Microsoft Word - 순2-10.doc

Size: px

Start display at page:

Download "Microsoft Word - 순2-10.doc"

재홍 채
5 years ago
Views:

1 증례 Korean Circulation J 2003;33(2): SCN5A 유전자의 Missense 돌연변이를가진 1 가계 원광대학교의과대학생화학교실, 1 내과학교실 2 신창호 1 김남호 2 김경희 1 유수성 1 최용복 1 오석규 2 홍경만 1 정진원 2 백문기 1 A Family with A Missense Mutation in the SCN5A Gene Chang Ho Shin, PhD 1, Nam-Ho Kim, MD 2, Kyung-Hee Kim, BS 1, Su-Sung Yoo, BS 1, Yong-Bock Choi, MS 1, Seok Kyu Oh, MD 2, Kyeong-Man Hong, MD 1, Jin-won Jeong, MD 2 and Moon-Kee Paik, MD 1 1 Departments of Biochemistry and 2 Internal Medicine, Wonkwang University School of Medicine, Iksan, Korea ABSTRACT Brugada syndrome, an autosomal dominantly inherited form of ventricular fibrillation, is characterized by STsegment elevation in leads V1-3 and right bundle-branch block on surface electrocardiogram. It is caused by mutations in the cardiac sodium channel gene, SCN5A, and to the best of our knowledge, there has been no report of this mutation in Korea. Three members of a family were heterozygous for a G to T substitution at the nucleotide position 5851 in exon 28 of the SCN5A gene. This nucleotide alteration makes a missense mutation, leading to a valine to leucine substitution (V1951L), in the carboxy terminal region of the sodium channel a subunit. We report here a missense mutation in a Korean family with Brugada-type electrocar-diogram. (Korean Circulation J 2003;33(2): ) KEY WORDS:Brugada syndrome;ventricular fibrillation;sodium channels;mutation. 서 논문접수일 :2002 년 09 월 04 일심사완료일 :2002 년 10 월 24 일교신저자 : 김남호, 전북익산시신용동 원광대학교의과대학내과학교실전화 :(063) 전송 :(063) cardionh@wonkwang.ac.kr 론 심전도소견상특징적인우각차단양상과우흉부유도상 (V 1-3) ST절의상승소견을보이면서심실세동에의한심인성급사의특징적인임상경과를보이는환자들을 Brugada 증후군이라한다. 1)2) 이들환자의경우, 심근세포막에존재하는소디움이온통로 (sodium channel) 의 alpha subunit를부호화 (encoding) 하는 SC- N5A, 3p21 유전자에돌연변이가있음이확인되었다. 3-11) 국내에서도 Brugada 증후군이 2례가보고된적이있으나, 12) 소디움이온통로유전자의돌연변이에대한보고는없다. 본저자들은한가족에서나타난 SCN5A 유전자의돌연변이를발견하였기에보고하는바이다. 증례 환자 : 이 진, 남자 41세. 주소 :12유도심전도상우각차단과우흉부유도 (V 1-3 ) 에서 ST절상승. 150

Fig. 1. The 12-lead electrocardiogram of the proband shows J point elevation and incomplete right bundle branch block in V1-3. 과거력 및 가족력 실신 및 돌연사 등의 특이한 병 력은 없었다.

2 Fig. 1. The 12-lead electrocardiogram of the proband shows J point elevation and incomplete right bundle branch block in V1-3. 과거력 및 가족력 실신 및 돌연사 등의 특이한 병 력은 없었다. Amp PCR system 2400, Perkin Elmer, USA)를 사 용하여 95 에서 3분간 DNA를 처리시킨 후 94 에 현병력 평소 건강하게 지내던 환자는 내원 3일 전 서 30초간 변성(denaturation), 61 에서 30초간 보 부터 발생한 고열과 기침으로 폐렴 진단하에 치료하던 합(annealing), 72 에서 30초간 확장(extension)과 중 우연히 발견한 심전도상의 이상으로 본원에 내원하 정을 35회 반복하였고, 마지막 과정에서는 72 에서 7 였다. 분간 유지시킨 후 정지시켰고, 3 primer set을 이용하 진찰소견 및 경과 이학적 검사 및 혈액 검사에서 특 여 SCN5A 유전자의 exon 28번을 증폭하였다. 이때 이 소견 없었으며, 심전도상 전형적인 Brugada 형태의 사용된 primer는 1F GCACTGTGCTCTCGGACA- 심전도를 보였다(Fig. 1). 환자의 부모, 아들, 그리고 TC, 1R CACGCTGAAGTTCTCCAGGA, 2F A 딸에게서 심전도 검사를 실시하였으나 특이한 심전도 GC-CGTGGGCATCCTCTTCT, 2R GACACC- 양상은 없었으며, 소디움 차단제를 이용한 유발검사는 TCTT-CGTGCTTGCG, 3F ATGGACGCCCTG- 시행하지 못하였다. 모든 대상자는 심초음파 검사, 신 AAGA-TCCA, 3R TCACACGATGGACTCACG- 호 평균화 심전도에서 특이소견 없었다. 환자는 심실 GT이었다. 증폭된 PCR산물을 1.0% agarose gel에서 빈맥 유발 유무를 확인하기 위하여 심전기 생리검사를 전기영동 후 증폭된 DNA band를 절제하여 Gel ext- 권유하였으나 거부한 상태에서 특별한 약물치료 없이 raction kit(necleogen Biotechnoloy, Korea)을 이용 1년째 추적 관찰 중이다. 하여 세척 분리하였다. DNA 분리 환자의 가족 5명을 대상으로 유전체 연 돌연변이 확인 약 30 ng template DNA을 이용하 TM 구에 대한 동의서를 획득후 혈액을 채취하였다. EDTA 였다. ABI PRISM BigDye 관에 채혈한 혈액은 원심 분리하여 buffy coat 층을 분 quencing ready reaction kit(applied Biosystems, 리하고, 같은 양의 phosphate buffered saline를 첨가 Foster City, Calif. USA)을 이용하여 ABI PRISM 하여 혼합한 뒤 원심 분리하여 적혈구를 함유한 상층액 BigDye 을 제거하였다. 분리된 Buffy coat에 STE 500 μl, ems)로 DNA 염기순서 분석을 실시하였다. 3번 염색 proteinase K 40 μl, 20% SDS 40 μl를 가해 침전 체의 소디움 이온 통로의 유전자인 SCN5A에서 mis- 시킨 후 phenol 및 chloroform를 가해 정제 후 cold sense 돌연변이가 아버지, 계보발단자, 그리고 딸에게 100% ethanol을 넣어 DNA를 침전시켰다. 다시 원심 서 확인되었다. 이 3명은 SCN5A 유전자의 exon 28의 분리하여 상층액을 버리고 70% ethanol로 washing nucleotide position 5851에서 G/T 치환이 일어난 이 한 뒤 DNA를 추출하였다. 형 접합(heterozygote)이었다. 이러한 nucleotide의 중합효소연쇄반응(PCR) 자동 온도조절기(Gene- TM terminator cycle se genetic analyzer(applied Biosyst- 변형은 c-terminus에서 valine을 leucine으로 치환하는 151

3 A B Fig. 2. Mutation detection in a family. A:pedigree of a family. B:DNA sequence analysis of genomic DNA identifies a G-to-T base substitution (arrow) in exon 28 of SCN5A, leading to an amino acid substitution of valine by leucine at codon 1951 (V1951L). Fig. 3. SCN5A mutation identified. The location of the V1951L mutation is indicated. missense 돌연변이를일으켰다 (V1951L)(Fig. 2, 3). 152 고 Brugada 증후군은심전도상특징적인우각차단과우흉부유도에서 ST절의상승소견을갖으면서돌연사를일으키는질환이다. 1)2) 최근에알려지기시작한질환으로그유병율과발생빈도는아직정확하지않다. 일반적으로남자에서, 특히동양인과백인에서그발생 찰 빈도가높은것으로알려져있다. 25% 의경우에는유전적경향의확인이어려우며, 약 15% 정도에서는가족력을확인할수없는것으로알려져있다. 돌연사의 4~ 12%, 특히구조적으로심장이정상인경우에는 50% 이상이 Brugada 증후군이돌연사의원인일것으로생각한다. 현재까지알려진바에의하면 Brugada 증후군의 25% 가계에서상염색체우성형태의유전양상이확인되고있으며, 따라서이론적으로환자의자손중약 50% 에서 Brugada 증후군이나타날확률을지닌다. 1)2)11)13)14) Brugada 증후군에서 SCN5A의돌연변이는 splicedonor, frame-shift, 그리고 missense의 3가지형태가보고되고있다. 3-11) T1620M 돌연변이는소디움통로의 DⅣS3와 DⅣS4 사이의 extracelluar loop 에서 threonine이 methionine에의해치환되어 steadystate inactivation curve 를우측으로이동시킴으로써소디움통로를정상통로보다빨리불활성화시킨다. 3) R1512W 돌연변이는소디움통로의불활성화관문으로알려져있는 DⅢ-Ⅳ linker에서불활성화의회복과불활성화을더욱느리게한다. 4) R1432G는소디움통로의발현을폐지함으로써소디움통로의기능을소실시킨다. 15) 또한 1795insD 돌연변이는소디움통로의전류를감소시킨다. 16) 이와같이 SCN5A 유전자의돌연변이로인해정상적기능의소디움통로의수적감소혹은그기능자체의이상을통해심근세포단위에서재분극과정의이상을초래함으로써 Brugada 증후군을유발할것으로생각한다. 3)17-20) 하지만, 이러한유전자의돌연변이가 Brugada 증후군을유발하는직접적인기전에대해서는아직명확하지않다. 21)22) 본저자들은심전도상우각차단과우흉부유도에서 ST절상승이있는환자의가계에서 1개의돌연변이를발견하였다. 아버지, 계보발단자, 딸에게서소디움통로의 α subunit carboxy terminal 부위에서모두동일한 missense 돌연변이 (V1951L) 가관찰되었다. 아버지와딸에게서는특징적인심전도의발현이안되었는데이는소디움차단제를사용하여유발검사가필요할것으로생각된다. 본연구에서는이러한소디움통로유전자의돌연변이가소디움채널의기능에영향을주어심전도상변화를나타내는기전에대해서는직접적인확인은하지못하였으나, Priori 등 11) 이 Brugada 증후군에서같은부위의돌연변이 V1951L을보고한적 Korean Circulation J 2003;33(2):

4 이있다. 향후에는이러한 SCN5A의돌연변이가기능적으로소디움이온통로에어떠한영향을미치는지에대해서추후연구가되어야할것이다. 이러한제한점에도불구하고국내에서는처음으로 Brugada 형태의심전도를갖는환자의가계에서소디움이온통로의유전자돌연변이를발견하여보고하는바이다. 요 Brugada 증후군은심전도상우각차단과우흉부유도상 ST절상승소견이관찰되고돌연사를일으키는질환이다. 상염색체우성으로유전되고심장소디움통로의 SCN5A 유전자에돌연변이를일으키는것으로알려져있다. 그러나국내에서는소디움이온통로유전자의돌연변이가아직보고된바없다. 계보발단자는우연히발견된 Brugada 형태의심전도를주소로내원하여부모, 두자녀들을포함하여혈액검사로 DNA sequencing을실시하였다. 아버지, 계보발단자, 딸에게서공통적으로 SCN5A 유전자의 exon 28의 nucle-otide position 5851에서염기치환 (G/T) 에의해 C-terminus 에서 valine 을 leucine 으로치환하는 misse-nse 돌연변이 (V1951L) 가관찰되었다. 저자들은한국인 1가계에서소디움통로의 SCN5A 유전자에서 missense 돌연변이를관찰하였기에문헌고찰과함께보고한다. 중심단어 :Brugada 증후군 ; 심실세동 ; 소디움통로 ; 돌연변이. 이논문은 2001 년도원광대학교교내연구비의지원에의해서수행됨. REFERENCES 1) Brugada P, Brugada J. Right bundle branch block, persistent ST segment elevation and sudden cardiac death: a distinct clinical and electrocardiographic syndrome. J Am Coll Cardiol 1992;20: ) Brugada P, Brugada R, Brugada J. The Brugada syndrome. Curr Cardiol Rep 2000;2: ) Chen Q, Kirsch GE, Zhang D, Brugada R, Brugada J, Brugada P, Potenza D, Moya A, Borggrefe M, Breithardt G, Ortiz-Lopez R, Wang Z, Antzelevitch C, O'Brien RE, Schulze-Bahr E, Keating MT, Towbin JA, Wang Q. Genetic basis and molecular mechanism for idiopathic ventricular fibrillation. Nature 1998;392: ) Deschenes I, Baroudi G, Berthet M, Barde I, Chalvidan T, Denjoy I, Guicheney P, Chahine M. Electrophysiological 약 characterization of SCN5A mutations causing long QT (E1784K) and Brugada (R1512W and R1432G) syndromes. Cardiovasc Res 2000;46: ) Valdivia CR, Ackerman MJ, Tester DJ, Wada T, McCormack J, Ye B, Makielski JC. A novel SCN5A arrhythmia mutation, M1766L, with expression defect rescued by mexiletine. Cardiovasc Res 2002;55: ) Vatta M, Dumaine R, Antzelevitch C, Brugada R, Li H, Bowles NE, Nademanee K, Brugada J, Brugada P, Towbin JA. Novel mutations in domain I of SCN5A cause Brugada syndrome. Mol Genet Metab 2002;75: ) Baroudi G, Acharfi S, Larouche C, Chahine M. Expression and intracellular localization of an SCN5A double mutant R1232W/T1620M implicated in Brugada syndrome. Circ Res 2002;90:E ) Kyndt F, Probst V, Potet F, Demolombe S, Chevallier JC, Baro I, Moisan JP, Boisseau P, Schott JJ, Escande D, le Marec H. Novel SCN5A mutation leading either to isolated cardiac conduction defect or Brugada syndrome in a large French family. Circulation 2001;104: ) Levy-Nissenbaum E, Eldar M, Wang Q, Lahat H, Belhassen B, Ries L, Friedman E, Pras E. Genetic analysis of Brugada syndrome in Israel: two novel mutations and possible genetic heterogeneity. Genet Test 2001;5: ) Weiss R, Barmada MM, Nguyen T, Seibel JS, Cavlovich D, Kornblit CA, Angelilli A, Villanueva F, McNamara DM, London B. Clinical and molecular heterogeneity in the Brugada syndrome: a novel gene locus on chromosome 3. Circulation 2002;105: ) Priori SG, Napolitano C, Gasparini M, Pappone C, Della Bella P, Giordano U, Bloise R, Giustetto C, De Nardis R, Grillo M, Ronchetti E, Faggiano G, Nastoli J. Natural history of Brugada syndrome: insights for risk stratification and management. Circulation 2002;105: ) Park SS, Nam GB, Choi KJ, Song JK, Kim JJ, Park SJ, Park JH, Kim YH. Two cases of sudden cardiac death syndrome associated with right bundle branch block and ST segment elevation. Korean Circ J 2000;30: ) Belhassen B, Viskin S, Fish R, Glick A, Setbon I, Eldar M. Effects of electrophysiologic-guided therapy with Class IA antiarrhythmic drugs on the long-term outcome of patients with idiopathic ventricular fibrillation with or without the Brugada syndrome. J Cardiovasc Electrophysiol 1999;10: ) Priori SG, Napolitano C, Gasparini M, Pappone C, Della Bella P, Brignole M, Giordano U, Giovannini T, Menozzi C, Bloise R, Crotti L, Terreni L, Schwartz PJ. Clinical and genetic heterogeneity of right bundle branch block and STsegment elevation syndrome: a prospective evaluation of 52 families. Circulation 2000;102: ) Baroudi G, Pouliot V, Denjoy I, Guicheney P, Shrier A, Chahine M. Novel mechanism for Brugada syndrome: defective surface localization of an SCN5A mutant (R1432G). Circ Res 2001;88:E ) Baroudi G, Chahine M. Biophysical phenotypes of SCN5A mutations causing long QT and Brugada syndromes. FEBS Lett 2000;487: ) Rook MB, Bezzina Alshinawi C, Groenewegen WA, van Gelder IC, van Ginneken AC, Jongsma HJ, Mannens MM, Wilde AA. Human SCN5A gene mutations alter cardiac sodium channel kinetics and are associated with the Brugada 153

5 syndrome. Cardiovasc Res 1999;44: ) Antzelevitch C, Yan GX, Shimizu W. Transmural dispersion of repolarization and arrhythmogenicity: the Brugada syndrome versus the long QT syndrome. J Electrocardiol 1999;32(Suppl): ) Yan GX, Antzelevitch C. Cellular basis for the Brugada syndrome and other mechanisms of arrhythmogenesis associated with ST-segment elevation. Circulation 1999;100: ) Antzelevitch C, Yan GX. Cellular and ionic mechanisms responsible for the Brugada syndrome. J Electrocardiol 2000;33(Suppl): ) Grant AO. Molecular biology of sodium channels and their role in cardiac arrhythmias. Am J Med 2001;110: ) Smits JP, Eckardt L, Probst V, Bezzina CR, Schott JJ, Remme CA, Haverkamp W, Breithardt G, Escande D, Schulze- Bahr E, LeMarec H, Wilde AA. Genotype-phenotype relationship in Brugada syndrome: electrocardiographic features differentiate SCN5A-related patients from non- SCN5A-related patients. J Am Coll Cardiol 2002;40: Korean Circulation J 2003;33(2):

ºÎÁ¤¸ÆV10N³»Áö

ºÎÁ¤¸ÆV10N³»Áö case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads