384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
|
|
- 영대 원
- 6 years ago
- Views:
Transcription
1 식물병연구 Note Open Access Res. Plant Dis. 23(4) : (2017) First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea * 1, 2, 3 *Corresponding author Tel: Fax: hschoi@korea.kr These authors contributed equally to this work as co-first authors. Mikyeong Kim 1, Hyo-Jung Kang 2, Hae-Ryun Kwak 1, Jeong-Eun Kim 1, Jaedeok Kim 1, Jang-Kyun Seo 3, and Hong-Soo Choi 1 * 1 Crop Protection Division, National Institute of Agricultural Sciences, Wanju 55365, Korea 2 Chungcheongbuk-do Agricultural Research and Extension Services, Boeun 28902, Korea 3 Graduate School of International Agricultural Technology, Seoul National University, Pyeongchang 25354, Korea Received October 26, 2017 Revised October 31, 2017 Accepted November 1, 2017 In 2016, less than 30% of virus-like symptoms such as chlorosis, necrosis and ringspots were observed in Hoya carnosa from commercial greenhouse in Eumseong, Korea. A total of 6 samples from Hoya carnosa were collected both symptomatic and asymptomatic plants and tested for virus infection by RT-PCR of 3 viruses known to infect Hoya spp. including Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV) and Tomato chlorotic spot virus (TCSV). Three symptomatic samples were positives for INSV. Also, it was not the virus detected in three asymptomatic samples. To further confirm the presence of INSV, complete nucleocapsid (N) gene of the virus were amplified and sequenced from two samples. BLAST analysis of the consensus sequence showed that two isolates (INSV-Hy1 and -Hy2) shared nucleotide sequence identities of 99% with each other and 97-99% with other INSV isolates available in the GenbBank. Phylogenetic analysis showed that these isolates closely related to the INSV isolates from ornamental from China. This is the first report of INSV on Hoya carnosa from Korea. Keywords: Hoya carnosa, Impatiens necrotic spot virus, Orthotospovirus (Hoya carnosa) 100, 3-5 ( ). (Yang, 2009). (Impatiens necrotic spot virus, INSV) Tospoviridae, Orthotospovirus, (Frankliniella occidentalis), (F. intonsa) Research in Plant Disease pissn , eissn (Simko, 2017; Sakurai, 2004). 1990,,, 36 (Crosslin Hamlin, 2010; Daughtrey, 1997; De Avila, 1992; Kuo, 2014; Law Moyer, 1990) (Horita Sasaki, 2005), 2010 (Ding, 2011), 2009,,, ha, The Korean Society of Plant Pathology This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; Shin, 2013; Roggero, 1999; Vicchi, 1999) RT-PCR, (INSV) ( 1,000 m 2, 15 ). 40 1%, 60 10%, 90 30%.,., 3 ( ) (Fig. 1). 7.. (Quick DIP) (2% PTA). 6,, nm. RNA RT-PCR , 3 1 3, 6, 7 ( mg), (BCS Plant RNA Prep Kit, BioCube System, Gwacheon, Korea) Total RNA. Orthotopsovirus (TSWV), (INSV) (Tomato chlorotic spot virus, TCSV) 3 RT-PCR (Table 1). 3 (INSV). Fig. 1. Disease symptoms induced in Hoya carnosa plants by Impatiens necrotic spot virus (INSV). (A) Chlorotic and necrotic ring spots on leaves in natural field. (B) Brown to dark brown, necrotic spotting in middle leaves of the plant. (C, D) Chlorotic spots and necrosis of leaves.
3 Research in Plant Disease Vol. 23 No Table 1. Sequences of primers for detection of TSWV, INSV, TCSV, CMV and BBWV2 in this report Viruses a Name Sequence (5-3 ) Product size (bp) TSWV TSWV-6F GAGATTCTCAGAATTCCCAGT TSWV-6R AGAGCAATCGTGTCAATTTTATTC 459 bp INSV INSV-1F ATCAATAGTAGCATTAAACAT INSV-1R GACTCAATCTGATTCCTTAGA 800 bp TCSV TCSV-F TCCCTTGGTTTCATTGACCAAACGC TCSV-R ACATG ACACTTGCAAATGAGACTCC 590 bp CMV CMV DP u1 CGTCGTGGTTCCCGCTCCG CMV DP d2 AGCGCGCATCGCCGAAAGAT 473 bp BBWV2 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG BBWV2 1R GCCATCTCATTGGCATGGA 380 bp a TSWV, Tomato spotted wilt virus; INSV, Impatiens necrotic spot virus; TCSV, Tomato chlorotic spot virus; CMV, Cucumber mosaic virus and BBWV2, Broad bean wilt virus 2. Table 2. Analysis of leaves of Hoya carnosa for five viruses using specific primers by RT-PCR 3 7 (TSWV), (INSV) (TCSV) (Cucumber mosaic virus, CMV) (Table 2). 3 (Ls), (La), (S), (R) (INSV),,,, (Fig. 2). (INSV) (Vicchi, 1999). Host a No. of positive samples b TSWV INSV TCSV CMV BBWV2 Hoya-S Hoya-A Pepper-S a Number of samples collected; S = symptomatic samples and A = asymptomatic samples. b Viruses: TSWV, Tomato spotted wilt virus; INSV, Impatiens necrotic spot virus; TCSV, Tomato chlorotic spot virus; CMV, Cucumber mosaic virus and BBWV2, Broad bean wilt virus 2; -, not tested. Fig. 2. Detection of Impatiens necrotic spot virus (INSV) in Hoya carnosa stocks by RT-PCR. Samples were collected from symptomatic leaf (Ls), asymptomatic leaf (La), stem (S) and root (R) from each of stocks (lanes 1,2 and 3). M, DNA ladder; N, negative; P, positive control.. RT-PCR (INSV) bp PCR direct sequencing. (National Center for Biotechnology Information, NCBI, USA) BLAST Genbank INSV 97-99%. (INSV) (INSV-Hy1,-Hy2) (Nucleocapsid gene) forward INSV-N (5 CACAACACAAAGCAAACCAAGC 3), reverse J13 (5 CCCGGATCCAGAGCAAT 3) (Cortez, 2001), PCR Expin TM ComboGP (GeneAll Bio., Seoul, Korea), pgem-t Easy vector (Promega, WI, USA). 3
4 386 Research in Plant Disease Vol. 23 No. 4 Fig. 3. Phylogenetic analysis by Maximum likelihood method showing the relationship of Impatiens necrotic spot virus (INSV) isolates from various hosts and countries based on an alignment of complete nucleocapsid (N) gene sequences. The percentage of trees in which the associated texa clustered together is shown next to the branches. The Tomato spotted wilt virus (TSWV), Zucchini lethal chlorosis virus (ZLCV) and Tomato chlorotic spot virus (TCSV) were used as an outgroup. (Genotech., Daejeon, Korea). BLAST Genbank INSV 97-99%. INSV-HDL (GU112504,, ), INSV J (AB109100,, ) 99%. MEGA 7, (outgroup) Orthotospovirus (TSWV), (TCSV), (Zucchini lethal chlorosis virus, ZLCV). Clustal W.,,, (INSV), (GQ336989) (GU112504) (Fig. 3) %,. 6, (TSWV), (INSV) (TCSV) 3 RT-PCR., 3 (INSV), 3. 2 (INSV) (N),. (INSV) Hy-1 Hy-2 BLAST 99%, Genbank (INSV) 97-99%.. (INSV). Conflicts of Interest No potential conflict of interest relevant to this article was reported. Acknowledgement This study was carried out with the support of Cooperative Research program for Agricultural Science & Technology Development (Project No. PJ ) Rural Development Administration, Republic of Korea.
5 Research in Plant Disease Vol. 23 No References Brisco-McCann, E. I. and Hausbeck, M. K Handbook of Florists Crops Diseases, pp Cortez, I., Saaijer, J., Wongjkaew, K. S., Pereira, A. M., Goldbach, R., Preters, D. and Kormelink, R Identification and characterization of a novel tospovirus species using a new RT-PCR approach. Arch Virol. 146: Crosslin, J. M. and Hamlin, L. L First report of Impatiens necrotic spot virus infecting greenhouse-grown potatoes in Washington state. Plant Dis. 94: Daughtrey, M. L., Jones, R. K., Moyer, J. W., Daub, M. E. and Baker, J. R Tospoviruses strike the greenhouse industry: INSV has become a major pathogen on flower crops. Plant Dis. 81: De Avila, A. C., Haan, P. D., Kitajima, E. W., Kormelink, R., Resende, R. D., Goldbach, R. W. and Peters, D Characterization of a distinct isolate of Tomato spotted wilt virus (TSWV) from Impatiens sp. in the Netherlands. J. Phytopathol. 134: Ding, M., Yin, Y., Fang, Q., Li, S. and Zhang, Z First report of Impatiens necrotic spot virus in Gentiana macrophylla in China. Plant Dis. 95: Horita, H. and Sasaki, J Necrotic spot of lisianthus caused by Impatiens necrotic spot virus in Hokkaido. Jpn. J. Phytopathol. 71: 83. (Abstract, In Japanese) Kuo, Y. W., Gilbertson, R. L., Turini, T., Brennan, E. B., Smith, R. F. and Koike, S. T Characterization and epidemiology of outbreaks of Impatiens necrotic spot virus on lettuce in coastal California. Plant Dis. 98: Law, M. D. and Moyer, J. W A tomato spotted wilt-like virus with a serologically distinct N protein. J. Gen. Virol. 71: Shin, Y.-G List of plant quarantine viruses in Korea newly revised in Res. Plant Dis. 19: Roggero, P., Ciuffo, M., Dellavalle, G., Gutta, P., Gallo, S. and Peters, D Additional ornamental species as hosts of Impatiens necrotic spot tospovirus in Italy. Plant Dis. 83: 967. Sakurai, T., Inoue, T. and Tsuda, S Distinct efficiencies of Impatiens necrotic spot virus transmission by five thrips vector species (Thysanoptera: Thripidae) of tospoviruses in Japan. Appl. Entomol. Zool. (Jpn.) 39: Simko, I., Richardson, C. and Wintermantel, W Variation within Lactuca spp. for resistance to Impatiens necrotic spot virus. Plant Dis. doi: /PDIS RE. (In press) Vicchi, V., Fini, P. and Cardoni, M Presence of Impatiens necrotic spot tospovirus (INSV) in horticultural crops in Emilia-Romagna. Informatore Fitopatologico 4: Yang, D. S., Pennisi, S. V., Son, K. C. and Kays, S. J Screening indoor plants for volatile organic pollutant removal efficiency. HortScience 44:
01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio
식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More informationhttp://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
More information(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More information식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu
식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More information(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
More information00내지1번2번
www.keit.re.kr 2011. 11 Technology Level Evaluation ABSTRACT The Technology Level Evaluation assesses the current level of industrial technological development in Korea and identifies areas that are underdeveloped
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.381-404 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.381 A study on Characteristics of Action Learning by Analyzing Learners Experiences
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More information泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여
權 近 의 五 經 인식 - 經 學 과 經 世 論 의 연결을 중심으로 - 姜 文 植 * 1. 머리말 2. 經 學 과 經 世 論 연결의 이론적 기반 3. 五 經 淺 見 錄 의 經 典 해석과 經 世 論 4. 맺음말 요약문 권근( 權 近 )은 체용론( 體 用 論 )에 입각하여 오경( 五 經 ) 간의 관계 및 각 경서의 근본 성격을 규정하였다. 체용론에서 용( 用 )
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More information<313120B9DABFB5B1B82E687770>
한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징
More information141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932 ()()3) 2 1) 1897519( ) ( ) () () () 4) ( ) 5) 6) 15-20 7) 191216 2) ( ) () 42 () 193111 12 1933 4 3)
141(26) 20056 Korean J Med Hist 14131 Jun 2005 ISSN 1225505X ( 1897-1982) * ** 1 ( 1897-1982) ( ) 1) 3 1 ( ) 1930 1930 1930 * () ** 1) ( 2000 p 13-15) 1 141(26) 20056 1930 19 () ( ( ) () () () ) 2) 1932
More information아태연구(송석원)13-2-05.hwp
아태연구 제 13권 제 2호 2006년 11월 30일 pp.81~103 일본에서의 한국학연구 - 회고와 전망 宋 錫 源 경희대학교 사회과학부 정치외교학과 조교수 Ⅰ. 머리말 Ⅱ. 1945년 이전의 한국연구 Ⅲ. 1945년 이후의 한국연구 < 목 차 > Ⅳ. 맺음말 참고문헌 Abstract Key words(중심용어): 한국학(Korean studies), 식민지지배(colonial
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More information:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information06_±è¼öö_0323
166 167 1) 2) 3) 4) source code 5) object code PC copy IP Internet Protocol 6) 7) 168 8) 9)10) 11) 12)13) / / 14) 169 PC publisher End User distributor RPG Role-Playing Game 15) FPS First Person Shooter
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information시안
ULSAN NATIONAL INSTITUTE OF SCIENCE AND TECHNOLOGY GRADUATE SCHOOL OF TECHNOLOGY & INNOVATION MANAGEMENT 울산과학기술원 기술경영전문대학원 http://mot.unist.ac.kr 02 03 Global Study Mission CURRICULUM 2 Practicality Global
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information¹ýÁ¶ 12¿ù ¼öÁ¤.PDF
논문요약 146 [ 주제어 ] 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 abstract Recent Development in the Law of DPRK on the
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과
More information63 19 2 1989 90 2013 3 4 2 54 15 2002 p 19; 1 2008 pp 32 37; 2013 p 23 3 2001 ㆍ 2002 2009 新 興 寺 大 光 殿 2010 2013 2013 4 大 光 殿 壁 畵 考 察 193 1992 ; : 2006
DOI http:ddoi org 10 14380 AHF 2015 41 113 新 興 寺 佛 殿 莊 嚴 壁 畵 考 I. 머리말 朴 銀 卿 동아대학교 인문과학대학 고고미술사학과 교수 규슈대학 문학박사 불교회화사 15 3 3 1 1 * 2013 NRF 2013S1A5A2A03045496 ** : 26 2014; 高 麗 佛 畵 : 本 地 畵 幅 奉 安 問 題 美 術
More information???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
More information민속지_이건욱T 최종
441 450 458 466 474 477 480 This book examines the research conducted on urban ethnography by the National Folk Museum of Korea. Although most people in Korea
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
More informationMain Title
2003 5140001 IMD WCY IMD 2003 (, 54 ), Competitiveness Valuation International, Inc. Korea Partner of IMD WCY jeong@cvikorea.net page 1 2003, Jin-Ho Jeong, CVI, Korea Partner of IMD +41-25-618-0251 Fax
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More informationKD2003-30-01.hwp
韓 國 敎 育 요 약 학술 논문,,,.,...,,,,.,.... 60, 70.,.,,.,,., ( ). (1997), (2000), (1999),. ( ). 1920 1930, ( ),, ( ). ,.. (1925 5 15 19 )..,,,,, ( ).,.. ( ). ( ). < 1>.,,,... 학술 논문,, (,, ),,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * Experiences of Af
Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.201-229 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.201 * Experiences of After-school Class Caring by Married Early Childhood
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information°í¼®ÁÖ Ãâ·Â
Performance Optimization of SCTP in Wireless Internet Environments The existing works on Stream Control Transmission Protocol (SCTP) was focused on the fixed network environment. However, the number of
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationreview050829.hwp
한국무역협회 무역연구소 서울시 강남구 삼성동 무역센터 트레이드타워 4801호 Tel: 6000-5174~9 Fax: 6000-6198 홈페이지 : http://tri.kita.net - 1 - 5 4 (% ) 경상수지(G DP 대 비) 추 이 일본 독일 3 네덜란드 2 1 아일랜드 0-1 -2 [1만불 - 2 만불 달성기간 ] -일본(80-88) -독일(79-90)
More information대한한의학원전학회지23권3호(최종)_100531.hwp
鄭澣1 趙學俊1* 世明大學校 韓醫科大學 原典醫史學敎室1 A Study on the Life, Works and Distinctive Features of Gogobong(高鼓峰)'s medicine Jung Han1 Jo Hak-jun1* 1 Dept. of Korean Medical Classics & Medical History, Semyung University
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More informationJournal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )
Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information2015
2015 34863 85 Tel 042 530 3548 Fax 042 530 3559 Web www djdi re kr/gfcenter/main do 2015 information Graphic Infographics Gender Sensitive 1995 2014 2013 2014 1 2013 2014 SNS SNS 1. 1 1 daejeon DEVELOPMENT
More information상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /
,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information大学4年生の正社員内定要因に関する実証分析
190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationDBPIA-NURIMEDIA
논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information