Microsoft Word - 순2-10.doc
|
|
- 재홍 채
- 5 years ago
- Views:
Transcription
1 증례 Korean Circulation J 2003;33(2): SCN5A 유전자의 Missense 돌연변이를가진 1 가계 원광대학교의과대학생화학교실, 1 내과학교실 2 신창호 1 김남호 2 김경희 1 유수성 1 최용복 1 오석규 2 홍경만 1 정진원 2 백문기 1 A Family with A Missense Mutation in the SCN5A Gene Chang Ho Shin, PhD 1, Nam-Ho Kim, MD 2, Kyung-Hee Kim, BS 1, Su-Sung Yoo, BS 1, Yong-Bock Choi, MS 1, Seok Kyu Oh, MD 2, Kyeong-Man Hong, MD 1, Jin-won Jeong, MD 2 and Moon-Kee Paik, MD 1 1 Departments of Biochemistry and 2 Internal Medicine, Wonkwang University School of Medicine, Iksan, Korea ABSTRACT Brugada syndrome, an autosomal dominantly inherited form of ventricular fibrillation, is characterized by STsegment elevation in leads V1-3 and right bundle-branch block on surface electrocardiogram. It is caused by mutations in the cardiac sodium channel gene, SCN5A, and to the best of our knowledge, there has been no report of this mutation in Korea. Three members of a family were heterozygous for a G to T substitution at the nucleotide position 5851 in exon 28 of the SCN5A gene. This nucleotide alteration makes a missense mutation, leading to a valine to leucine substitution (V1951L), in the carboxy terminal region of the sodium channel a subunit. We report here a missense mutation in a Korean family with Brugada-type electrocar-diogram. (Korean Circulation J 2003;33(2): ) KEY WORDS:Brugada syndrome;ventricular fibrillation;sodium channels;mutation. 서 논문접수일 :2002 년 09 월 04 일심사완료일 :2002 년 10 월 24 일교신저자 : 김남호, 전북익산시신용동 원광대학교의과대학내과학교실전화 :(063) 전송 :(063) cardionh@wonkwang.ac.kr 론 심전도소견상특징적인우각차단양상과우흉부유도상 (V 1-3) ST절의상승소견을보이면서심실세동에의한심인성급사의특징적인임상경과를보이는환자들을 Brugada 증후군이라한다. 1)2) 이들환자의경우, 심근세포막에존재하는소디움이온통로 (sodium channel) 의 alpha subunit를부호화 (encoding) 하는 SC- N5A, 3p21 유전자에돌연변이가있음이확인되었다. 3-11) 국내에서도 Brugada 증후군이 2례가보고된적이있으나, 12) 소디움이온통로유전자의돌연변이에대한보고는없다. 본저자들은한가족에서나타난 SCN5A 유전자의돌연변이를발견하였기에보고하는바이다. 증례 환자 : 이 진, 남자 41세. 주소 :12유도심전도상우각차단과우흉부유도 (V 1-3 ) 에서 ST절상승. 150
2 Fig. 1. The 12-lead electrocardiogram of the proband shows J point elevation and incomplete right bundle branch block in V1-3. 과거력 및 가족력 실신 및 돌연사 등의 특이한 병 력은 없었다. Amp PCR system 2400, Perkin Elmer, USA)를 사 용하여 95 에서 3분간 DNA를 처리시킨 후 94 에 현병력 평소 건강하게 지내던 환자는 내원 3일 전 서 30초간 변성(denaturation), 61 에서 30초간 보 부터 발생한 고열과 기침으로 폐렴 진단하에 치료하던 합(annealing), 72 에서 30초간 확장(extension)과 중 우연히 발견한 심전도상의 이상으로 본원에 내원하 정을 35회 반복하였고, 마지막 과정에서는 72 에서 7 였다. 분간 유지시킨 후 정지시켰고, 3 primer set을 이용하 진찰소견 및 경과 이학적 검사 및 혈액 검사에서 특 여 SCN5A 유전자의 exon 28번을 증폭하였다. 이때 이 소견 없었으며, 심전도상 전형적인 Brugada 형태의 사용된 primer는 1F GCACTGTGCTCTCGGACA- 심전도를 보였다(Fig. 1). 환자의 부모, 아들, 그리고 TC, 1R CACGCTGAAGTTCTCCAGGA, 2F A 딸에게서 심전도 검사를 실시하였으나 특이한 심전도 GC-CGTGGGCATCCTCTTCT, 2R GACACC- 양상은 없었으며, 소디움 차단제를 이용한 유발검사는 TCTT-CGTGCTTGCG, 3F ATGGACGCCCTG- 시행하지 못하였다. 모든 대상자는 심초음파 검사, 신 AAGA-TCCA, 3R TCACACGATGGACTCACG- 호 평균화 심전도에서 특이소견 없었다. 환자는 심실 GT이었다. 증폭된 PCR산물을 1.0% agarose gel에서 빈맥 유발 유무를 확인하기 위하여 심전기 생리검사를 전기영동 후 증폭된 DNA band를 절제하여 Gel ext- 권유하였으나 거부한 상태에서 특별한 약물치료 없이 raction kit(necleogen Biotechnoloy, Korea)을 이용 1년째 추적 관찰 중이다. 하여 세척 분리하였다. DNA 분리 환자의 가족 5명을 대상으로 유전체 연 돌연변이 확인 약 30 ng template DNA을 이용하 TM 구에 대한 동의서를 획득후 혈액을 채취하였다. EDTA 였다. ABI PRISM BigDye 관에 채혈한 혈액은 원심 분리하여 buffy coat 층을 분 quencing ready reaction kit(applied Biosystems, 리하고, 같은 양의 phosphate buffered saline를 첨가 Foster City, Calif. USA)을 이용하여 ABI PRISM 하여 혼합한 뒤 원심 분리하여 적혈구를 함유한 상층액 BigDye 을 제거하였다. 분리된 Buffy coat에 STE 500 μl, ems)로 DNA 염기순서 분석을 실시하였다. 3번 염색 proteinase K 40 μl, 20% SDS 40 μl를 가해 침전 체의 소디움 이온 통로의 유전자인 SCN5A에서 mis- 시킨 후 phenol 및 chloroform를 가해 정제 후 cold sense 돌연변이가 아버지, 계보발단자, 그리고 딸에게 100% ethanol을 넣어 DNA를 침전시켰다. 다시 원심 서 확인되었다. 이 3명은 SCN5A 유전자의 exon 28의 분리하여 상층액을 버리고 70% ethanol로 washing nucleotide position 5851에서 G/T 치환이 일어난 이 한 뒤 DNA를 추출하였다. 형 접합(heterozygote)이었다. 이러한 nucleotide의 중합효소연쇄반응(PCR) 자동 온도조절기(Gene- TM terminator cycle se genetic analyzer(applied Biosyst- 변형은 c-terminus에서 valine을 leucine으로 치환하는 151
3 A B Fig. 2. Mutation detection in a family. A:pedigree of a family. B:DNA sequence analysis of genomic DNA identifies a G-to-T base substitution (arrow) in exon 28 of SCN5A, leading to an amino acid substitution of valine by leucine at codon 1951 (V1951L). Fig. 3. SCN5A mutation identified. The location of the V1951L mutation is indicated. missense 돌연변이를일으켰다 (V1951L)(Fig. 2, 3). 152 고 Brugada 증후군은심전도상특징적인우각차단과우흉부유도에서 ST절의상승소견을갖으면서돌연사를일으키는질환이다. 1)2) 최근에알려지기시작한질환으로그유병율과발생빈도는아직정확하지않다. 일반적으로남자에서, 특히동양인과백인에서그발생 찰 빈도가높은것으로알려져있다. 25% 의경우에는유전적경향의확인이어려우며, 약 15% 정도에서는가족력을확인할수없는것으로알려져있다. 돌연사의 4~ 12%, 특히구조적으로심장이정상인경우에는 50% 이상이 Brugada 증후군이돌연사의원인일것으로생각한다. 현재까지알려진바에의하면 Brugada 증후군의 25% 가계에서상염색체우성형태의유전양상이확인되고있으며, 따라서이론적으로환자의자손중약 50% 에서 Brugada 증후군이나타날확률을지닌다. 1)2)11)13)14) Brugada 증후군에서 SCN5A의돌연변이는 splicedonor, frame-shift, 그리고 missense의 3가지형태가보고되고있다. 3-11) T1620M 돌연변이는소디움통로의 DⅣS3와 DⅣS4 사이의 extracelluar loop 에서 threonine이 methionine에의해치환되어 steadystate inactivation curve 를우측으로이동시킴으로써소디움통로를정상통로보다빨리불활성화시킨다. 3) R1512W 돌연변이는소디움통로의불활성화관문으로알려져있는 DⅢ-Ⅳ linker에서불활성화의회복과불활성화을더욱느리게한다. 4) R1432G는소디움통로의발현을폐지함으로써소디움통로의기능을소실시킨다. 15) 또한 1795insD 돌연변이는소디움통로의전류를감소시킨다. 16) 이와같이 SCN5A 유전자의돌연변이로인해정상적기능의소디움통로의수적감소혹은그기능자체의이상을통해심근세포단위에서재분극과정의이상을초래함으로써 Brugada 증후군을유발할것으로생각한다. 3)17-20) 하지만, 이러한유전자의돌연변이가 Brugada 증후군을유발하는직접적인기전에대해서는아직명확하지않다. 21)22) 본저자들은심전도상우각차단과우흉부유도에서 ST절상승이있는환자의가계에서 1개의돌연변이를발견하였다. 아버지, 계보발단자, 딸에게서소디움통로의 α subunit carboxy terminal 부위에서모두동일한 missense 돌연변이 (V1951L) 가관찰되었다. 아버지와딸에게서는특징적인심전도의발현이안되었는데이는소디움차단제를사용하여유발검사가필요할것으로생각된다. 본연구에서는이러한소디움통로유전자의돌연변이가소디움채널의기능에영향을주어심전도상변화를나타내는기전에대해서는직접적인확인은하지못하였으나, Priori 등 11) 이 Brugada 증후군에서같은부위의돌연변이 V1951L을보고한적 Korean Circulation J 2003;33(2):
4 이있다. 향후에는이러한 SCN5A의돌연변이가기능적으로소디움이온통로에어떠한영향을미치는지에대해서추후연구가되어야할것이다. 이러한제한점에도불구하고국내에서는처음으로 Brugada 형태의심전도를갖는환자의가계에서소디움이온통로의유전자돌연변이를발견하여보고하는바이다. 요 Brugada 증후군은심전도상우각차단과우흉부유도상 ST절상승소견이관찰되고돌연사를일으키는질환이다. 상염색체우성으로유전되고심장소디움통로의 SCN5A 유전자에돌연변이를일으키는것으로알려져있다. 그러나국내에서는소디움이온통로유전자의돌연변이가아직보고된바없다. 계보발단자는우연히발견된 Brugada 형태의심전도를주소로내원하여부모, 두자녀들을포함하여혈액검사로 DNA sequencing을실시하였다. 아버지, 계보발단자, 딸에게서공통적으로 SCN5A 유전자의 exon 28의 nucle-otide position 5851에서염기치환 (G/T) 에의해 C-terminus 에서 valine 을 leucine 으로치환하는 misse-nse 돌연변이 (V1951L) 가관찰되었다. 저자들은한국인 1가계에서소디움통로의 SCN5A 유전자에서 missense 돌연변이를관찰하였기에문헌고찰과함께보고한다. 중심단어 :Brugada 증후군 ; 심실세동 ; 소디움통로 ; 돌연변이. 이논문은 2001 년도원광대학교교내연구비의지원에의해서수행됨. REFERENCES 1) Brugada P, Brugada J. Right bundle branch block, persistent ST segment elevation and sudden cardiac death: a distinct clinical and electrocardiographic syndrome. J Am Coll Cardiol 1992;20: ) Brugada P, Brugada R, Brugada J. The Brugada syndrome. Curr Cardiol Rep 2000;2: ) Chen Q, Kirsch GE, Zhang D, Brugada R, Brugada J, Brugada P, Potenza D, Moya A, Borggrefe M, Breithardt G, Ortiz-Lopez R, Wang Z, Antzelevitch C, O'Brien RE, Schulze-Bahr E, Keating MT, Towbin JA, Wang Q. Genetic basis and molecular mechanism for idiopathic ventricular fibrillation. Nature 1998;392: ) Deschenes I, Baroudi G, Berthet M, Barde I, Chalvidan T, Denjoy I, Guicheney P, Chahine M. Electrophysiological 약 characterization of SCN5A mutations causing long QT (E1784K) and Brugada (R1512W and R1432G) syndromes. Cardiovasc Res 2000;46: ) Valdivia CR, Ackerman MJ, Tester DJ, Wada T, McCormack J, Ye B, Makielski JC. A novel SCN5A arrhythmia mutation, M1766L, with expression defect rescued by mexiletine. Cardiovasc Res 2002;55: ) Vatta M, Dumaine R, Antzelevitch C, Brugada R, Li H, Bowles NE, Nademanee K, Brugada J, Brugada P, Towbin JA. Novel mutations in domain I of SCN5A cause Brugada syndrome. Mol Genet Metab 2002;75: ) Baroudi G, Acharfi S, Larouche C, Chahine M. Expression and intracellular localization of an SCN5A double mutant R1232W/T1620M implicated in Brugada syndrome. Circ Res 2002;90:E ) Kyndt F, Probst V, Potet F, Demolombe S, Chevallier JC, Baro I, Moisan JP, Boisseau P, Schott JJ, Escande D, le Marec H. Novel SCN5A mutation leading either to isolated cardiac conduction defect or Brugada syndrome in a large French family. Circulation 2001;104: ) Levy-Nissenbaum E, Eldar M, Wang Q, Lahat H, Belhassen B, Ries L, Friedman E, Pras E. Genetic analysis of Brugada syndrome in Israel: two novel mutations and possible genetic heterogeneity. Genet Test 2001;5: ) Weiss R, Barmada MM, Nguyen T, Seibel JS, Cavlovich D, Kornblit CA, Angelilli A, Villanueva F, McNamara DM, London B. Clinical and molecular heterogeneity in the Brugada syndrome: a novel gene locus on chromosome 3. Circulation 2002;105: ) Priori SG, Napolitano C, Gasparini M, Pappone C, Della Bella P, Giordano U, Bloise R, Giustetto C, De Nardis R, Grillo M, Ronchetti E, Faggiano G, Nastoli J. Natural history of Brugada syndrome: insights for risk stratification and management. Circulation 2002;105: ) Park SS, Nam GB, Choi KJ, Song JK, Kim JJ, Park SJ, Park JH, Kim YH. Two cases of sudden cardiac death syndrome associated with right bundle branch block and ST segment elevation. Korean Circ J 2000;30: ) Belhassen B, Viskin S, Fish R, Glick A, Setbon I, Eldar M. Effects of electrophysiologic-guided therapy with Class IA antiarrhythmic drugs on the long-term outcome of patients with idiopathic ventricular fibrillation with or without the Brugada syndrome. J Cardiovasc Electrophysiol 1999;10: ) Priori SG, Napolitano C, Gasparini M, Pappone C, Della Bella P, Brignole M, Giordano U, Giovannini T, Menozzi C, Bloise R, Crotti L, Terreni L, Schwartz PJ. Clinical and genetic heterogeneity of right bundle branch block and STsegment elevation syndrome: a prospective evaluation of 52 families. Circulation 2000;102: ) Baroudi G, Pouliot V, Denjoy I, Guicheney P, Shrier A, Chahine M. Novel mechanism for Brugada syndrome: defective surface localization of an SCN5A mutant (R1432G). Circ Res 2001;88:E ) Baroudi G, Chahine M. Biophysical phenotypes of SCN5A mutations causing long QT and Brugada syndromes. FEBS Lett 2000;487: ) Rook MB, Bezzina Alshinawi C, Groenewegen WA, van Gelder IC, van Ginneken AC, Jongsma HJ, Mannens MM, Wilde AA. Human SCN5A gene mutations alter cardiac sodium channel kinetics and are associated with the Brugada 153
5 syndrome. Cardiovasc Res 1999;44: ) Antzelevitch C, Yan GX, Shimizu W. Transmural dispersion of repolarization and arrhythmogenicity: the Brugada syndrome versus the long QT syndrome. J Electrocardiol 1999;32(Suppl): ) Yan GX, Antzelevitch C. Cellular basis for the Brugada syndrome and other mechanisms of arrhythmogenesis associated with ST-segment elevation. Circulation 1999;100: ) Antzelevitch C, Yan GX. Cellular and ionic mechanisms responsible for the Brugada syndrome. J Electrocardiol 2000;33(Suppl): ) Grant AO. Molecular biology of sodium channels and their role in cardiac arrhythmias. Am J Med 2001;110: ) Smits JP, Eckardt L, Probst V, Bezzina CR, Schott JJ, Remme CA, Haverkamp W, Breithardt G, Escande D, Schulze- Bahr E, LeMarec H, Wilde AA. Genotype-phenotype relationship in Brugada syndrome: electrocardiographic features differentiate SCN5A-related patients from non- SCN5A-related patients. J Am Coll Cardiol 2002;40: Korean Circulation J 2003;33(2):
ºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
More informationFluoroscopic anatomy for supraventricular tachycardia ablation Hui-Nam Pak, MD, PhD Division of Cardiology, Yonsei Cariovascular Center and Cardiovascular Research Institute, Yonsei University College
More information서론 - 대상및방법 결과 임상적특성 Table 1. Clinical characteristics of the study patients No Sexage FHx Provocating factor Structural heart ds Clinical manifestatio
Original Articles Korean Circulation J 2002;329:798-806 선천성 QT 연장증후군의임상적특성에대한고찰 김정호 1 남기병 1 김현국 1 이경석 1 한기훈 1 최기준 1 고재곤 2 박인숙 2 김유호 1 Clinical and Electrocardiographic Features of Patients with Congenital
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More information<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>
심전도연수강좌 : 처음시작하는사람들을위한심전도 연세대학교원주의과대학순환기내과학교실 안민수 Cardiac Electrophysiology I : Automaticity : 60-100 회 /min, His bundle : 40-60 회 /min Bundle branch : 20-40 회 /min Purkinje fiber : 20 회 /min Cardiac Electrophysiology
More informationºÎÁ¤¸ÆÃÖÁ¾
MAIN TOPIC REVIEWS Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea Catheter
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More information충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
More information02-³í´Ü1
Molecular and Cellular Biology News 1 Molecular and Cellular Biology News 4 2010 2 Molecular and Cellular Biology News 3 Molecular and Cellular Biology News 4 2010 4 Molecular and Cellular Biology News
More information<B0E6C8F1B4EBB3BBB0FA20C0D3BBF3B0ADC1C E687770>
심전도연수강좌 : 처음시작하는사람들을위한심전도 강남힘찬병원 이병호 심전도의이해정상 12- Lead 심전도 심전도연수강좌 : 처음시작하는사람들을위한심전도 Session III. Tachy Arrhythmias and Sudden Death Axis Horizontal vs Frontal plane AVR AVL (lateral wall ) ( Anteroseptum
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
More informationΔ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
More informationºÎÁ¤¸ÆV10N³»Áö
A case of atrioventricular dissociation with interference ABSTRACT Interference dissociation is one of the most interesting arrhythmias. Once thought to be a rare arrhythmia, it is now considered a very
More information부정맥질환을유발하는것이보고되었다. 3,4 LQTS는 600개이상의다양한유전적이상뿐만아니라다양한임상양상으로진단이쉽지않다. 5 최근들어유전적이상에대한정보제공이급격하게발전하여임상정보와함께다양한유전정보를정확하게해석하고 LQTS의진단과치료에적절하게이용할수있도록하는것이중요하다.
MAIN TOPIC REVIEWS Congenital Long QT Syndrome 성균관대학교의과대학소아과학교실허준 June Huh, MD, PhD Department of Pediatrics, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea Congenital
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More informationMicrosoft PowerPoint - Benefits of CRT-D in CHF.ppt
Benefits of CRT-D in CHF 울산의대서울아산병원 최기준 ICD and CRT : The Perfect Marriage? Michel Mirowski and Morton Mower : Two Baltimore cardiologists If CRT-P alone provide predictable SCD prevention (or anti-arrhythmic
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information2009;21(1): (1777) 49 (1800 ),.,,.,, ( ) ( ) 1782., ( ). ( ) 1,... 2,3,4,5.,,, ( ), ( ),. 6,,, ( ), ( ),....,.. (, ) (, )
Abstract Kim Dal-Rae, Kim Sun-Hyung* Dept. of Sasang Constitutional Medicine, College of Oriental Medicine, Kyung-Hee Univ. *Dept. of Sasang Constitutional Medicine, East-West Neo Medical Center, Kyung-Hee
More information프로그램 목차 들어가는 말 9 문전성시 문화시장 프로그램 99선 지역 공동체 10 시장 공동체 44 내발적 문화 74 예술의 역할 106 지역활성화 축제 150 여행지로 변신 182 문화중심 216 문화복지 258 문화예술학교 296 새로운 시장 개척 332 마치는 말
프로그램 목차 들어가는 말 9 문전성시 문화시장 프로그램 99선 지역 공동체 10 시장 공동체 44 내발적 문화 74 예술의 역할 106 지역활성화 축제 150 여행지로 변신 182 문화중심 216 문화복지 258 문화예술학교 296 새로운 시장 개척 332 마치는 말 358 참여인력 360 프로그램 목차 연번 카테고리 시장 프로그램명 살펴보기 연번 카테고리
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information001-학회지소개(영)
Review Article Randomization, What is the Proper Method? Jin Ho Hong, M.D., Jae Chul Yoo, M.D. Shoulder & Sports medicine, Department of Orthopedic Surgery, Samsung Medical Center Purpose: Among the numerous
More information< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>
원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of
More informationKbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationTrd022.hwp
김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,
More information1
β β Tm = 81.5 + 16.6 (log10[na+]) + 0.41 (%G+C) 675/n [Na+] monovalent cations ( [Na+] = [K+] ) n =primer base Tm = 81.5 + 16.6 (log10[0.05]) + 0.41 (60) 675/22 = 81.5 + 16.6 ( 1.30) + 24.60
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationuntitled
대한내과학회지 : 제 72 권부록 2 호 2007 급작한심장돌연사로발현된남자선천성 QT 간격연장증후군 예 인하대학교의과대학내과학교실 김철현 김대혁 임주한 최윤아 권준 박금수 이우형 =Abstract= A case report of male congenital long QT syndrome presented with aborted sudden cardiac death
More information> > > 제1장 정치 의회 1. 민주주의 가. 민주주의 지수 나. 세계은행의 거버넌스 지수 다. 정치적 불안정 지수 2. 의회 가. 의회제도와 의석 수 나. 여성의원 비율 다. 입법통계 현황 라. 의회의 예산 규모 마. 의원보수 및 보좌진 수당 3. 선거 정당 가. 투표율 나. 선거제도 다. 정당과 정치자금 4. 정치문화 가. 신뢰지수 나. 정부에 대한 신뢰
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More informationConnexin 26 의유전자변이 서론 재료및방법 대상 방법 Korean J Audiol Volume 5 December, 2001
KISEP Original Articles Korean J Audiol 52:105-110, 2001 선천성고도난청에서 Connexin 26 의유전자변이의형태분석 이상흔 1 이정래 1 이지은 1 김태정 2 강봉석 2 Molecular Genetic Analysis of Connexin 26 in Congenital Profound Hearing Loss Sang
More informationºÎÁ¤¸ÆV10N³»Áö
ISSN 2005-9728 VOL.11 NO.2 JUNE 2010 The Official Journal of Korean Society of Cardiac Arrhythmia Special Review Main Topic Reviews Conference Coverage ECG & EP Cases The Korean Society of Cardiac Arrhythmia
More information페링야간뇨소책자-내지-16
야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More informationMicrosoft PowerPoint - 2- 남기병
쉽게풀어보는심전도 울산대서울아산병원남기병 심전도진단 Chamber enlargement (hypertrophy) Bundle branch block Myocardial infarction WPW ST-T change: Nonsp ST-T change, Early repolarization Arrhythmia: tachycardia, PVC, AF 남자 63
More information미래의학 - 맞춤형의학 유전자가위
미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health
More informationKee-Joon Choi, MD Division of Cardiology, Department of Internal Medicine, Asan Medical Center, Ulsan University School of Medicine, Seoul, Korea Troubleshooting ICD therapy ABSTRACT Implantable cardioverter-defibrillator
More information석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
More information노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
More information表紙(化学)
수험 번호 성 명 2013년 일본 공과대학 학부 유학생 파견 선발 시험 화 학 (90분 100점) 주 의 1 시험시작의 지시가 있을 때까지 열지 마시오. 2 해답은 해답용지의 지정된 난 안에 알아보기 쉽게 기입하시오. 3 해답에 한글이 포함되면 채점되지 않습니다. 필요한 경우, 아래의 값을 사용하시오. 원자량 H 1.0, C 12, N 14, O 16, Cu
More informationJkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information11. 증례.hwp
영남의대학술지제26권제2호 Yeungnam Univ. J. of Med. Vol.26 No.2 p148-155, Dec. 2009 증례 Brugada 증후군환자의경접형동선종절제술을위한마취경험 허민정 김세연 영남대학교의과대학마취통증의학교실 Anesthetic Experience for Trans-Sphenoidal Surgery of Pituitary Adenoma
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More information32
3 1 32 3 3 20 1 21 N G O re f o rm u l a t i o n 1 2 1 2002 p 458 34 2 g e n d e r 2 3 5 36 3 c a re 4 5 e s s e n t i a l i s m M a rg a re t T h a t c h e r I n d i r a G a n d h i w a r r i o r 2 3
More information<39372D3032C6F3B1A4C1F6BFAAC4ABC1F6B3EBBCB3C4A1B9D7BFEEBFB5B9E6BEC8BFACB1B82E687770>
More information
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More information歯5)논단2.PDF
1) 2) 1. :. NGO..,..,,,...,.. OECD, 15 15 1997 4.. 1997 3 15. 1999 8,..,..,. ( 1), ( : ). ha nc lk@pspd.org 2), ( : ). biocdst@orgio.net ). 1980. 1998,. 2 (biosafety protocol), LMO. DNA...,,,., ( )..,..
More informationuntitled
대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran
More information서 론 대상 및 방법 대 상 706 Table 1. Characteristics of patients Number n 125 Age meansd 3514 Sex MF 7154 QRS duration sec 0.110.02 Site of AP n Anterior 21 1
Original Articles Korean Circulation J 1999;297:705-711 Wolff-Parkinson-White증후군 환자에서의 이차성 T파 변화 2 배장호 1 김윤년 2 신이철 2 박소영 2 김기영 1 남창욱 2 김미정 2 김기식 2 김권배 2 정시전 Secondary T Wave Changes in Patients with Wolff-Parkinson-WhiteWPW
More informationºÎÁ¤¸ÆV10N³»Áö
A case of nonischemic dilated cardiomyopathy with ventricular tachycardia treated by ICD ABSTRACT Dilated cardiomyopathy (DCM) is a syndrome characterized by left or biventricular dilatation and impaired
More informationuntitled
대한수혈학회지:제21권 제2호, 2010 유전자 검사로 확인된 A 1 B weak 형 환자 1예 조치현ㆍ유병준ㆍ윤승규ㆍ최계령ㆍ최재열ㆍ김장수ㆍ임채승ㆍ김영기ㆍ이갑노 고려대학교 의과대학 진단검사의학교실 Using Genotyping to Identify an A 1 B weak Blood Group Chi-Hyun Cho, Byong-Joon Yoo, Seung-Gyu
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More informationePapyrus PDF Document
MAIN TOPIC REVIEWS Hong-Euy Lim, MD, PhD Division of Cardiology, Korea University Guro Hospital, Seoul, Republic of Korea Surface electrocardiography of supraventricular tachycardia - differential diagnosis
More information심장2.PDF
(Treatment of Hypertension with Associated Diseases) 1.. (140/90 mmhg). 80 mmhg. ( ). (atenolol ), (amlodipine ) 1. -1 nitrate. ACE diltiazem, verapamil. ACE. ( )., ACE diltiazem,, diltiazem, verapamil.
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information2 3 4 5 6 8 9 11 12 13 14 16 44 68 80 86 1 ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) (, ) ( ) ( ) ( ) ( ) ( ) ( ) (KORDI/KRISO) () () () () () () 2 3 : 1 : 2005 5 12() 09:00~14:30 Session 15:00~19:00 : 19:00~20:30
More informationα α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More information27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
More information<C5F0B0E8C7D032352D3030B8F1C2F7283235C1FD292E687770>
第 25 輯 社 團 法 人 退 溪 學 釜 山 硏 究 院 2015. 06 이 도서는 부산광역시 보조금으로 간행되었습니다. 第 25輯 퇴계학 退溪詩에 나타난 마음의 의미 李 貞 和 7 退溪 詩 의 학문적 맥락 읽기 김 병 권 27 사상 先秦儒家美学的范畴体系 张 黔 51 试析孟子 民贵 说的 尊君 实质 刘 清 平 65 儒家儀禮의 方位 에 관한 文化解釋 趙
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationuntitled
홍콩 중국을 알려주는 주간소식지- 제15-42-993호 WEDNESDAY JOURNAL.NET 2015년 10월 28일 이후 정부의 대학 장악 시도 마찰 홍콩 과기대 최고경영자 MBA과정, 세계 2위 한때 6년간 세계 최고로 평가받았던 홍콩과기 대의 켈로그 최고 경영자 MBA 프로그램이 올해 에도 1위 탈환에는 실패했다.
More information원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
More information(Microsoft PowerPoint - S13-3_\261\350\273\363\307\366 [\310\243\310\257 \270\360\265\345])
Cardiovascular Disease in Metabolic Syndrome 김상현 보라매병원내과 서울대학교의과대학내과학교실 Contents Metabolic syndrome and Cardiovascular system CVD Mortality Coronary artery disease Heart failure Atrial fibrillation Management
More information김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
More informationCase Reports Korean Circulation J 1999;29 10 : 제세동역치가높았던특발성심실세동에시술한 삽입형심실제세동기 ICD 1 예 송창석 김형주 박현용 박희백 장영광 차태준 주승재 이재우 Implantation of ICD in
Case Reports Korean Circulation J 1999;2910:1138-1143 제세동역치가높았던특발성심실세동에시술한 삽입형심실제세동기 ICD 1 예 송창석 김형주 박현용 박희백 장영광 차태준 주승재 이재우 Implantation of ICD in a Ventricular Fibrillation Patient with a High Defibrillation
More information<36C8A3B3EDB9AE5B31305B315D2E323020BCF6C1A45D2E687770>
기업옥의 파드디자인에 관한 연구 A Study on Facade design of an office building 문혜정 / 홍익대학교 공간디자인전공 석과정 Moon Hye jeong / School of Spatial Design, Hongik University moons81@nate.com 김주연 / 홍익대학교 산업디자인학과 Kim Joo yun/ Dept.
More information160215
[ 진경준, 대한민국 검사의 민낯! ] 진경준 검사 정봉주 : 진경준 검사장 사건이 충격적인가 봐요. 고위공직자 비리수사처 얘기도 나오는 걸 보니까. 왜 그래요, 느닷 없이? 김태규 : 공수처는 여러 검찰개혁안 중의 하나였죠. 검찰의 기 소독점주의를 견제하기 위해서는 공수처를 도입해야 한다 는 얘기가 오래 전부터 나왔고. 그런데 지금 정권이 레임 덕에 막 빠지려고
More information109~120 õÃʾàħ Ä¡·á
109 DOI : 10.3831/KPI.2010.13.3.109 Received : 10. 08. 13 Revised : 10. 09. 06 A Case Study Of Patients With Knee Joint Pain Treated With Rubiae Radix Pharmacopuncture Accepted : 10. 09. 07 Key Words:
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information<32303136C7D0B3E2B5B520B9FDC7D0C0FBBCBABDC3C7E820C3DFB8AEB3EDC1F528C8A6BCF6C7FC292E687770>
20학년도 법학적성시험 1 제2교시 추리논증 성명 수험 번호 이 문제지는 35문항으로 구성되어 있습니다. 문항 수를 확인하십시오. 문제지의 해당란에 성명과 수험 번호를 정확히 쓰십시오. 답안지에 수험 번호, 문형, 성명, 답을 표기할 때에는 답안 작성 시 반드시 지켜야 하는 사항 에 따라 표기하십시오. 답안지의 필적 확인란 에 해당 문구를 정자로 기재하십시오.
More information좋은 디자인은 곧 그것만의 아이덴티티 를 발견하는 것입니다. 대상과 관련된 수많은 정보의 맥락을 깊이있게 이해한 후 고유의 정보를 조합하는 것부터 시작하여 이를 통해 시간이 지날수록 개인과 커뮤니티, 인공과 자연, 과거와 미래가 소통할 수 있는 제품을 만듭니다. Company Introduction 1 3 Brand Profile (인프레임)은 큰산인디컴의
More information005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
More information00표지
11 2007 11 Vol.379 www.corrections.go.kr 004 004 011 032 007 012 020 021 032 036 038 041 042 044 046 COVER STORY 067 162 170 052 067 076 079 084 134 145 148 150 153 154 183 184 Monthly Correctional Review
More information<303520C1BEBCB320B9DAC7FCBCB72DC7D1BCBABFED2E687770>
대한내과학회지 : 제 90 권제 2 호 2016 http://dx.doi.org/10.3904/kjm.2016.90.2.115 종설 (Review) 돌연사의일차적예방을위한삽입형제세동기치료 계명대학교동산의료원심장내과 박형섭 한성욱 Implantable Cardioverter-Defibrillators for Primary Prevention of Sudden
More information레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information<31325F3134335FB1E8B9CCC1A42CBFF8C0B1B0E62CB1E8B9CCC7F62E687770>
143 패션쇼에 나타난 퓨처리즘 메이크업의 특징에 관한 고찰 (2000 년대 초반을 중심으로 ) 김 미 정 / 원 윤 경 / 김 미 현 한성대학교 예술대학원 / 충청대학 피부미용학부 / 동명대학교 뷰티디자인학과 Abstract The Characters of Futurism Make up by Observation of 21's Century Fashion
More information<4368616E6736652033C0E520C8ADC7D0BEE7B7D02E687770>
제3장 화학양론 3.1 원자질량 (Atomic Mass) 원자질량: 실제로 매우 작아 상대질량으로 표시 Atomic mass is the mass of an atom in atomic mass units (amu). 기준 원자=탄소-12, 탄소-12 원자 1개 질량 = 12.00000 amu 로 정의 amu : 원자질량 단위 ( atomic mass units)
More information1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.
More informationY 염색체미세결실증례보고 이지현외 117 이없는곳이지만, 법의학에서나산전진단시흔히성별을감식하는데사용된다. Y 염색체의단완 11.2 (Yp 11.2) 부위의유전자성별감식시동체 ( 프라이머, primer) 결합부위에전좌또는돌연변이, 결실로인해 amelogenin Y gen
Korean J Leg Med 2014;38:116-120 증례보고 Y 염색체단완미세결실유전자검사사례보고 이지현 1 김한나 1 V. Shinde 2 신동훈 3,4 이숭덕 1,3 1 서울대학교의과대학법의학교실 2 데칸대학교고고학교실 3 서울대학교의학연구원법의학연구소 4 서울대학교의과대학해부학교실 접수 : 2014년 6월 16일수정 : 2014년 7월 28일게재승인
More informationCONTENTS 표지 설명 자기만의 독특한 남성적 카리스 마를 내면화시킨 배우 최민수. 그가 SBS 주말극장 태양의 남 쪽 을 통해 2년여 만에 브라운 관에 복귀했다. 선 굵은 서사의 중심 인물이 되어 돌아온 그가 벌써부터 화제의 중심인물로 떠 올랐다. 사진 서창식 H
2003 September 09 주말극장 태양의 남쪽 아침연속극 이브의 화원 커버스토리 태양의 남쪽 의 최민수 SBS TV 추석특집 프로그램 프로그램 탐험 해결! 돈이 보인다 CONTENTS 표지 설명 자기만의 독특한 남성적 카리스 마를 내면화시킨 배우 최민수. 그가 SBS 주말극장 태양의 남 쪽 을 통해 2년여 만에 브라운 관에 복귀했다. 선 굵은 서사의
More information02À±¼ø¿Á
Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we
More information2 이달의 제품 vol.04 1위 2014 스토어 36.5 결산 내가 제일 잘 나가 2014년 스토어 36.5는 질적 양적으로 많은 성장을 거뒀다. 먼저 2013년 25개이던 매장이 올해에는 41개로 늘었다. 착한소비에 관심을 갖는 소비자가 늘어남에 따라 매장의 입점
2014 12 vol 04 윤리적 소비로 세상을 바꾸는 당신을 위한 사회적기업 상품 정보 매거진 02 이달의 제품 2014 스토어 36.5 결산 06 Good Collaboration 부활 김태원+예비사회적기업 폴 제페토 기타 08 36.5 현장 호오생활예술 10 장바구니 습격사건 임산부 위한 탁월한 선택! 11 It place 전주 남부시장 청년몰+스토어
More information. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, ( )
. 45 1,258 ( 601, 657; 1,111, 147). Cronbach α=.67.95, 95.1%, Kappa.95.,,,,,,.,...,.,,,,.,,,,,.. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ,. (, 2011),, 1980 5 49.9%, 4 (20.3%). 1985, 5 (39.0%), 4 (25.3%).
More informationJkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More information