연구단신, Brief report 2 이중표지유비저균제작을통한생체내추적시스템구축 질병관리본부감염병분석센터고위험병원체분석과신용우, 박덕범, 최명민, 전정훈, 이기은 * 연세대학교생명시스템대학생명공학과 성백린 * 교신저자 : gerhie@korea.kr, 043-719-8270 Construction of luminescence and fluorescence tagged Burkholderia pseudomallei for pathogen tracking in a mouse model Shin Yong-woo, Park Deok-bum, Choi Myung-min, Chun Jeong-hoon, Rhie Gi-eun Division of High-risk Pathogens, Center for Laboratory Control of Infectious Diseases, KCDC Seong Baik-lin Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University Molecular imaging of pathogens causing infectious diseases, at both cell and whole organism levels, is crucial to studying the pathogenesis mechanisms of infectious diseases. In this study, we have produced a luminescence and fluorescence duallabeled form of Burkholderia pseudomallei, a high-risk pathogen, which can be used to study pathogenesis and the immune responses at live organism, isolated organ, tissue and cell levels simultaneously. Using this method, we could trace B. pseudomallei in mice, and visualize bacterial replication in cells. The method is highly applicable to other pathogens, and could be an extremely useful tool to study the pathogenesis and host immune responses of a variety of infectious diseases. Keywords: Burkholderia pseudomallei, Molecular imaging, Luminescence, Fluorescence 들어가는말 최근세포의특정인자위치를영상화하는기술과함께살아있는개체내에서특정인자의위치를실시간으로시각화하여위치정보를확인하는분자영상기술이급속도로발전하고있다. 생체분자영상기법은다양한분야에서적극적으로활용되고있지만, 감염병분야, 특히고위험병원체연구분야에있어서의적용은아직미흡한실정이다. 병원체의분자영상분석은개체전체뿐만아니라세포수준에서의병원체분포분석과감염기작및면역반응의 상세한메커니즘조사연구에이용될수있다 [1,2]. 현재의병원체영상화기술은항체를사용하는형광인자 (fluorescence) 및발광인자 (luminescence) 관련된시각화를통하여동물의생체내병원체를추적하고있다 [3,4]. 그러나대다수고위험병원체의경우적절한항체가존재하지않으며 [5,6], 또한일반적으로형광신호는생체가가지고있는배경신호 (background signal) 및생체조직의투과성등의단점으로항체기반의형광신호를이용한면역염색방법은살아있는동물이나세포내의병원체추적연구에적용할수없다. 이러한문제로인해여러병원체의생체내 www.cdc.go.kr 1125
Table 1. Bacterial strains and plasmids used in this study Strain and plasmids Description Source B. pseudomallei strains H0901 Clinical isolate (wild type) [13] H0901-M2GFP-Lux H0901, containing pt7-m2gfp-lux This study Plasmids pbhr1 Broad-host range vector (ori 6k, mobrp4, rep, Cm r, Kan r ) MoBiTec GmbH ptopo-m2gfp-lux Genes for M2GFP and lux operon cloned into pcr2.1-topo This study pt7-m2gfp-lux Genes for T7promoter, M2GFP, and lux operon cloned into pbhr1 This study PCR primers EcoRI-F EcoRI-R Primer sequences (5'-3') a AGCGAATTCCCCTATAGTGAGTCGTATTACATGAGTAAAG AGCGAATTCTCAACTATCAAACGCTTCGGTTAAG a Restriction enzyme sites are underlined;boldface indicates T7 promoter sequence. 기작에대한연구는암과같은잘특징지어지는질병과비교하여어렵다는것이입증되었다 [7,8]. 병원체의감염메커니즘을정확하게분석하기위해서는생체내장기, 조직및세포수준에서동시에시공간적으로분석되어야한다. 이연구에서는생체내에서일어나는병원체증식현상에대한영상화를목적으로형광인자와발광인자이중표지유비저균을개발하여감염병연구를위한생체분자영상추적시스템을구축하였다. 및발광인자표지화를위한유비저균용벡터를제작하였다. 형광신호를발현하는 M2GFP 유전자와세포내에서효소-기질작용에의해발광신호를유도하는발광인자유전자군 (lux operon) 이포함된 pt7-m2gfp-lux 벡터를사용하여형광및발광인자가발현하는유비저균 (H0901-M2GFP-Lux) 을제조하였다 (Figure 1A, Table 1). 유비저균의형광및발광인자발현이세균수가증가함에따라영상신호가증가함을정량적으로관찰할수있었다 (Figure 1B). 이후제작된 H0901-M2GFP-Lux 균주를실제마우스에 몸말 유비저균 (Burkholderia pseudomallei) 은그람음성균이며사람에게유비저 (Melioidosis) 라는감염병을일으키는고위험병원체이다 [9]. 또한적은양으로도병원성을일으키기때문에생물학적무기로도사용될수있다 [10]. 효과적인백신과치료법은아직개발되지않았으며기초연구를위한병원체분포및감염된숙주의면역반응에대한정보가필요하다 [11,12]. 이연구에서는생체내에서일어나는유비저균의숙주내병원체추적과단일세포영상화를위한목적으로이중표지유비저균을제작하였다. 이연구에사용된유비저균은국내발생유비저환자로부터분리되었고 [13], 유전자재조합기법을이용하여형광 감염시켜생체분자영상분석을위한동물실험을수행하였다. 이연구에서진행된모든실험은질병관리본부지침에따라생물안전 3등급시설 (BL3) 에서수행되었으며, 동물실험윤리위원회 (Institutional Animal Care and Use Committee, IACUC) 의실험기준에따라진행되었다. 6주령의 BALB/c 마우스에 1x10 7 또는 1x10 8 (CFU/mL) 의 H0901-M2GFP-Lux 균주를정맥주사한후, 생체영상분석장비 IVIS Lumina III(PerkinElmer, MA, USA) 로영상신호를분석하여감염유비저균의생체내분포양상을관찰하였다. 마우스생체내에서의유비저균의발광인자발현을확인하였고 (Figure 2A), 발광신호는 PBS 대조군에비해현저하게증가됨을확인하였다 (Figure 2B). 마우스장기의경우, 정맥주사한후감염된장기를적출하여병원체가감염된장기에서의발광신호를정량화하였다. 감염 6시간후비장을비롯한타장기로병원균이전파됨을확인할 www.cdc.go.kr 1126
Figure 1. Construction of Burkholderia pseudomallei H0901-M2GFP-Lux A. Construct of pt7-m2gfp-lux. M2GFP is a GFP variant of increased fluorescence. The T7 promoter gene was inserted upstream of the M2GFP and lux operon genes for constitutive expression. B. Fluorescent (top panel) and luminescent (lower panel) signals from H0901-M2GFP-Lux. Differences in fluorescent and luminescent signal intensities were analyzed by one-way ANOVA and Tukey s post-hoc test. ***P < 0.001. 수있었고, 대조군에비해폐, 간, 비장에병원체분포가크게증가하였다. 또한공초점형광현미경 (Confocal microscopy, Olympus FV1000) 을사용하여마우스비장조직내의병원체감염양상을확인하였다 (Figure 3A). 세포수준에서의관찰을위해마우스대식세포 J774A.1 세포에 10 MOI로감염시켰다. 2시간후공초점형광현미경을사용하여유비저균이세포질에위치하는것을확인하였다 (Figure 3B). 맺는말 생체분자영상분석기법을이용한감염병연구는개체수준에서감염병원체의실시간위치정보를제공할수있다. 이번연구의결과는유비저균감염이후의시간에따른생체내각기관별조직및세포수준에서시공간적정보를영상화할수있음을나타낸다. 기존의일반적인동물실험기법은시간별, 위치별로분석결과를 얻기위해많은개체의소모가필요하지만이연구를통해확립된 이중표지영상균주기법은한개체에서반복적인관찰이가능하고 www.cdc.go.kr 1127
Figure 2. In vivo distribution of Burkholderia pseudomallei H0901-M2GFP-Lux A. Mice were intravenously infected with 1 10 7 or 1 10 8 CFU/ml of H0901-M2GFP-Lux, and in vivo analysis was performed 6 h later. The photon counts (photons/sec/cm 2 ) of labeled bacteria are represented colorimetrically from red (high concentration) to violet (low concentration). Images are representative of three replicate experiments, and representative animals are shown. B. Differences in bioluminescent signal intensities were analyzed by one-way ANOVA and Tukey s post hoc test. ***P < 0.001. Figure 3. Dual image analyses of Burkholderia pseudomallei H0901-M2GFP-Lux-infected mice A. Mice were intravenously inoculated with either PBS or H0901-M2GFP-Lux for 6 h. The animals were sacrificed and organs were harvested for ex vivo imaging using IVIS Lumina III and bacterial load determination (left). Fluorescent confocal microscopic analysis of H0901-GFP-Lux infected spleen tissue was also conducted (right). B. Analysis and visualization of bacteria at the cellular level using fluorescence. J774A.1 macrophages were infected with H0901-M2GFP-Lux at an MOI of 10 for 2 h. DIC, differential interference contrast. www.cdc.go.kr 1128
실험에사용되는개체수를최소화할수있어동물윤리적측면에서도바람직한방법이라할수있다. 또한이중표지균주를이용한영상분석은숙주의감염과정을연구하는효율적인방법을제공할수있다. 병원균특이적항체없이도살아있는숙주장기조직및세포에서동시에추적할수있어병원체감염현상에대한자세한정보제시가가능하다. 이중표지를이용한이번연구의분석연구에응용은유비저균에국한되지않고다른병원균으로확대될수있다. 특정병원체내에서복제가가능한벡터및활성화프로모터의교체를통해다른고위험병원체에적용하여시각화하고추적할수있다. 또한영상신호의높은발현양으로낮은농도의병원균검출및분석에도활용될수있다. 이연구결과는생체분자영상분석을통한고위험병원체의감염양상연구에활용이가능할것으로기대된다. 참고문헌 1. Massey S, Johnston K, Mott TM, Judy BM, Kvitko BH, Schweizer HP, Estes DM, Torres AG. In vivo bioluminescence imaging of Burkholderia mallei respiratory infection and treatment in the mouse model. 2. Warawa JM, Long D, Rosenke R, Gardner D, Gherardini FC. Bioluminescent diagnostic imaging to characterize altered respiratory tract colonization by the Burkholderia Pseudomallei capsule mutant. Front Microbiol. 2011;2:133. 3. Nham T, Filali S, Danne C, Derbise A, Carniel E. Imaging of bubonic plague dynamics by in vivo tracking of bioluminescent Yersinia pestis. PLoS One. 2012;7:e34714. 4. Revelli DA, Boylan JA, Gherardini FC. A non-invasive intratracheal inoculation method for the study of pulmonary melioidosis. Front Cell Infect Microbiol. 2012;2:164. 5. Louie M, Read S, Simor AE, Holland J, Louie L, Ziebell K, Brunton J, Hii J. Application of multiplex PCR for detection of non-o157 verocytotoxin-producing Escherichia coli in bloody stools: identification of serogroups O26 and O111. J Clin Microbiol. 1998;36:3375-3377. 6. Rajwa B, Dundar MM, Akova F, Bettasso A, Patsekin V, Hirleman ED, Bhunia AK, Robinson JP. Discovering the unknown: detection of emerging pathogens using a label-free light-scattering system. Cytometry A. 2010;77:1103-1112. 7. Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, Yang Q, Bishop JM, Contag CH, Felsher DW. MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature. 2004;431:1112-1117. 8. Burton JB, Johnson M, Sato M, Koh SB, Mulholland DJ, Stout D, Chatziioannou AF, Phelps ME, Wu H, Wu L. Adenovirus-mediated gene expression imaging to directly detect sentinel lymph node metastasis of prostate cancer. Nat Med. 2008;14:882-888. 9. Wiersinga WJ, Currie BJ, Peacock SJ. Melioidosis. N Engl J Med. 2012;367:1035-1044. 10. Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM. Public health assessment of potential biological terrorism agents. Emerg Infect Dis. 2002;8:225-230. 11. Limmathurotsakul D, Peacock SJ. Melioidosis: a clinical overview. Br Med Bull. 2011;99:125-139. 12. Patel N, Conejero L, De Reynal M, Easton A, Bancroft GJ, Titball RW. Development of vaccines against Burkholderia Pseudomallei. Front Microbiol. 2011;2:198. 13. Shin YW, Cho MH, Chun JH, Kim CM, Oh HB, Rhie GE, Yoo, CK. The Laboratory Diagnosis of Melioidosis in a Korean Patient. J Bacteriol Virol. 2011;41:19-25. www.cdc.go.kr 1129