Microsoft Word doc

Size: px

Start display at page:

Download "Microsoft Word doc"

영숙 변
4 years ago
Views:

1 식이폴리페놀들이사람호흡기상피세포의 MUC5AC 유전자발현과사람코점막의생체외섬모운동에미치는영향 연세대학교대학원 의학과 송기재

2 식이폴리페놀들이사람호흡기상피세포의 MUC5AC 유전자발현과사람코점막의생체외섬모운동에미치는영향 연세대학교대학원 의학과 송기재

3 식이폴리페놀들이사람호흡기상피세포의 MUC5AC 유전자발현과사람코점막의생체외섬모운동에미치는영향 지도교수김경수 이논문을석사학위논문으로제출함 2008 년 12 월 연세대학교대학원 의학과 송기재

4 송기재의석사학위논문을인준함 심사위원김경수인 심사위원용태순인 심사위원김현준인 연세대학교대학원 2008 년 12 월

5 감사의글 이논문이완성되기까지끊임없는관심과배려, 그리고세심한지도를베풀어주신김경수교수님께진심으로감사드립니다. 또한논문의작성과심사에많은지도편달을해주신용태순교수님, 김현준교수님께도진심으로감사를드리는바입니다. 귀중한자료를얻을수있도록많은도움을주신김소연연구원께고마운마음을전합니다. 끝으로묵묵히힘이되어준가족들에게사랑의마음을전하며이논문을바칩니다 년 12 월 송기재올림

6 차례 국문요약 1 I. 서론 3 II. 재료및방법 6 III. 결과 MUC5AC 유전자발현의변화 세포증식률의변화 섬모운동의변화 16 IV. 고찰 19 V. 결론 23 참고문헌 24 영문요약 27

7 표차례 표 1. Change of IL -1β-induced MUC5AC gene expression by polyphenols 11 표 2. Cell proliferation in treatment with polyphenols 14 표 3. Change of ciliary movement in treatment of polyphenols 17 그림차례 그림 1. Change of IL-1β-induced MUC5AC gene expression by polyphenols 12 그림 2. Cell proliferation in treatment with polyphenols 15 그림 3. Change of ciliary movement in treatment of polyphenols 18

8 < 국문요약 > 식이폴리페놀들이사람호흡기상피세포의 MUC5AC 유전자발현과사람코점막의생체외섬모운동에미치는영향 식이폴리페놀 (Polyphenol) 이란우리가섭취하는음식특히식물에포함되어있는폴리페놀을일컫는데최근먹거리에대한관심이높아지면서이에대한연구가활발하다. 이들은항염증 (antiinflammatory), 항산화 (anti-oxidative), 항돌연변이 (anti-mutagenic), 항암, 세포고사유도등의작용을하지만폴리페놀이코점막에서발생하는점액과분비나섬모운동에어떤영향을미치는가에대해서는연구가미미한실정이다. 이에본연구의목적으로첫째, 사람호흡기상피세포인 NCI-H292 세포에여러식이폴리페놀 ([6]- gingerol, EGCG, curcumin, quercetin) 을처치하여폴리페놀이 MUC5AC 유전자발현을억제하는가를알아보고자하였다. 다음으로세포의증식을억제하지않고 MUC5AC 유전자발현을억제하는농도로폴리페놀을사람코점막에처치하여폴리페놀이섬모운동에미치는영향을보고자하였다. NCI-H292 세포주에 4종의폴리페놀 ([6]-gingerol, EGCG, curcumin, quercetin) 을각각투여하였다. 이들이 MUC5AC 유전자발현을억제하는최소농도를 real-time PCR법으로알아본결과, [6]- gingerol은 1 μm, EGCG 20 μm, quercetin 40 μm, curcumin은 10 μm이었으며, 실험한폴리페놀들은이농도에서세포증식을억제하지않았다. 정상사람코점막에서의섬모운동변화는 [6]-gingerol, quercetin, EGCG의경우대조군과유의한차이를보이지않았으나 1

9 curcumin에서는유의하게감소하는것을확인할수있었다. 결론적으로 [6]-gingerol, quercetin, EGCG 등은호흡기상피세포의점액분비를효과적으로억제하며코점막섬모운동은정상적으로유지하므로임상적으로이용가능한점액분비억제물질로생각된다 핵심되는말 : 식이폴리페놀, MUC5AC, 생체외섬모운동 2

10 식이 Polyphenol 들이사람의호흡기상피세포의 MUC5AC 유전자발현과사람코점막의생체외섬모운동에미치는영향 < 지도교수김경수 > 연세대학교대학원의학과 송기재 I. 서론식이폴리페놀 (polyphenol) 이란우리가섭취하는음식특히식물에포함되어있는폴리페놀을일컫는다. 폴리페놀은 flavonoid, stillbene, lignan, phenolic acid 등의 4종으로구분되는데이성분들은식물의이차대사산물로서자외선이나곤충에대한방어기전에중요한 역할을한다. 1 이중에서도생강의주요활성성분인 6-gingerol, 녹차에포함된 catechin 성분과주요구성성분인 EGCG, 적포도주에포함된 resveratrol과 quercetin, 카레에포함된 curcumin, 콩에포함된 genistein, indole-3-carbinol, 은행잎에포함된 kaempferol, quercetin과 rutin, 감귤류에포함된 hesperidine과 naringin 등을 포함하여많은성분이존재한다. 2,3 인체가섭취하는양이미국인의 경우하루 1 g 정도로, flavonoid 에속한 flavonol 의경우하루 mg 을섭취한다고한다. 또한 flavonoid 의혈중농도가 10 µm 이하이며정적상태 (steady-state) 의농도는 1 µm 이하로전체 폴리페놀의농도는이이상으로생각되고있다. 4,5 이처럼폴리페놀이 3

11 인체에미치는영향에대해최근많은연구가행해지고있으며먹거리에대한관심이높아지면서이방면의연구가더욱활발해지고있다. 폴리페놀은항염증 (anti-inflammatory), 항산화 (antioxidative), 항돌연변이 (anti-mutagenic), 항암, 세포고사유도등의작용을하며이러한작용의기전으로 cyclooxygenase, lipoxygenase, phopholipase A2, nitric oxide, NF-κB 등의억제작용, nonsteroidal anti-inflammatory drug-activated gene (NAG-1) 의유도 작용등이언급되고있다. 6 그러나폴리페놀이사람코점막에서 발생하는점액과분비나섬모운동에미치는영향에대해서는연구가미미한실정이다. 7,8 비염을비롯한급, 만성부비동염, 기관지염과기관지천식같은염증성기도질환에서과분비된점액은기도점막의점액섬모운동능을감소시키고이차적인세균감염을유발하여다양한호흡기질환을초래하게된다. 이때점액의과분비는여러종류의사이토카인이나펩타이드, 염증성매개물질이직간접적으로관여하여 MUC5AC나 MUC8과같은점액유전자의발현을상향조절시켜일어나게되는데, 9 대표적인염증유발사이토카인인 IL-1β가기도점막상피세포에서과다분비되는경우에는기도염증반응이 더욱촉발되는것으로알려져있다. 10 또한최근사람정상코점막 상피세포및사람폐점액상피양암종세포주 (NCI-H292 세포주 ) 에 대한연구에서, IL-1β 에의해유도되는 MUC5AC 의과발현이 ERK/p38 MAP kinase-msk1-creb 신호전달체계의순차적인 활성화에의해기도상피세포에서일어나는것임이밝혀진후, 11 점액 과분비조절을통한염증성기도질환의치료전략에새로운관점을 제공하게되었다. 현재까지사람호흡기상피세포에서점액과분비 4

12 조절물질로서 dexamethasone 혹은 budesonide가점액생산및점액유전자의발현을억제한다는연구결과가있으나, 12 [6]- gingerol, EGCG, curcumin, quercetin과같은식이폴리페놀성분에의한기도점액과분비조절에대한연구는미흡한실정이다. 7,8,13,14,15,16 이에본연구의목적으로첫째, 사람호흡기상피세포인 NCI- H292 세포에여러식이폴리페놀 ([6]-gingerol, EGCG, curcumin, quercetin) 을처치하여폴리페놀이 MUC5AC 유전자발현을억제하는가를알아보고자하였다. 다음으로세포의증식을억제하지않고 MUC5AC 유전자발현을억제하는농도로폴리페놀을사람코점막에처치하여폴리페놀이섬모운동에미치는영향을보고자하였다. 궁극적으로이연구를통해효과적으로 MUC5AC 유전자를억제하고섬모운동에는영향을미치지않거나증강시키는폴리페놀을발굴하고자하였다. 5

13 II. 재료및방법 (1) 재료사람 폐 점액상피양 암종 세포주 (human pulmonary mucoepidermoid carcinoma cell line) 인 NCI-H292 세포는 American Type Culture Collection (Rockville, MD, USA) 에서 구입하였다. EGCG, curcumin, quercetin은 Sigma Co. (St. Louis, MO, USA) 에서, [6]-gingerol은 Calbiochem Biochemicals (San Diego, CA, USA) 에서구입하였다. IL-1β는 R&D Systems (Minneapolis, MN, USA) 에서구입하였다. (2) 세포배양 NCI-H292 세포주는 95% 의공기와 5% 의이산화탄소, 가습화된환경에서 37 의온도로 10% fetal bovine serum과 2 mm L- glutamine, penicillin(100 μg/ml), streptomycin(100 μg/ml) 이포함된 RPMI-1640 배지 (Gibco BRL, Grand Island, NY, USA) 에서배양하였다. 분주후밤새배양한다음세포를 24시간동안 0.5% fetal bovine serum을포함하는 RPMI-1640 배지에서배양한후실험하였다. (3) 실험조건 MUC5AC 유전자를유도하기위한 IL-1β의농도는기존실험에서밝혀진 10 ng/ml의농도로이용하였다. [6]-gingerol은 DMSO를용매로 0.1µM, 1µM, 10µM로설정하였고, curcumin와 quercetin은 DMSO를용매로 10µM, 20µM, 40µM로설정하였다. EGCG는 H 2 O를 6

14 용매로실험농도를 10µM, 20µM, 40µM 로설정하였다. 6-well plate 에 배양된세포는 IL-1β 를처치하기 1 시간이전에각식이 polyphenol 을처리한다음 IL-1β 를 24 시간동안처치하였다. (4) Reverse transcriptase (RT)-PCR 전체 RNA는 Tri-Reagent(Molecular Research Center, Cincinnati, OH, USA) 를이용하여각조건으로배양된세포에서얻었으며전체 RNA에서 cdna로의역전사는 1 μg/20 μl의전체 RNA를 random hexanucleotide primer와 Moloney murine leukemia virus 역전사효소 (Gibco-BRL) 를이용하였고, 중합효소연쇄반응은 Perkin- Elmer Cetus DNA Thermal Cycler(Perkin-Elmer, Norwalk, CT, USA) 를이용하였다. 중합효소연쇄반응에사용한 oligonucleotide 시발체 (primer) 는 MUC5AC 의 GenBank TM sequence (GenBank TM accession number AJ001402) 에근거하여 5' primer CGACAACTACTTCTGCGGTGC; 3' primer GCACTCATCCTTCCTGTCGTT를사용하여 337 bp를증폭하였다. 각반응의대조군으로사용된 β 2 -microglobulin(β 2 M) 의 oligonucleotide primer는 Clontech Laboratories(Palo Alto, CA, USA; 335 bp fragment) 에서구입하였다. MUC5AC의중합효소연쇄반응은 95 에서 30초간변성 (denaturation) 과정과 60 에서 60초간결합 (annealing) 반응, 72 에서 60초간연장 (extension) 반응을 35회진행하였고증폭된 PCR 산물은 2% 한천겔에서전기영동하여 ethidium bromide 용액으로염색하여밴드를관찰하였고, 이를 sequencing하여염기서열을확인하였다. 7

15 (5) Real-time PCR 분석 Primer와 probe는 Perkin Elmer Life Sciences Primer Express software를이용해만들어 PE Biosystem에서구입하였다. TaqMan PCR Universal PCR Master Mix (PE Biosystem, Foster City, CA, USA) 와실험조건은생산자의 protocol을이용하였다. 1 mg의 cdna, primer 농도 800 nm의 oligonucleotides, 200 nm TaqMan hybridization probe 등을 25 μl로사용하였다. Real-time PCR의 probe는 5 -end에 carboxyfluoscein (FAM) 으로 labelling 하였고, 3 -end에 quencher carboxytetramethyl fluoresceing (TAMRA) 를 labelling 하였다. MUC5AC와 β2-microglobulin의 primer와 TaqMan probe는다음과같다. MUC5AC(Forward : 5'- CAGCCACGTCCCCTTCAATA-3'; Reverse : 5' ACCGCATTTGGGCATCC-3'; TaqMan probe : 6FAM- CCACCTCCGAGCCCGTCACTGAG-TAMRA), β2- microglobulin(forward : 5'- CGCTCCGTGGCCTTAGC-3', Reverse : 5'GAGTACGCTGGATAGCCTCCA-3' ; TaqMan probe : 6FAM-TGCTCGCGCTACTCTCTCTTTCTGGC-TAMRA) Real-time reverse transcription-pcr은 PerkinsElmer Life Science ABI PRISM 7700 Sequence Detection System (Foster City, CA, USA) 을사용하였다. MUC5AC mrna의상대적양은 threshold method을이용하여 comparative cycle로정하였고 β2m을대조군으로하여 normalization을하였다. 통계분석은 ANOVA with post hoc test를이용하여 p values <0.05를유의한것으로하였다. (6) 세포증식분석 8

16 NCI-H292 세포주를 well당 2,000개씩분주하여 96 well plate에서 16시간동안배양한다음각조건으로실험후세포증식분석을시행하였다. 분석은 Cell Titer 96 AQueous One Solution Proliferation Assay Kit (Promega Inc., Madison, WI, USA) 를사용하였다. 방법으로 kit에포함된 tetrazolium 합성물 2 ml와 phenazine ethosulfate 100 μl를섞은후 well당 20 μl의혼합용액을첨가하였다. 이후 1시간동안 37, 5% CO2의환경에서 96 well plate를배양한후 spectrophotometer(490 nm 파장 ) 로 optical density(o.d.) 를측정하였다. 통계분석은 ANOVA with post hoc test를이용하여 p values <0.05를유의한것으로하였다. (7) 섬모운동횟수검사비, 부비동내염증이없으며, 경접형동뇌하수체수술, 비강내조직검사혹은코막힘으로부비동수술을받는환자등에서건강한점막을채취하여 incubating chamber에서 37, 5% CO2에서 배양하며 6 시간동안안정화를시킨후 MUC5AC 발현을억제하는 최소농도의 polyphenol을각각처치하여시간대별 (0, 3 시간, 6시간, 12시간, 24시간 ) 로 inverted microscope로관찰하였다. 섬모운동의관찰은섬모운동이활발한부분을찾아 5군데부분을선정후관찰된영상을 microscope용 digital camera로녹화하여영상처리용전용컴퓨터에저장하였다. 이후저장된영상을변환하여 ciliary beat frequency를측정하는 program으로섬모운동횟수를측정하였다. 통계분석은 ANOVA with post hoc test를이용하여 p values <0.05를유의한것으로하였다. 9

17 III. 결과 (1) Polyphenol 에의한 IL-1β 유도 MUC5AC 유전자발현의변화각 Polyphenol을처리한이후 IL-11 유도MUC5AC 유전자발현의변화는 < 표 1.> 과같다. Quercetin, EGCG, [6]-gingerol은농도의존성으로유전자발현이감소하였으나 curcumin의경우 10 μm에서는 MUC5AC가감소하였으나 40 μm에서는오히려 MUC5AC가증가하였다. 이러한결과로 MUC5AC의발현을감소시키는폴리페놀의최소농도는 [6]-gingerol은 1 μm, Quercetin은 40 μm, EGCG는 20 μm, Curcumin은 10 μm농도로결정하여다음실험에이용하였다 ( 그림 1.). 11

18 <Table 1.> Change of IL-1β-induced MUC5AC gene expression by polyphenols μm 1 μm 10 μm [6]-Gingerol 4.8± ± ± ± μm 20 μm 40 μm Quercetin 5.1± ± ± ±0.3 EGCG 5.0± ± ± ±0.2 Curcumin 5.3± ± ± ±1.2 Ratio: MUC5AC expression of polyphenol-treated cells in treatment with IL-1β / MUC5AC expression of the control cells Value: mean ± standard deviation. 12

19 6-Gingerol 6 5 Quercetin 6 5 Fold increase Fold increase * * * 1 0 CTRL (µm) IL-1β 0 CTRL (µm) IL-1β EGCG 6 5 Curcumin Fold increase CTRL * * (µm) IL-1β Fold increase CTRL * (µm) IL-1β (Fig. 1.) Change of IL-1β-induced MUC5AC gene expression by polyphenols NCI-H292 cells were respectively pretreated with various concentrations of polyphenols for 1 h and then treated with 10 ng/ml of IL-1β for 24 h. Real-time PCR for MUC5AC mrna expression were performed on each group. Compared with cells treated only with IL-1β (0 μm), expression of MUC5AC mrna is significantly suppressed by pretreatment with 1μM [6]-gingerol, 40 μm quercetin, and 20 μm EGCG and the suppression is dosedependent. In 10 μm curcumin-treated cells, expression of MUC5AC mrna is significantly suppressed, but, in 40 μm curcumin-treated cells, expression of MUC5AC mrna is increased. p<0.05 when compared with IL-1β only-treated cells. 13

20 (2) 세포증식분석세포증식의변화는 < 표 2.> 와같다. Curcumin 40 μm에서 68.3±3.6% 로생존세포가 80% 이하로떨어진것을제외하면다른모든조건에서는세포증식이유의하게감소하지않아상기결정된농도가세포증식에는영향을미치지않는것을알수있었다 ( 그림 2.) 14

21 <Table 2.> Cell proliferation in treatment with polyphenols 0.1 μm 1 μm 10 μm [6]-Gi Gingerol 97.5± ± ± μm 20 μm 40 μm Quercetin 92.8± ± ±4.1 EGCG 96.1± ± ±4.8 Curcumin 93.2± ± ±3.6 Cell proliferation: mean proliferation of experimental group/mean proliferation of control x 100. (%) Value: mean ± standard deviation. 15

22 6-Gingerol Percentage of living cells (%) (µm) Quercetin Percentage of living cells (%) (µm) EGCG Percentage of living cells (%) (µm) Curcumin Percentage of living cells (%) (µm) (Fig. 2.) Cell proliferation in treatment with polyphenols In all examined concentration except 40 μm of curcumin, [6]- gingerol, quercetin, EGCG, and curcumin don t damage cell proliferation. 16

23 (3) 섬모운동의변화 MUC5AC 를억제하는폴리페놀의최소농도를정상코점막에각각투여한다음섬모운동의변화를알아보았다. < 표 3.> 의결과처럼 Quercetin, EGCG, [6]-gingerol은 30분에서 24시간까지의모든시간대에서섬모운동의변화가보이지않았다. 반면 curcumin의경우투여 1시간부터유의하게섬모운동이대조군에비해감소하여이후모든시간대에서섬모운동이감소하였다 (p<0.05) < 표 3.> ( 그림 3.) 17

24 Hour Material [6]-Gingerol (1μM) Quercetin (40µM) EGCG (20µM) Curcumin (10µM) ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±3.86 <Table 3.> Change of Ciliary movement in treatment of polyphenols [6]-gingerol, quercetin, EGCG shows no significant decrease of ciliary movement, but curcumin shows significant decrease of ciliary movement decrease since 1 hour after treatment(p<0.05) 18

120 100 120 100 Yongdong Severance 80 80 CBF(%) 60 CBF(%) 60 40 40 20 DMSO 1uM 6-Gingerol 6 20 DMSO 40μM M Quercetin 0 0 30min 1h 3h 6h 24h time 0 0 30min 1h 3h 6h 24h time 120 120 100 100 80 80

25 Yongdong Severance CBF(%) 60 CBF(%) DMSO 1uM 6-Gingerol 6 20 DMSO 40μM M Quercetin min 1h 3h 6h 24h time min 1h 3h 6h 24h time CBF(%) 60 CBF(%) DW 20μM M EGCG 0 30min 1h 3h 6h 24h time DMSO 10μM M Curcumin 0 30min 1h 3h 6h 24h time (Fig. 3.) Change of Ciliary movement in treatment of polyphenols [6]-gingerol, quercetin, EGCG shows no significant decrease of ciliary movement, but curcumin shows significant decrease of ciliary movement decrease since 1 hour after treatment(p<0.05) 19

26 IV. 고찰 기도점액의과분비는만성부비동염, 천식등과같은기도염증질환에서나타나는대표적인병적산물이다. 상기도염증은점액분비를증가시키는데, 여러가지염증성매개물질과사이토카인이직간접적으로점액분비를촉진하게된다. 현재까지 TNF-α, neutrophic elastase, IL-4, IL-9 등과같은염증성매개체는점액분비와점액유전자의발현을증가시키는것으로알려져있으며그중 IL-1β는다양한세포에서분비되는다기능의염증전구사이토카인으로서상기도염증반응유도에있어서가장중요한매개체로생각된다. 9 현재까지알려진점액유전자로는 13 개가있으며, 이중호흡기에관여하는유전자로는 MUC2, MUC5AC, MUC5B, MUC6, MUC7, MUC8 등이알려져있는데이중 MUC5AC 는가장중요한분비성점액유전자이다. 17 윤등은 IL- 1β 에의한 MUC5AC 유도과정에있어 ERK, p38, MAP kinase 를 통한신호전달체계가중요한역할을하며, IL-1β 에의한점액 단백의발현은전사단계에서조절됨을밝힌바있다. 10,11 이에본 실험에서는다양한식이폴리페놀들을이용하여 IL-1β에의한 MUC5AC 발현의변화를살펴보고 MUC5AC 발현감소를유도하는최소농도를확인하여해당농도에서섬모운동의변화를보았다. 실험결과배양된 NCI-H292 세포주에대해 1 μm, 10 μm 의 [6]-gingerol 을전처치할경우 MUC5AC 의발현이유의하게감소하였으며해당농도의경우세포증식에는유의한변화를야기하지않았다. 이에점액유전자발현을억제하는최소농도인 20

27 1 μm 의 [6]-gingerol 을사람코점막상피세포에처리하여섬모운동회수의변화를실험한결과대조군과비교시모든시간대에서유의한섬모운동의변화는보이지않았다. Quercetin 과 EGCG 는각각 40 μm, 20 μm 에서점액유전자발현을감소시키기시작하였으며이농도에서세포증식의변화는일어나지않았다. 또한섬모운동회수는 30 분-24 시간까지의모든시간대에서대조군과유의한차이를보이지않았다. 이러한결과는 MUC5AC 유전자발현억제에대해 NCI-H292 세포주에서 dexametasone 이 MUC2 와 MUC5AC 점액유전자의발현을억제시켰다는보고 12 와 budesonide 가 IL-1β에의해항진된 MUC2/5AC 점액유전자와점액단백의생성을억제하였다는보고 18,19 와일치하는결과였다. 또한폴리페놀에대한다른연구결과로 [6]-gingerol 과 EGCG 에대한결과와도 점액유전자억제에대해서일치하였다. 13,14,15,16 [6]-gingerol 의 경우기존의연구에서는 10 μm 에서 MUC5AC 유전자발현억제가 보였는데이는세포주는같으나 RT-PCR 을이용한실험으로본 실험에서이용한 real-time PCR 이민감도가뛰어나므로 10 본 결과에서는 1 μm 부터억제가보인것으로생각한다. 한편 EGCG 의경우다른연구에서는사람정상코점막상피세포를 대상으로실험을하여 50 μm 부터 MUC5AC 유전자발현억제가 보였고본실험은세포주를이용하여 10 μm 부터억제가보인 것으로보인다. 10 즉, 정상세포의경우항상성이있어약물에대한 반응이세포주보다높은농도를요구하거나반응시간이늦어 이러한결과가보인것으로생각한다. 21

28 섬모운동의경우가능하면섬모운동을항진시켰으면하는것이실험전의생각이었다. 그러나섬모운동에대한참고문헌에의하면대부분의약물들은섬모운동을저하시키며섬모운동이증가되는것도오히려비강내의기능을악화시키므로섬모운동의운동이정상적으로유지되는것이코의정상기능을유지하는면에서는 더욱도움이된다하겠다. 20,21 본실험결과도이러한측면에서 추후임상적용이가능하다고생각한다. 한편 curcumin 은 10 μm 에서는유의하게 IL-1β 유도 MUC5AC 유전자발현의감소를유도하였으나 40 μm 의농도에서는오히려점액유전자발현이증가하는결과를보였다. 따라서본실험에서는점액유전자발현의감소를보였던 10 μm 농도에서세포증식및섬모운동회수를확인하였다. 세포증식률의변화는 93.2±1.9% 로이농도에서는유의한세포증식억제를보이지않으므로이농도로섬모운동의변화를보았다. 섬모운동은 30 분째부터하강소견을보이고 1 시간째최대 75% 정도로하강하여유의한섬모운동감소를보였고이러한소견은이후 24 시간까지지속되었다. curcumin 에의한점액분비감소와증가에대해서는 curcumin 은카레의매운맛을내는데주요한성분이므로저농도에서는분비가억제되나높은농도에서는자극에의해점액이증가하는것으로생각되나이에대해서는추후연구가필요하리라본다. 점액분비에대한다른연구에서는 curcumin 100 μm 에서점액분비가증가하였다고하여, 8 본연구의 20, 40 μm 에서의결과와일치하였다. 이처럼 curcumin 의점액분비감소와증가에대한영향은그고유한성질에의한것으로생각되며이에대해서는추가연구가필요하리라본다. 이러한 22

29 점액의 분비 증가는 감귤류의 주요한 폴리페놀인 hesperidine 에서도관찰되어각성분의고유한성질임을알수 있었다. 7 또한본실험결과에의하면 curcumin 은섬모운동을 저하시켜코의기능저하를야기할수있으므로 22 이의임상적 사용에부정적으로작용한다하겠다. 이러한결과를종합하면 [6]-gingerol, quercetin, EGCG 등은 섬모운동에변화를주지않고점액분비를감소시키는데유용할 것으로생각하나, curcumin 은섬모운동에감소를야기하므로임상 응용에문제가있으리라생각한다. 23

30 V. 결론 [6]-gingerol, quercetin, EGCG 등은호흡기상피세포의 점액분비를효과적으로억제하며코점막섬모운동은정상적으로 유지하므로임상적으로이용가능한점액분비억제물질로생각된다. 24

31 < 참고문헌 > 1. Cragg GM, Newman DJ, Weiss RB. Coral reefs, forests, and thermal vents: the worldwide exploration of nature for novel antitumor agents. Semin Oncol 1997;24: P. M. Dewick, The Biosynthesis of shikimate Metabolites, Natural Product Reports 1995;12: E. Matuschek, U. Svanberg. Oxidation of polyphenols and the effect on in vitro iron accessibility in a model food system. Journal of Food Science 2002;67(1): Kuhnau J. The flavonoids. A class of semi-essential food components: their role in human nutrition. World Rev Nutr Diet 1976;24: Sampson L, RimmE, Hooman PC, de Vries JH, Katan MB. Flavonol and flavne intakes in US health professionals. J Am Diet Assoc 2002;102: Yoon JH, Baek SJ. Molecular targets of dietary polyphenols with antiinflammatory properties. J Yonsei Med 2005;46: Lee CJ, Lee JH, Seok JH, Hur GM, Park JS, Bae SH et al. Effects of betaine, coumarin, and flavonoids on mucin release from cultured hamster tracheal surface epithelial cells. Phytother. Res. 2004;18: Lee CJ, Lee JH, Seok JH, Hur GM, Park YC, Seol IC et al. Effects of baicalein, berberine, curcumin and hesperidin on mucin release from airway goblet cells. Planta Med. 2003;Jun 69(6): Kim HU, Kim CH, Lee YH, Lee JG, Yoon JH. Expression of MUC5AC and MUC8 mrna in human nasal mucosa. Korean J Otolaryngol 2001;44: Kim YD, Kwon EJ, Cho JS, Lee JE, Woo HJ, Beak SH et al. Regulation of IL-1β-mediated MUC2 gene and mucin in human airway epithelial cells. Korean J Otolaryngol 2002;45: Song KS, Lee WJ, Chung KC, Koo JS, Yang EJ, Yoon JH et al. Interleukin- 25

32 1β and tumor necrosis factor-α induce MUC5AC overexpression through a mechanism involving ERK/p38 mitogen-activated protein kinases-msk1- CREB activation in human airway epithelial cells. J Biol Chem 2003;278: Kai H, Yoshitake K, Hisatsune A, Kido T, Isohama Y, Takahama K, et al. Dexamethasone suppresses mucus production and MUC-2 and MUC-5AC gene expression by NCI-H292 cells. Am J Physiol 1996;271: Chang JH, Kim JH, Lee KW, Cho CI, Chun JH, Kim KS. Supression of IL- 1β-induced MUC5AC gene expression by Ginko biloba extract(egb761) in huamn airway epithelial cells. Korean J Rhinology 2007;14(1): Kim JH. [6]-gingerol supresses IL-1β-induced MUC5AC gene expression in human airway epithelial cells via both ERK and p38 MAPK signal transduction pathways. Yonsei university; Nam JI. Supression of MUC5AC gene expression by the components of Ginkgo biloba extract (EGb761) in human airway epithelial cells. Yonsei university; KIM HJ, Park SH, Park SY, Moon Uy, Lee BD, Yoon SH, Lee JG, Beak SJ, Yoon JH. Epigallocatechin-3-gallate inhibits interleukin-1β-induced MUC5AC gene expression and MUC5AC secretion in normal human nasal epithelial cells. J Nutr Biochem. 2008;19: Yoon JH, Park IY. Mucin gene expression and mucin secretion in human airway epithelium. Rhinology 1998;36: Kim YD, Cho JS, Chang KY, Sin JH, Song SY, Yoon SK. Budesonide down-regulates IL-1β-mediated MUC2/MUC5AC genes expression and mucin secretion in human airway epithelial cells. Korean J Otolaryngol 2002;45: Kim YD, Kwon EJ, Kwon TK, Baek SH, Song SY, Suh JS. Regulation of IL-1β-mediated MUC2 gene in NCI-H292 human airway epithelial cells. 26

33 Biochem Biophys Res Commun 2000;274: Wyatt Todd A., Forget Mary A., Sisson Joseph H. Ethanol stimulates ciliary beating by dual cyclic nucleotide kinase activation in bovine brohchial epithelial cells. The American Journal of Pathology 2003;vol.163: Braverman I, Wright ED, Wang CG et al. Human nasal ciliary-beat frequency in normal and chronic sinusitis subjects. J Otolaryngol 1998;27: Joki S, Toskala E, SannoV. Correlation between ciliary beat frequency and the structure of ciliated epithelia in pathologic human nasal mucosa. Laryngoscope 1998;108 :

34 Abstract Effects of dietary polyphenols on expression of MUC5AC gene in respiratory epithelial cells and on ciliary movement in human nasal mucosa Kee Jae Song Department of Medicine The Graduate School, Yonsei University (Directed by Professor Kyung-Su Kim) 1. Background and objective Dietary polyphenols have been widely consumed in food, and their anti-inflammatory, anti-oxidative and anti-mutagenic activities have been recently studied. However, the effect on mucin hypersecretion or mucociliary movement of dietary polyphenol has not been elucidated yet. Therefore, this study was to investigate whether dietary polyphenols ([6]-gingerol, EGCG, curcumin, quercetin) inhibit MUC5AC gene expression, and if so, whether they would have effect on the ciliary movement of human nasal mucosa. 2. Material and method After NCI-H292 cells had been treated with IL-1β (10 ng/ml) and pretreated with 4 different dietary polyphenols ([6]-gingerol, EGCG, curcumin, quercetin), the mrna expression of MUC5AC 28

35 was determined by real-time polymerase chain reaction. Normal nasal mucosa was obtained during sphenoid sinusotomy and treated with minimal inhibitory concentration of each polyphenol. Ciliary movement was assessed via inverted microscope and computerized program. 3. Result Minimal inhibitory concentration of MUC5AC gene expression in each polyphenol was found as following; [6]-gingerol 1 μm, EGCG 20 μm, quercetin 40 μm, and curcumin 10 μm. Each polyphenol did not influence cell proliferation at this minimal inhibitory concentration. In assessment of ciliary movement, [6]-gingerol, quercetin, EGCG did not show any difference between control group and experiment group, but curcumin showed decrease of ciliary movement. 4. Conclusion [6]-gingerol, quercetin, and EGCG suppress MUC5AC gene expression and maintain normal ciliary movements. Therefore, these polyphenols may be used as anti-hypersecretory agents and the further clinical study will be needed Key Words : polyphenol, MUC5AC, ciliary movement 29

Microsoft Word doc

Microsoft Word doc KISEP Rhinology Korean J Otolaryngol 2006;49:307-12 사람정상코점막상피세포에서겔형성점소 (Gel-Forming Mucin) 분비에대한 Prostaglandin E 2 의효과 김진국 1 김창훈 2,3 김규보 2 장현종 1 김현직 2 윤주헌 2,3,4 Effect of Prostaglandin E 2 on Gel-forming