47-52.hwp

Size: px
Start display at page:

Download "47-52.hwp"

Transcription

1 만성기침환자에서혈청클라미디아항체에대한 ELISA 와 microimmunofluorescence 검사의비교 강원대학교의과대학내과학교실, 강원대학교병원임상의학연구소이희영, 김우진 Enzyme-linked Immunosorbent Assays for Antibodies against Chlamydia Pneumoniae Compared with Microimmunofluorescence Test with Patients with Chronic Cough Hui Young Lee, M.D., Woo Jin Kim, M.D. Department of Internal Medicine, College of Medicine, Kangwon National University and Clinical Research Institute, Kangwon National University Hospital Background : Chlamydia pneumoniae is a clinically important pathogen, the diagnosis of such infection being based mainly on serology. Microimmunofluorescence (MIF) is the current standard diagnostic method, but is subjective and time-consuming, so the authors tested the serology of chronic cough patients using an EILSA method for the Chlamydial antibody, which is a more objective method, and compared the results with those of the standard method. Method : Thirty-five patients, who visited Kangwon National University Hospital between August 2003 and July 2004, were evaluated. A MIF and ELISA tests were used to determine C. pneumoniae antibody titers. Nasopharyngeal aspirates were examined by polymerase chain reaction (PCR). The Spearman rank correlation test was used for data analysis. Results : Sensitivities of ELISA for IgG, IgA and IgM, as judged by MIF, were 84.0, 84.0 and 40.0% and the specificities were 60.0, 60.0 and 96.7%, respectively. Three patients were Chlamydia PCR positive. Conclusion : ELISA can be a useful tool for studying the seroprevalence of Chlamydia pneumoniae. However, further studies will be required prior to its clinical use. (Tuberc Respir Dis 2005; 59: 47-52) Key words : Chlamydophila pneumoniae, Enzyme Linked Immunosorbent assay 서 클라미디아폐렴균은지역사회폐렴의약 10% 에서원인균이며 1 성인의 70% 까지혈청양성소견을보여 2 이전에클라미디아폐렴균에감염되었거나만성감염으로유지되는경우가많은것으로사료된다. 특히최근클라미디아폐렴균에대한혈청양성이동맥경화와관련된다는보고가있고 3, 만성호흡기증상과관련된다는보고와 4 폐암의위험요인이된다는보고도있어 5, 앞으로도클라미디아폐렴균의, 동맥경화와폐 2004년도강원대학교학술연구조성비로연구하였음 Address for correspondence : Woo Jin Kim, M.D. Department of Internal Medicine, Kangwon National University Hospital, 17-1 Hyoja-3 Dong, Chunchon-Si, Kangwon-Do, , Korea Phone : Fax : pulmo2@knuh.or.kr Received : Jan Accepted : Jun 론 질환에대한역할에대해많은임상적, 역학적연구가요구되고있다. 클라미디아폐렴의진단에있어, 클라미디아폐렴균의배양이매우어렵고, polymerase chain reaction (PCR) 은좀더민감하지만아직진단적으로인정받지는못하고있어, 현재까지혈청검사가진단에가장중요하게이용된다. 그중에서 microimmunofluore scence(mif) 검사법이표준으로되어있다 6. 그러나, 이검사는시간이많이소요되며, 주관적이며많은경험이요구된다는단점이있다. 특정질환과클라미디아폐렴균과의관계를연구하기위해특정질환에서의혈청학적유병률을연구하게되는데, 이경우많은환자를대상으로하게되고이경우좀더객관적이며한번에많은수의검사를시행할수있는 Enzyme-Linked Immunosorbent assay (ELISA) 가더유리할수있다. 그러나, 클라미디아폐렴의진단에서는 MIF 이외에는표준진단으로인정받지못하고있다 6. 47

2 HY Lee et al.: Comparison of ELISA and microimmunofluorescence for Chlamydia antibody MIF와 ELISA 를비교한최근연구는정상인은대상으로하거나 7,8, 호흡기감염이있는환자들을대상으로 9 시행되었다. 클라미디아혈청검사의경우, 호흡기감염을가진환자이외에도동맥경화, 만성호흡기질환과의관련성을알기위해시행되는데, 이런대상에서 MIF와 ELISA를비교한연구는거의없다. 만성기침과클라미디아폐렴균과의관계는아직논란이있는상태로, 만성기침을호소하는환자들에서두가지검사법으로검사를진행하여 ELISA 검사법이표준검사법과비교하여정확도가어떤지를평가하기위하여연구를진행하였다. 서반응시킨후, PBS로세척하고, 다시 FITC-con jugated anti-ig G, A, M 으로 1시간동안반응하고, 세척한후형광현미경으로 200배시야에서관찰하였다. IgM 검사에는비특이적반응을없애기위해 RF absorbent(dade Behringer, Marburg, Germany) 를처리하여 15분간미리반응시켰다. 정성적인비교를위해 Ig G, A, M 모두 이상을양성으로판정하였다. 정량적인비교를위해서는 MIF 역가를구하였다. 4. PCR 방법 1. 혈청 3주이상지속되는만성기침을주소로 2003년 8월부터 2004년 7월까지강원대학교병원을방문한 35명의성인환자에서얻은혈청으로검사를시행하였다. 흉부방사선사진에서이상소견이발견된환자는제외하였다. 혈청은검사에사용하기까지 -70 에서보관하였다. 본연구는강원대학교병원임상연구위원회의승인을얻었다. 2. ELISA 환자의비인두에서스왑으로얻은검체를원심분리하여원침에서 DNA를추출하였고, Gaydos 등 11 에의한방법으로 PCR을시행하였다. PCR 조건은 primer CPN90 5' GGTCTCAACCCCATCCGTGTCGG 3', CPN91 5'TGCGGAAAGCTGTATTTCTACAGTT 3' 을첨가하여, denaturation은 94 에서 15분, annealing 62 에서 52 로 touchdown 법으로시행하였고, ex tension은 72 에서 1분간시행하였다. 5. 통계 Spss(ver. 10.0) 으로 ELISA I.D 수치와 MIF의역가에대하여비모수상관계수분석 (Spearman) 을하였다. 준비된혈청을클라미디아폐렴균에대한 IgG, IgA, IgM 항체에대하여 Hitazyme Cpn kit(hitachi chemical, Tokyo, Japan) 을이용하여정량적으로 3회측정하여평균을구하였다. 측정치가 IgG, IgA는 1.10 이상이면양성으로, IgM은 1.60 이상이면양성으로판정하였다 MIF 결과 1. 대상환자총환자수는 35명 ( 남자13, 여자22) 평균나이는 50.0 ± 18.7 세이었고, 흡연력은평균 3.2 ± 6.0 갑년이었다. 병력으로고혈압이 5명, 당뇨가 2명, 결핵이 1명이었다. 순수분리하여 0.03% 포르말린으로고정한 C. pne umoniae(ar-39), C. trachomatis(l2), C. psittaci 의 elementary body(eb) 를유리슬라이드에항원으로올리고, 순차적으로희석한혈청을 1시간동안 37 에 2. IgG ELISA 로양성인환자가 24명, MIF로양성인환자가 33명이었다 (Table 1). MIF 결과를 gold standard 48

3 Tuberculosis and Respiratory Diseases Vol. 59. No. 1, Jul Table 1. Results of C. mneumoniae serology by microimmunofluorescence and ELISA Number IgG IgA IgM ELISA MIF ELISA MIF ELISA MIF :128 1:1024 < 1: < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < < 로하였을때, ELISA 검사의위양성은없었고, 위음성이 9명있어 74.3% 의일치율을보였다. 민감도는 72.7%, 특이도는 100% 이었다. 상관계수는 0.846(p< 0.05) 이었다. 3. IgA 4. IgM ELISA 로양성인환자가 3명, MIF로양성인환자가 5명이었다. 위양성이 1명, 위음성이 3명이었다. 민감도는 40.0%, 특이도는 96.7% 이었다. 일치율은 88.6% 이었다. 상관계수는 0.300(p=0.08) 이었다. ELISA로양성인환자가 25명, MIF로양성인환자가 25명이었다. 위양성이 4명, 위음성이 4명이었고일치율은 77.1% 이었다. 민감도는 84.0%, 특이도는 60.0% 이었다. 상관계수는 0.433(p<0.05) 이었다. 5. PCR 3명의환자에서 PCR 양성소견을보였다 (Fig. 1). 이들의혈청은 IgG는두명이 1:128에서, 한명이 에서양성이었고 IgA는모두 에서양성이었고, 49

4 HY Lee et al.: Comparison of ELISA and microimmunofluorescence for Chlamydia antibody Figure 1. PCR for C. pneumoniae from nasopharyngeal swabs. Lane 1, 2 and 4 are positive samples for C. pneumoniae, lane 3 is negative sample and lanes 5 and 6 are negative and positive controls, respectively. IgM 역가는모두음성이었다. 고 본연구에서는 ELISA로시행한만성기침환자의클라미디아폐렴균에대한항체가를기존의표준검사인 MIF법과비교하여 IgG는민감도 84.0%, 특이도 60.0%, IgA는민감도 84.0%, 특이도 60.0%, IgM은민감도 40.0%, 특이도 96.7% 의결과를보였다. 이전의연구에서는 Numazaki 등이소아를대상으로 ELISA 를 MIF와비교한연구에서 IgG는 90.4% 의민감도와 89.9% 의특이도를보였고, IgA는 84.6% 의민감도와 86.7% 의특이도를보였다 7. 또한, 유럽에서건강인을대상으로한이전의연구에서는 ELISA kit 의종류에따라 % 의민감도와 % 의특이도를보였다 8. 같은그룹에서호흡기감염환자를대상으로시행한연구에서는역시 ELISA의종류에따라차이가있지만 90% 이상의일치율을보였다 9. 본연구는만성기침환자들을대상으로한연구였고, 이들을대상으로혈청역학적연구를 ELISA로시행할때참고가될수있을것이나, 정상대조군이나다른대상군에적용하는경우는추가연구가필요할것으로사료된다. MIF법은순수분리하여포르말린으로고정한 EB 를슬라이드에부착시켜항원항체반응을측정하는것이고, ELISA는일부특이항원을이용한다는점에서방법상의근본적인차이가있다. 본연구에서이용한 ELISA kit는 complex outer membrane complex 를항원으로이용한것으로순수분리한클라미디아폐렴균의 EB로부터 Sarkosyl buffer를이용하여제조하였 찰 다 10,12. 유럽에서제조한 ELISA kit는전체항원또는 recombinant lipopolysaccharide(lps) 등을항원으로이용하였고, LPS의경우에는민감도, 특이도가떨어진다는결과를보였다 9. 본연구에서 IgG의위음성은 (+) 에서 2예, (+) 에서 2예, (+) 에서 5예였다. 1:128이상의높은역가에서위음성을보인예는없었다. 이전의연구에서도대부분낮은역가에서만불일치를보이고있다. IgM의경우는위양성이문제가되는경우가많다. MIF의경우 RF absorbent를처리하여 IgG와 IgG 면역복합체와반응하는 IgM을제거하고, ELISA kit 역시비슷한원리로비특이적인항체를제거하는단계를거친다. 본연구의결과에서 IgM에대한 ELISA 의민감도가낮게나왔다고해석할수도있지만, 대상환자들이흉부방사선상정상인만성기침환자임을감안하면일부환자의 MIF가위양성일가능성이높음을시사한다. 또한, 상관관계가통계적으로의미없는수치로나온것이비특이적항체를제거하는방법의차이가영향을주었을가능성이있다. 본연구는만성기침환자를대상으로항체역가를비교하였다. 혈청학적기준으로이들환자들의 25% 가급성감염, 54% 가만성감염으로판단된다. 혈청학적양성의빈도는지역에따른차이를보이고있다. 이전의연구에서만성기침을대상으로클라미디아혈청검사를하여일본에서는 6.5% 가급성감염이라는보고가있었고, 미국의응급실에서시행한연구에서는 20% 가급성감염이었다. 유럽에서는 4% 가급성감염이고, 46% 가만성감염이었다는보고가있다 본연구에서는 3명 (8.6%) 의환자에서 PCR 양성을보였다. 이들의항체가는 IgG가, 에서양성이고 IgM은모두 미만이었다. 회복기의혈청검사가없다는한계가있으나, PCR 양성으로나온환자에서혈청학적으로급성감염의증거는없었다. 이전보고에서일본에서의만성기침환자에서는 5.5% 가 PCR 양성이었고 14, 유럽의연구에서는 1.5% 가 PCR 양성이었다 15. 클라미디아폐렴의진단에서 PCR은아직표준화된방법이정립되지는않았다. 외국의가이드라인에따르면 4가지가비교적신뢰성있는방법으로평가되고있고 6, 본연구에서도이중의한방법을이용 50

5 Tuberculosis and Respiratory Diseases Vol. 59. No. 1, Jul 하였다. PCR을이용한폐렴원인균의진단은아직은정확도가떨어지고, 임상에서의이용은제한되고있다 1. 또한, 클라미디아폐렴균은이전의감염이있었던환자에서도검출될수있다는연구보고도있어 16, 해석상의주의를요한다. 결론적으로, 항원성의차이가있을수있음에도불구하고 MIF법과 ELISA 법은혈청 IgG와 IgA 양성이비교적일치하였다. 좀더객관적인 ELISA 검사로많은환자들을대상으로하는혈청역학적연구에서는좀더유용하게이용될수있을것으로사료된다. 하지만임상적인폐렴의진단에이용되기위해서는 IgM의결과가좀더나아져야할것이고, 항체역가의 4배증가를 ELISA의수치변화에적용할수있을지는좀더연구가필요할것으로사료된다. 요약연구배경 : 클라미디아폐렴균은임상적으로중요한균으로혈청검사가진단에중요하다. 현재이용되는 micro immunofluorescence 법은주관적이고시간이많이소요되므로좀더객관적으로진단할수있는 ELISA 법을이용하여만성기침을주소로내원한환자들의혈청을대상으로검사하고표준방법과결과를비교하였다. 방법 : 2003년 8월부터 2004년 7월까지강원대학교병원을방문한 35명의성인환자에서얻은혈청을 ELISA 법과 micoimmunofluorescence 법으로시행하였다. 비인두스왑에서 PCR을시행하였다. 두방법의비교는비모수상관계수분석 (Spearman) 을하였다. 결과 : ELISA 검사결과 IgG는민감도 84.0%, 특이도 60.0%, IgA는민감도 84.0%, 특이도 60.0%, IgM은민감도 40.0%, 특이도 96.7% 의결과를보였다. PCR은 3 명의환자에서양성이었다. 결론 : ELISA법이많은환자들을대상으로하는역학적연구에서는좀더유용하게이용될수있을것으로사료된다. 임상적으로적용되기위해서는좀더연구가 필요할것으로사료된다. 참고문헌 1. File TM. Community-acquired pneumonia. Lancet 2003;362: File TM, Tan JS, Plouffe JF. The role of atypical pa thogens: Mycoplasma pneumonia, Chlamydia pne umoniae and Legionella pneumophila in respiratory infection. Infect Dis Clin North Am 1998;12: Saikku P, Leinonen M, Mattila KJ, Ekman MR, Nieman MS, Makela PH, et al. Serological evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction. Lancet 1988;2: Falck G, Gnarpe J, Hansson LO, Svardsudd K, Gnarpe H. Comparison of individuals with and with out specific IgA antibodies to Chlamydia pneumoniae. Chest 2002;122: Kocazeybek B. Chronic Chlamydophila pneumoniae infection in lung cancer, a risk factor: a case-control study. J Med Microbiol 2003;52: Dowell SF, Peeling RW, Boman J, Carlone GM, Fields BS, Guarner J, et al. Standardizing Chlamydia pne umoniae assays: recommendations from the centers for disease control and prevention and the labor atory centre for disease control. Clin Infect Dis 2001; 33: Numazaki K, Ikebe T, Chiba S. Detection of serum antibodies against by Chlamydia pneumoniae ELISA. FEMS Imunol Med Microbiol 1996;14: Hermann C, Graf K, Groh A, Straube E, Hartung T. Comparison of eleven commercial tests for Chlamydia pneumoniae-specific immunoglobulin G in asympto matic healthy individuals. J Clin Microbiol 2002;40: Hermann C, Gueinzius K, OehmeA, von Aulock S, Straube E, Hartung T. Comparison of quantitative and semiquantitative enzyme-linked immunosorbent assays for immunoglobulin G against Chlamydia pne umoniae to a microimmunofluoresence test for use with patients with respiratory tract infections. J Clin Microbiol 2004;42: Kishimoto T, Matsushima T, Morikawa T, Kawagoe K. Assay of specific anti-chlamydia pneumoniae antibodes by ELISA method: 3. setting of serological criteria. Kansenshogaku Zasshi 1999;73: Gaydos CA, Quin TC, Eiden JJ. Identification of Chlamydia pneumonia by DNA amplification of the 16S rrna gene. J Clin Microbiol 1992;30: Caldwell HD, Kromhout J, Schachter J. Purification 51

6 HY Lee et al.: Comparison of ELISA and microimmunofluorescence for Chlamydia antibody and partial characterization of the major outer mem brane of Chlamydia trachomatis. Infect Immun 1981; 31: Wright SW, Edwards KM, decker MD, Grayston JT, Wang S. Prevalence of positive serology for acute Chlamydia pneumonia infection in emergency de partment patients with persistent cough. Acad Emerg Med 1997;4: Birkebaek NH, Jensen JS, Seefeldt T, Degn J, Hu niche B, Andersen PL, et al. Chlamydia pneumonia infection in adults with chronic cough compared with healthy blood donors. Eur Respir J 2000;16: Miyashita N, Fukano H, Yoshida K, Niki Y, Matsu shima T. Chlamydia pneumonia infection in adult patients with persistent cough. J Med Microbiol 2003; 52: Menendez R, Cordoba J, Cuadra P, Cremades MJ, Lopez-hontagas JL, Slavert M, et al. Value of the polymerase chain reaction assay in noninvasive res piratory samples for diagnosis of community-acqu ired pneumonia. Am J Respir Crit Care Med 1999; 159:

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

歯채민병.PDF

歯채민병.PDF Patient number Sex Age Animal contact 1 F 36 No 2 F 31 Cat scratch Result of biopsy/aspiration cytology of lymph nodes Chronic granulomatous inflammation with caseation necrosis, compatible with tuberculous

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie

Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung

More information

<30382EC0C7C7D0B0ADC1C22E687770>

<30382EC0C7C7D0B0ADC1C22E687770> 대한내과학회지: 제 76 권 제 2 호 2009 의학강좌-개원의를 위한 모범처방(Current Clinical Practice) 간기능검사의 이해와 적용 인제대학교 의과대학 일산백병원 내과학교실 김 경 아 Understanding and application of liver function tests Kyung-Ah Kim, M.D. Department of

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

308 박주원 김재경 임인수외 1 인 험적항생제요법이사용되므로질환초기의신속한감별진단이중요하다. 특히소아에서심각한임상양상을나타낼수있는지역사회획득폐렴 (community-acquired pneumonia, 원외폐렴 ) 의경우주요세균성원인으로는 Streptococcus pn

308 박주원 김재경 임인수외 1 인 험적항생제요법이사용되므로질환초기의신속한감별진단이중요하다. 특히소아에서심각한임상양상을나타낼수있는지역사회획득폐렴 (community-acquired pneumonia, 원외폐렴 ) 의경우주요세균성원인으로는 Streptococcus pn 대한진단검사의학회지제 29 권제 4 호 2009 Korean J Lab Med 2009;29:307-13 DOI 10.3343/kjlm.2009.29.4.307 Original Article Clinical Microbiology 소아의세균성호흡기감염의진단을위한 Seeplex TM Pneumobacter Multiplex PCR 키트의평가 박주원 김재경 임인수

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

노영남

노영남 Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

약수터2호최종2-웹용

약수터2호최종2-웹용 Contents 06 08 11 14 17 17 18 19 23 28 28 33 37 41 45 45 51 56 59 64 66 72 80 26 29 31 34 35 35 38 39 40 42 43 43 46 46 47 49 50 51 52 53 54 56 57 59 60 61 62 69 73 74 77 78 79 14 15 25 36 48 06 07 08

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w 497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

untitled

untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

ºÎÁ¤¸ÆV10N³»Áö

ºÎÁ¤¸ÆV10N³»Áö case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

44-4대지.07이영희532~

44-4대지.07이영희532~ A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

°Ç°�°úÁúº´6-13È£ÀÛ¾÷

°Ç°�°úÁúº´6-13È£ÀÛ¾÷ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 13 www.cdc.go.kr 2013 3 29 6 13 ISSN: 2005-811X 10-years of Hepatitis B Perinatal Transmission Prevention

More information

Rheu-suppl hwp

Rheu-suppl hwp Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

1. 서론 1-1 연구 배경과 목적 1-2 연구 방법과 범위 2. 클라우드 게임 서비스 2-1 클라우드 게임 서비스의 정의 2-2 클라우드 게임 서비스의 특징 2-3 클라우드 게임 서비스의 시장 현황 2-4 클라우드 게임 서비스 사례 연구 2-5 클라우드 게임 서비스에

1. 서론 1-1 연구 배경과 목적 1-2 연구 방법과 범위 2. 클라우드 게임 서비스 2-1 클라우드 게임 서비스의 정의 2-2 클라우드 게임 서비스의 특징 2-3 클라우드 게임 서비스의 시장 현황 2-4 클라우드 게임 서비스 사례 연구 2-5 클라우드 게임 서비스에 IPTV 기반의 클라우드 게임 서비스의 사용성 평가 - C-Games와 Wiz Game 비교 중심으로 - Evaluation on the Usability of IPTV-Based Cloud Game Service - Focus on the comparison between C-Games and Wiz Game - 주 저 자 : 이용우 (Lee, Yong Woo)

More information

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15

목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 체외진단용의료기기 ( 인플루엔자바이러스및 A형간염바이러스 ) 의허가 심사가이드라인 2015. 2. 의료기기심사부체외진단기기과 - 1 - 목차 Ⅰ. 개요 1 Ⅱ. 용어의정의 4 Ⅲ. 관련규정 13 Ⅳ. 신청서기재항목및기술문서제출자료 14 Ⅴ. 제조 수입허가신청서기재항목 15 Ⅵ. 기술문서등의심사를위한제출자료 37 Ⅶ. 성능시험에대한상세사항 44 Ⅷ. 참고문헌

More information

보건사회연구-25일수정

보건사회연구-25일수정 30(1), 2010, 220-241 Health and Social Welfare Review...... * :, (slee@kangnam.ac.kr) 220 ( ) 5.. (, 2005;, 2006;, 2006;, 2007), (, 2004;, 2005;, 2007;, 2007), (, 2005, 2009;, 2005;, 2005;, 2008).....

More information

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>

<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770> 醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의

More information

대한한의학원전학회지26권4호-교정본(1125).hwp

대한한의학원전학회지26권4호-교정본(1125).hwp http://www.wonjeon.org http://dx.doi.org/10.14369/skmc.2013.26.4.267 熱入血室證에 대한 小考 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 韓醫學古典硏究所 白裕相1, 2 *117) A Study on the Pattern of 'Heat Entering The Blood Chamber' 1, Baik 1

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

866 제7권 제39호 사례가 있다[11]. 성별 발생 비율은 여성보다 남성에서 많이 발생하며, 흑인보다 백인에서 많이 발생하는 것으로 알려져 있다[12]. AIDP는 서구 선진국의 연령이 높은 군에서 발생률이 높으나, AMAN의 경우에는 소아와 청년층에서 발생률이 높

866 제7권 제39호 사례가 있다[11]. 성별 발생 비율은 여성보다 남성에서 많이 발생하며, 흑인보다 백인에서 많이 발생하는 것으로 알려져 있다[12]. AIDP는 서구 선진국의 연령이 높은 군에서 발생률이 높으나, AMAN의 경우에는 소아와 청년층에서 발생률이 높 주간 건강과 질병 865 국내 길랑-바레 증후군 환자에 대한 캠필로박터 제주니 혈청학적 진단 검사 Serological diagnosis of Campylobacter jejuni in Guillain-Barré syndrome patients in Korea 질병관리본부 국립보건연구원 감염병센터 수인성질환과 이선진, 김종현 Abstract Background:

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of

More information

Microsoft PowerPoint - S5-04 푒뀴욟 짗뉨과 칟룄_ìš´ì−¹íŸ—_10_22_최좖.ppt [ퟸ펟 모ëfiœ]

Microsoft PowerPoint - S5-04 푒뀴욟 짗뉨과 칟룄_ìš´ì−¹íŸ—_10_22_최좖.ppt [ퟸ펟 모ëfiœ] 폐렴의진단과치료 경희대병원호흡기내과 이승현 정의및서론 폐실질조직에감염으로인해발생한염증 세균, 바이러스, 진균, 기생충.. 지역사회획득폐렴의사망률 : 12 14% ( 감염으로인한사망중 1 위 ) 고령층에서는더높은사망률 면역억제자에서의폐렴증가 (HIV 감염, 항암치료, 장기이식수혜자등 ) 병리기전 Mechanism host factor pathogen 1. Microaspiration

More information

¼Û±âÇõ

¼Û±âÇõ 223 Table 1. Results of FEV 1.0, Methacholine Challenge Test, and Exercise Provocation Test in Eight Patients Who Performed PFT Pts Tests 1 2 3 4 5 6 7 8 FEV 1.0 (%pred) 66.6 88.8 120 101 90.5 95.4 91.6

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

서론

서론 - i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

책임연구기관

책임연구기관 2009. 2. 책임연구기관 - i - - ii - - iii - - iv - 6.3.1 Sample Collection and Analysis 161 6.3.1.1 Sample Collection 161 6.3.1.2 Sample Analysis 161 6.3.2 Results 162 6.3.2.1 Dalian 162 6.3.2.2 Xiamen 163 6.3.3

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소 1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지

More information

pissn: eissn: Allergy Asthma Respir Dis 3(5): , September ORIGINAL ARTICLE

pissn: eissn: Allergy Asthma Respir Dis 3(5): , September ORIGINAL ARTICLE pissn: 2288-0402 eissn: 2288-0410 3(5):346-351, September 2015 http://dx.doi.org/10.4168/aard.2015.3.5.346 ORIGINAL ARTICLE 급성호흡기감염으로입원한소아환자에서 Chlamydia pneumoniae 의임상양상 : Mycoplasma pneumoniae 와의비교 성재진,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:

Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120: Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

<31325FB1E8B0E6BCBA2E687770>

<31325FB1E8B0E6BCBA2E687770> 88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

pissn: eissn: Allergy Asthma Respir Dis 6(5): , September ORIGINAL ARTICLE Po

pissn: eissn: Allergy Asthma Respir Dis 6(5): , September ORIGINAL ARTICLE Po pissn: 2288-0402 eissn: 2288-0410 6(5):248-254, September 2018 https://doi.org/10.4168/aard.2018.6.5.248 ORIGINAL ARTICLE Polymerase chain reaction 양성소아마이코플라스마폐렴에서혈청 IgM enzyme-linked immunosorbent assays

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

°Ç°�°úÁúº´5-44È£ÃÖÁ¾ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

Jkafm093.hwp

Jkafm093.hwp 가정의학회지 2004;25:721-739 비만은 심혈관 질환, 고혈압 및 당뇨병에 각각 위험요인이고 다양한 내과적, 심리적 장애와 연관이 있는 질병이다. 체중감소는 비만한 사람들에 있어 이런 위험을 감소시키고 이들 병발 질환을 호전시킨다고 알려져 있고 일반적으로 많은 사람들에게 건강을 호전시킬 것이라는 믿음이 있어 왔다. 그러나 이런 믿음을 지지하는 연구들은

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

大学4年生の正社員内定要因に関する実証分析

大学4年生の正社員内定要因に関する実証分析 190 2016 JEL Classification Number J24, I21, J20 Key Words JILPT 2011 1 190 Empirical Evidence on the Determinants of Success in Full-Time Job-Search for Japanese University Students By Hiroko ARAKI and

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information