에새로이한국인에서발견된변이형으로추가할수있게되었다. 촉진자 (promoter) P1 지역의 -48 번에서 C 가 G 로, -228 번에서 G 가 A 로바뀌는변이가각각 3 가족에서발견되었으나정상대조군을대상으로같은돌연변이가있는지를검사하였을때같은변이가존재함을확인하여이것은 CMTX 의원인유전변이가아닌단순한유전자다형성 (polymorphism) 인것으로판명할수있었다 (Table 4). 2. CMTX 와 CMT1A 환자의임상적특성 X 염색체상의 Cx32 유전자에과오돌연변이가있었던 22 권 3 호대한신경과학회지 229
5 최병옥정기화박기덕김승민신상희선우일남 Table 3. Mutational analysis of the coding region (exon2) in the Cx32 gene of the CMT patients Mutation Family number Family member Affection state Getype Leu10Leu (CTC-CTT) Val136Ala (GTC-GCC) Arg164Gln (CGG-CAG) Cys168Arg (TGC-CGC) Ser198Ser (TCT-TCA) CMT#5 CMT#20 CMT#2 CMT#30 CMT#22 CMT#2 proband ( ) father mother sister proband ( ) mother proband ( ) mother sister grandmother proband ( ) proband ( ) proband ( ) mother sister grandmother T C C/T C/C C/T C/T C:43 C/C:62 T/C T:43 :62 A G:43 G/G:62 C T:43 :62 T/A T:43 :62 Table 4. Mutational analysis of the promoter region and exon1 in the Cx32 gene of the CMT patients Mutation C-48G (GCT-GGT) G-228A (GGG-GAG) Family number CMT#4 CMT#6 CMT#8 male (n=6) female (n=10) CMT#19 CMT#22 CMT#34 male (n=9) female (n=10) Affection state Getype C/G G C/G C:5, G:1 C/C:10 A A A G:7, A:2 G/G:8, G/A:2 Figure 2. Sequencing analysis of Cx32 gene. Exon 2 region of Cx32 was amplified by the PCR method and sequenced by automatic sequencing analyzer (ABI 3700). The 164th codon is TGC encoding Cys(cysteine) in rmal sample, whereas, it is replaced into CGC encoding Arg(arginine) in the patient sample. Green lines: adesine residues (A); blue lines: cytosine (C); black lines: guanine (G); red lines: thymine (T). CMTX 환자들의임상양상을 CMT 중에서가장높은빈도를차지하고있는 PMP22 유전자의중복이발견된 CMT1A 환자 34 명의임상양상과비교해보았다. CMTX 환자들은 CMT1A 환자들에비해서발병연령과질병기간이빠른경향을보였으나통계적인유의성은보이지않았다. 기능저하척도 (FDS), 발모양변형, 근육위축, 척추측만증등의임상양상에서도두군사이에는 230
6 Cx32 유전자돌연변이를보인 CMTX 와 PMP22 유전자중복을보인 CMT1A 환자들의임상및전기생리학적특성비교 Table 5. Comparison of clinical aspects between the patients with Cx32 missense mutations (CMTX) and the patients with PMP-22 duplications (CMT1A) CMTX CMT1A* No. of patient 3 34 No. of male (%) 2 (66.7) 13 (38.2) Onset age (year) 13.7± ±14.7 Disease duration (year) 5.0± ±6.6 FDS (%) Low (0 or 1) Moderate (2) High ( 3) Muscular atrophy (%) U/E L/E 1 (33.3) 1 (33.3) 1 (33.3) 1 (33.3) 2 (66.7) 13 (38.2) 10 (29.4) 11 (32.4) 19 (55.9) 29 (85.3) Foot deformity (%) 3 (100) 30 (88.2) Scoliosis (%) 1 (33.3) 5 (14.7) Facial palsy (%) 1 (33.3) 0 (0.0) Hearing deffect (%) 2 (66.7) 0 (0.0) Values are mean±sd, and percentages are in parentheses. *CMT1A patients with chromosome 17p11.2-p12 duplication, functional disability scale. 유의한차이를보이지않았다. 그런데 CMT1A 환자군에서관찰되지않았던청력장애및안면마비등뇌신경장애소견이 CMTX 환자군에서는각각 2 명과 1 명에서관찰되었다 (Table 5). 3. CMTX 와 CMT1A 환자의전기생리학적특성 Cx32 유전자돌연변이가있는 CMTX 환자들과 PMP22 유전자중복이있는 CMT1A 환자의신경전도검사결과를비교해보았다 (Table 6). CMTX 환자군에서는정중신경및척골신경의운동신경전도속도가 38 m/s 보다빠른경우가있었다. 따라서 CMTX 는 CMT1 과 CMT2 의전기생리학적특성을모두보여주었다. CMTX 와 CMT1A 환자군모두에서정중신경운동신경을측정할수없는경우는없었다. 그런데 CMT1A 환자군의경우, 비골신경에서는 60% (15 예 ), 그리고후경골신경검사에서는 52% (13 예 ) 에서측정이불가능하였다. 그리고 CMTX 환자군에서는척골신경, 비골신경에서각각 1 예씩 (33%) 에서측정이되지않았다. 감각신경검사상 CMT1A 환자군에서는척골신경과비복신경에서각각 84% (21 예 ) 가측정되지않았고, 다음으로정중신경에서는 80% (20 예 ) 가측정이불가능하였다. 이에비하여 CMTX 환자군에서는정중신경및척골신경검사에 서각각 1 예 (33%), 그리고비복신경에서는 2 예 (67%) 가측정되지않았다. 청각장애가의심되는모든환자들을대상으로뇌간청각유발전위검사를하였고 CMTX 환자 2 명에서양쪽청각신경전도장애의소견을관찰할수있었으나 CMT1A 환자군에서는이상소견을가진경우를발견할수없었다. 안면마비를보인환자를검사하기위해안면신경전도검사및순목반사를하였다. 안면신경전도검사상복합근육활동전위가작아지거나신경전도속도가저하된소견을보였으며순목반사는양쪽모두에서측정이되지않았다. 그런데 CMT1A 환자에서는안면마비의소견을보이는경우가관찰되지않았다. 고찰 선천성질환의원인유전자를분리하고분자생물학적발병기전을규명하기위한연구가세계적으로활기를띠고있다. 1 분자유전학의발전으로이제까지확실하지않던여러유전성질환의본질이규명되면서질병에대한진단과치료의개념이변화하고있으며, 질병의분류도많이달라지고있는데대표적인것으로주로하지비골근육에서서서히진행하는근력약화와위축을특징으로하는 CMT 질환을들수있다. 2 CMT 질환은병리학적소견에의하여탈수초성신경병증인 CMT1 형과축삭형신경병증인 CMT2 형으로나누는데, CMT1 형은다시유전자변이에따라 CMT1A, 1B, 1C 로구분하며 CMT2 형은 2A, 2B, 2C, 2D, 2E, 2F 로나눌수있다 그리고상염색체열성유전을하는 CMT4 형은유전자변이에따라 CMT4A 에서 4F 까지분류된다 이외에 X 염색체의변이에의한 CMTX 형과태생시부터심한증상을보이는 CMT3 형이있다 이중 CMT1A 는 CMT 질환중에서가장높은비율을차지하며말초신경수초의단백질을만드는데관여하는 PMP22 유전자를포함하는염색체 17p11.2-p12 의중복이원인으로알려져있는데, 대부분에서중복이발견되지만드물게는 PMP22 유전자에서점상돌연변이도관찰된다. 12 그외에 MPZ (myelin protein zero) 유전자에서의돌연변이는대부분 CMT1B 를유발하는것으로알려져있지만간혹 CMT2F 형을유발시키기도한다. 11,23 그리고 EGR2 (early growth response 2) 의돌연변이는 CMT 1 형과 Dejerine-Sottas neuropathy, congenital hypomyelination 을유발하는것으로알려져있다. 24 CMT 질환중에서 CMT1A 다음으로높은빈도를차지하는것은간극결합을형성하는 Cx32 유전자의변이에의해발생하는 CMTX 형이알려져있다. 3,4 이러한간극결합은주로주변세포들사이에서세포간채널 (intercelluar channels) 을형성하고있으며말초신경계뿐만아니라간, 콩팥, 폐, 위및중추신경계등체내의많은조직들에서발현된다. 25 또한 Cx32 유전자는말초 22 권 3 호대한신경과학회지 231
7 최병옥정기화박기덕김승민신상희선우일남 Table 6. Comparison of electrophysiological aspects between the patients with Cx32 missense mutations (CMTX) and the patients with PMP-22 duplications (CMT1A) Median motor nerve DML (ms) CMAP (mv) MNCV (m/s) Ulnar motor nerve DML (ms) CMAP (mv) MNCV (m/s) Peroneal nerve DML (ms) CMAP (mv) MNCV (m/s) Tibial nerve DML (ms) CMAP (mv) MNCV (m/s) Median sensory nerve SNAP (µv) SNCV (m/s) Ulnar sensory nerve SNAP (µv) SNCV (m/s) Sural nerve SNAP (µv) SNCV (m/s) CMTX (n=3) CMT1A* (n = 25) CMT#2 CMT#22 CMT#30 range mean SD range ~ ~ ~ ~ ~10.1 ~ ~ ~0.4 ~ ~ ~1.8 ~37.5 ~20.4 ~35.0 ~10.0 ~34.2 ~6.0 ~ ~ ~ ~ ~ ~ ~ ~ ~5.3 ~ ~ ~9.5 ~32.7 ~10.0 ~25.4 ~8.8 ~30.3 ~10.4 ~21.6 DML, distal motor latency, CMAP; compound muscle action potential, MNCV; motor nerve conduction velocity, SNAP; sensory nerve action potential, SNCV; sensory nerve action potential, ; t determined, *CMT1A patients with chromosome 17p11.2-p12 duplication, standard deviation 신경계의수초단백질인 Schwann cell뿐만아니라중추성수초단백질인 oligodendrocyte에서도발현이되므로 Po나 PMP-22 등말초신경계수초단백질에만발현되는유전자의이상에의해발생하는다른 CMT 질환들과는달리뇌신경및중추신경계에서의병변도보고되어있다. 5,6,21 본연구에서 Cx32 유전자의과오돌연변이를보이는 CMTX 환자는전체 48 가족중 3가족으로 6.3% 에해당하였다. 이수치는같은아시아국가인일본 26 의 5.6% 와는유사하지만유럽국가들인핀란드 27 (20.7%), 러시아 28 (13.0%), 독일 29 (11.9%) 등과비교하면절반에도못미치는빈도임을알수있다. 이제까지의연구결과들을보면많은유전병들이유전적이질성을보이며, 질병의종류, 발병시기, 진행양상은인종에따라큰차이를보였다 따라서동일한유전병에대해서도집단에따른 유전적원인분석이이루어져야할것이다. 그러므로앞으로보다많은연구가있어야하겠지만 CMT 질환에있어서도동양과서양에는인종및지역간의차이가있을것으로생각된다. 저자들이 CMTX 환자와 CMT1A 환자들의임상양상을서로비교해보았을때, 발병연령, 질병의심한정도와근육위축등에서는유의한차이가없다는사실을발견하였다. 이것이오랫동안 CMTX 가 CMT1 형의한아형으로포함되었던이유가되었을것으로추정된다. 2,30 그런데 CMT1A 에비해서 CMTX 환자들이가지는또다른특성은뇌신경을침범한증상을보일수있다는것이다. 5,6 본 CMTX 환자들에서도청각신경전도장애및안면마비등이관찰되었다. 그리고 CMTX 는유전자변이가 X 염색체상에위치하므로아버지에서아들로는유전되지않으며, 남자환자는여자환자보다신경전도속 232
8 Cx32 유전자돌연변이를보인 CMTX 와 PMP22 유전자중복을보인 CMT1A 환자들의임상및전기생리학적특성비교 도의저하및임상양상이심하게나타나는특징이있다고알려져있다. 5 본연구에서도아버지에서아들로유전되는경우는없었고, 2 가족에서어머니는증상이가벼워서일상생활을영위하는데별다른지장이없었으나아들은발모양의변형이심하고걷는데장애가있는등임상증상이여자보다남자에서심한것이발견되었다. 그러나증례수가적어서남자환자와여자환자들의임상적및전기생리학적차이를통계적으로비교할수는없었으며, 앞으로보다많은환자들을대상으로조사분석할필요가있다고생각된다. 따라서 CMTX 환자들과 CMT1A 와비교할때에는 X 염색체우성유전을한다는것과뇌신경을침범한증상을보일수있다는점을감별의대상으로삼아야할것으로생각된다. CMTX 질환이근본적으로축삭형신경병증인지혹은탈수초성신경병증인지에대해서는아직까지도서로다른의견들이존재하고있다. 7,8 CMTX 는말초신경의수초단백질장애로인해발생하는질환이지만그병인이축삭형신경병증인지혹은탈수초성신경병증인지에대해서는아직도의견의일치를보지못하고있다. 5-8 일부학자들은축삭형신경병증을보인다고주장한반면, 일부에서는탈수초성신경병증이라고보고하였다. 6-8 그런데 Fischbeck 등 8 은축삭형신경병증을가진 2 가족과탈수초성신경병증을가진 1 가족을동시에보고하였으며, Vital 등 6 은신경조직검사상 CMTX 환자들은축삭소실과재수초화 (remyelination) 를모두보였다고하였다. 또한 CMTX 환자의신경전도검사상남자에서는 25~40 m/s, 여자에서는 25~50 m/s 를보인다고알려져있으며 CMT 1 형과 CMT 2 형의중간형에해당한다고하는보고도있었다. 4,5 저자들은 CMTX 와 CMT1A 환자들에서신경전도속도의범위를조사하였다. PMP22 유전자의중복이확인된 CMT1A 환자군에서는정중신경의전도속도가 2.4~36.0 m/s 로 38 m/s 보다빠른경우는관찰되지않았으며탈수초성신경병증에합당한소견을보였다. 그런데 Cx32 유전자변이가있는 CMTX 환자들의정중신경전도속도는 20.0~42.7 m/s 로이전에보고된결과와일치하였으며탈수초성신경병증과축삭형신경병증에모두해당한다고할수있었다. 특히 CMT#30 환자의신경전도속도검사결과는축삭형신경병증에합당하다고생각되었다. 그런데 CMT#2, 22 환자의경우에는탈수초성신경병증의소견을보이고있었으며 CMT1A 환자군에서보이는소견과대부분일치하고있었으므로전기생리학적검사결과만으로는감별에어려움이있음을알수있었다. 그러나단면적연구 (cross-section study) 의결과보다는추적검사를통한전향적연구 (cohort study) 의결과가필요하다고생각되며앞으로이러한부분에대해서는추후에보다많은한국인 CMTX 환자들을대상으로전향적인추적연구조사를하는것이필요할것으로생각된다. 본연구를통하여한국인에서 CMT 질환을유발하는 돌연변이및새로운유전자들을찾을수있었고, 이결과는 CMT 질환의발병및진행과정에대한분자유전학적기작을이해하는데도움이되며, 이와함께한국인에게적합한 CMT 진단및치료법을개발하는데도움이될것이다. 또한어느가계가 X 염색체와연관된 Cx32 유전자의돌연변이로원인이밝혀졌다면, 아버지의질병은 100% 딸에게전달되지만, 아들에게는질병이전혀전달되지않을것이므로본연구의결과는 CMTX 가계의중요한유전상담자료로도활용될수있을것이다. REFERENCES 1. Berger P, Young P, Suter U. Molecular cell biology of Charcot-Marie-Tooth disease. Neurogenetics 2002;4: Harding AE. From the syndrome of Charcot, Marie and Toothe to disorders of peripheral myelin proteins. Brain 1995;118: Herringham WP. Muscular atrophy of the peroneal type affecting many members of a family. Brain 1889;11: Bergoffen J, Scherer SS, Wang S, Scott MO, Bone LJ, Paul DL, et al. Connexin mutations in X-linked Charcot-Marie- Tooth disease. Science 1993;262: Hahn AF, Bolton CF, White CM, Brown WF, Tuuha SE, Tan CC et al. Getype/phetype correlations in X-linked dominant Charcot-Marie-Tooth disease. Ann N Y Acad Sci 1999;883: Vital A, Ferrer X, Lagueny A, Vandenberghe A, Latour P, Goizet C, et al. Histopathological features of X-linked Charcot-Marie-Tooth disease in 8 patients from 6 families with different connexin32 mutations. J Peripher Nerv Syst 2001;6: Birouk N, LeGuern E, Maisobe T, Rouger H, Gouider R, Tardieu S, et al. X-linked Charcot-Marie-Tooth disease with connexin 32 mutations: clinical and electrophysiologic study. Neurology 1998;50: Fischbeck KH, ar-rushdi N, Pericak-Vance M, Rozear M, Roses AD, Fryns JP. X-linked neuropathy: gene localization with DNA probes. Ann Neurol 1986;20: Choi BO, Chung KW, Kim SM, Park KD, Lee MS, Shin SH, et al. A vel V136A mutation in Cx32 and a R359W mutation in EGR2 within a Charcot-Marie-Tooth patient. J Korean Neurol Assoc 2004;22: Choi BO, Sunwoo IN, Park KD, Kim YJ, Choi KG, Lee MS, et al. X-linked Charcot-Marie-Tooth patient with a vel Cys168Arg missense mutation in the connexin32 gene. J Korean Neurol Assoc 2004;22: Marrosu MG, Vaccargiu S, Marrosu G, Vannelli A, Cianchetti C, Muntoni F. Charcot-Marie-Tooth disease type 2 associated with mutation of the myelin protein zero gene. Neurology 1998;50: Roa BB, Garcia CA, Suter U, Kulpa DA, Wise CA, Mueller J, et al. Charcot-Marie-Tooth disease type 1A association with a spontaneous point mutation in the PMP22 gene. N Engl J Med 1993;329: Ben Othmane K, Middleton LT, Loprest LJ, Wilkinson KM, 22 권 3 호대한신경과학회지 233
9 최병옥정기화박기덕김승민신상희선우일남 Lenn F, Rozear MP, et al. Localization of a gene (CMT2A) for autosomal dominant Charcot-Marie-Tooth disease type 2 to chromosome 1p and evidence of genetic heterogeneity. Gemics 1993;17: Igarashi M, Thompson EI, Rivera GK. Vincristine neuropathy in type 1 and type 2 Charcot-Marie-Tooth (hereditary motor and sensory neuropathy). Med Pediatr Oncol 1995;25: Guilbot A, Williams A, Ravise N, Verny C, Brice A, Sherman DL, et al. A mutation in periaxin is responsible for CMT4F, an autosomal recessive form of Charcot-Marie- Tooth disease. Hum Mol Genet 2001;10: Senderek J, Bergmann C, Weber S, Ketelsen UP, Schorle H, Rudnik-Schoneborn S, et al. Mutation of the SBF2 gene, encoding a vel member of the myotubularin family, in Charcot-Marie-Tooth neuropathy type 4B2/11p15. Hum Mol Genet 2003;12: Boerkoel CF, Takashima H, Stankiewicz P, Garcia CA, Leber SM, Rhee-Morris L, et al. Periaxin mutations cause recessive Dejerine-Sottas neuropathy. Am J Hum Genet 2001;68: Nelis E, Erdem S, Van Den Bergh PY, Belpaire-Dethiou MC, Ceuterick C, Van Gerwen V, et al. Mutations in GDAP1: autosomal recessive CMT with demyelination and axopathy. Neurology 2002;59: Senderek J, Bergmann C, Ramaekers VT, Nelis E, Bernert G, Makowski A, et al. Mutations in the ganglioside-induced differentiation-associated protein-1 (GDAP1) gene in intermediate type autosomal recessive Charcot-Marie-Tooth neuropathy. Brain 2003;126: Simonati A, Fabrizi GM, Taioli F, Polo A, Cerini R, Rizzuto N. Dejerine-Sottas neuropathy with multiple nerve roots enlargement and hypomyelination associated with a missense mutation of the transmembrane domain of MPZ/P0. J Neurol 2002;249: Scherer SS, Deschenes SM, Xu YT, Grinspan JB, Fischbeck KH, Paul DL. Connexin32 is a myelin-related protein in the PNS and CNS. J Neurosci 1995;15: Bone LJ, Deschenes SM, Balice-Gordon RJ, Fischbeck KH, Scherer SS. Connexin32 and X-linked Charcot-Marie-Tooth disease. Neurobiol Dis 1997;4: Hattori N, Yamamoto M, Yoshihara T, Koike H, Nakagawa M, Yoshikawa H, et al. Demyelinating and axonal features of Charcot-Marie-Tooth disease with mutations of myelinrelated proteins (PMP22, MPZ and Cx32): a clinicopathological study of 205 Japanese patients. Brain 2003;126: Warner LE, Svaren J, Milbrandt J, Lupski JR. Functional consequences of mutations in the early growth response 2 gene (EGR2) correlate with severity of human myelipathies. Hum Mol Genet 1999;8: Kumar NM, Gilula NB. Cloning and characterization of human and rat liver cdnas coding for a gap junction protein. J Cell Biol 1986;103: Numakura C, Lin C, Ikegami T, Guldberg P, Hayasaka K. Molecular analysis in Japanese patients with Charcot-Marie- Tooth disease: DGGE analysis for PMP22, MPZ, and Cx32/GJB1 mutations. Hum Mutat 2002;20: Silander K, Meretoja P, Juvonen V, Ignatius J, Pihko H, Saarinen A, et al. Spectrum of mutations in Finnish patients with Charcot-Marie-Tooth disease and related neuropathies. Hum Mutat 1998;12: Mersiyava IV, Ismailov SM, Polyakov AV, Dadali EL, Fedotov VP, Nelis E, et al. Screening for mutations in the peripheral myelin genes PMP22, MPZ and Cx32 (GJB1) in Russian Charcot-Marie-Tooth neuropathy patients. Hum Mutat 2000;15: Huehne K, Benes V, Thiel C, Kraus C, Kress W, Hoeltzenbein M, et al. Novel mutations in the Charcot- Marie-Tooth disease genes PMP22, MPZ, and GJB1. Hum Mutat 2003;21: Chance PF, Pleasure D. Charcot-Marie-Tooth syndrome. Arch Neurol 1993;50:
< C1B6C7F6C1F62DC3D6BAB4BFC D E687770>
원저 J Korean Neurol Assoc / Volume 2 / October, 2005 CMT 환자들에서 Neurofilament Light Chain (NEFL) 유전자돌연변이분석 이화여자대학교의과대학신경과학교실, 공주대학교생명과학과 a, 연세대학교의과대학신경과학교실 b, 부산대학교의과대학신경과학교실 c 조현지정기화 a 선우일남 b 박기덕김대성 c 서범천
More information(박형준)108.hwp
증례접수번호 :09-029(2 차 -0710) 이화여자대학교의과대학목동병원신경과 a, 연세대학교의과대학신경과학교실 b, 성균관대학교의과대학삼성서울병원신경과 c 박형준 a,b 신하영 b 이효은 b 이동현 b 김경민 b 최병옥 c 김승민 b X-linked Charcot-Marie-Tooth Disease Type 1 Harboring Unusual Electrophysiological
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More informationMicrosoft PowerPoint - 발표자료(KSSiS 2016)
Sang Jun Kim, MD, PhD Application of 3D Printing in the Orthotic Fields Hallux Valgus, Charcot Marie Tooth, ADL Kit, Foot Insole, Wrist Pain, Foot Drop Development of Automated Program for Ankle Foot Orthosis
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>
원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information< C3D6BAB4BFC12DC1A4B1E2C8AD D E687770>
원저 J Korean Neurol Assoc / Volume 23 / December, 2005 CMT1A 와 HNPP 신경질환의진단을위한 Microsatellite 다중중합효소연쇄반응시스템의개발 이화여자대학교의과대학신경과학교실, 공주대학교생명과학과 a 최병옥박선화 a 윤지영정기화 a ByungOk Choi, M.D., Sun Wha Park, M.Sc. a,
More informationConnexin 26 의유전자변이 서론 재료및방법 대상 방법 Korean J Audiol Volume 5 December, 2001
KISEP Original Articles Korean J Audiol 52:105-110, 2001 선천성고도난청에서 Connexin 26 의유전자변이의형태분석 이상흔 1 이정래 1 이지은 1 김태정 2 강봉석 2 Molecular Genetic Analysis of Connexin 26 in Congenital Profound Hearing Loss Sang
More information(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
More informationºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More informationJksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationKISEP Otology Korean J Otolaryngol 2001;44: 유전성난청과동반된 GJB2 유전자변이의세포간극에대한기능적연구 정연훈 유상준 이준호 박홍준 Functional Study of Gap Junction in GJB2 Mutations
KISEP Otology Korean J Otolaryngol 2001;44:239-45 유전성난청과동반된 GJB2 유전자변이의세포간극에대한기능적연구 정연훈 유상준 이준호 박홍준 Functional Study of Gap Junction in GJB2 Mutations Associated with Hereditary Hearing Loss Yun Hoon Choung,
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information미래의학 - 맞춤형의학 유전자가위
미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information< D30362D BCB1BFECC0CFB3B22DB0ADBBE7C0B1292E687770>
원저 제주대학교의과대학신경과, 연세대학교의과대학신경과 a 강사윤김승민 a 선우일남 a Clinical and Electrophysiological Characteristics of Leprous Neuropathy Sa-Yoon Kang, M.D., Seung Min Kim, M.D. a, Il-Nam Sunwoo, M.D. a Department of Neurology,
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More information. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )
. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information증례 753
KISEP Case Reports 37 4 1998 J Korean Neuropsychiatr Assoc Vol 37, No 4 CAG 반복의확장을보인가족력이없는 Huntington 씨병 1 례 연규월 * 신수진 * 박성섭 ** A Case of Huntington s Disease without Family History Who Has Diagnosed with
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information< B9E8C1BEBCAE2DB1E8BAB4C1D D E687770>
원저 J Korean Neurol Assoc / Volume 23 / August, 2005 통증성및무통증성당뇨신경병증의전도지연 서울의료원신경과, 성균관대학교의과대학삼성서울병원신경과 a 배종석김지연고석민박성식안진영김민기김병준 a Jong Seok Bae, M.D., Ji Youn Kim, M.D., Seok Min Go, M.D., Sung Sik Park,
More information자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationIL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
More informationƯÇãû
'' - 1 - - 2 - - 3 - - 4 - - 5 - ' - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - Super-Bio Co., Ltd. KWON, Suk-Tae Thermostable DNA Polymerase-encoding Gene from Thermus sp. X-1 an d Amino Acid Sequence
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information[ 영어영문학 ] 제 55 권 4 호 (2010) ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with clon
[ 영어영문학 ] 제 55 권 4 호 (2010) 775-794 ( ) ( ) ( ) 1) Kyuchul Yoon, Ji-Yeon Oh & Sang-Cheol Ahn. Teaching English prosody through English poems with cloned native intonation. The purpose of this work is to
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information<4D F736F F F696E74202D20454D49A3AF454D43BAEDB7CEBCC52EBBEABEF7BFEBC6F7C7D428BBEFC8ADC0FCC0DA >
Materials Material Grades : PL Series Applicaton : Power transformer and Inductor Grades μi Freq. (MHz) Pcv 1) (Kw/ m3 ) Bs 2) (mt) Materials Characteristics PL-7 2,400 ~ 0.2 410 390 Mn-Zn Low loss PL-9
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information체성 감각신경계 진찰
말초신경및근육의전기생리학적검사 Electrophysiological Testing in Neuromuscular Disease 김병준교수 ( 신경과학교실, 강북삼성병원 ) 학습목표 - 근전도검사의적응증을설명한다. - 축삭병변과탈수초성병변의구분에있어서근전도검사의유용성을설명한다. - 근전도검사에서의사의역할을설명한다. 1. 근전도검사의개념 근전도검사 (Electromyography,
More information제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 Program 1 ANESTHESIA (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuou
제5회 가톨릭대학교 의과대학 마취통증의학교실 심포지엄 (Room 2층 대강당) >> Session 4 Updates on PNB Techniques PNB Techniques for shoulder surgery: continuous vs single injection, interscalene vs supraclavicular approach 의정부성모병원
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information975_983 특집-한규철, 정원호
Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationKIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information<31312D31352D B9E9C7F6BCAE2DB9DAB9CEBCF E687770>
증례 http://dx.doi.org/10.17340/jkna.2015.3.11 영남대학교의과대학신경과학교실 Acute-Onset Chronic Inflammatory Demyelinating Polyradiculoneuropathy Mimicking Miller-Fisher Syndrome Hyun-Seok Baek, MD, Chang Hun Bin, MD,
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More informationhapter_ i i 8 // // 8 8 J i 9K i? 9 i > A i A i 8 8 KW i i i W hapter_ a x y x y x y a /()/()=[W] b a b // // // x x L A r L A A L L A G // // // // /
A p p e n d i x Notation hapter_ i i 8 // // 8 8 J i 9K i? 9 i > A i A i 8 8 KW i i i W hapter_ a x y x y x y a /()/()=[W] b a b // // // x x L A r L A A L L A G // // // // // // // 8 b hapter_ hapter_
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information<28C3D6C1BE29312DC0CCBDC2BEC62E687770>
한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연
More information유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
More information08.hwp
박 기 식 여주대학 토목과 (2001. 10. 24. 접수 / 2002. 6. 14. 채택) A Study on the Longitudinal Vibration of Finite Elastic Medium using Laboratory Test Ki-Shik Park Department of Civil Engineering, Yeojoo Institute of
More information44-3대지.08류주현c
A Comparative Study on the Commuting Regional Type According to the Features of Foreigner Commuting Ju-Hyun Ryu* Abstract The purposes of this study are to identify many implications of commuting regional
More informationEffects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]
More information2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information대한한의학원전학회지26권4호-교정본(1125).hwp
http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1
More informationKinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc
Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]
More information한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과
한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More information연하곤란
2015.03.04 부울경소화기내시경지회 Intramucosal gastric cancer: The rate of lymph node metastasis in signet ring cell carcinoma was as low as that in welldifferentiated adenocarcinoma 인제대부산백병원 소화기내과 지삼룡 Signet ring
More information<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>
심전도연수강좌 : 처음시작하는사람들을위한심전도 연세대학교원주의과대학순환기내과학교실 안민수 Cardiac Electrophysiology I : Automaticity : 60-100 회 /min, His bundle : 40-60 회 /min Bundle branch : 20-40 회 /min Purkinje fiber : 20 회 /min Cardiac Electrophysiology
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More informationYI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w
497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More informationFluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College
More information135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information00유발전위-부속
V,,,,,,. 1929 Hans Berger,, Dawson. 1976, Dr. Drake Dr. Peerless, Dr. Barnett 1979 2 fellow 1980 Havard Dr. Chiappa Evoked potentials. Dr. Drake,. 1981,,,, conference. 1981 7 Nicolet. 1983 9 21~24 Tulsa,
More information