한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification o

Size: px
Start display at page:

Download "한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification o"

Transcription

1 한수지 50(4), , 2017 Note Korean J Fish Aquat Sci 50(4), ,2017 부산기장에서채집된말미잘의분자생물학적방법을이용한동정 유상준 김도형 * 부경대학교수산생명의학과 Molecular Identification of a Sea Anemone (Cnidaria: Anthozoa: Actiniaria) Obtained in Gijang, Busan Sang Joon Yoo and Do-Hyung Kim* Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Korea In this study, we tried to identify a sea anemone collected from the coast of Gijang, Busan. The anemone was morphologically similar to species belonging to the genus Anthopleura, but its morphological characteristics did not allow for confirmed identification to species level. Multiple genes from mitochondrial cytochrome oxidase III, 12S and 16S rrna, and nuclear 18S and 28S rrna, were amplified for multilocus sequence typing (MLST) analysis using genomic DNA extracted from the sampled anemone and a different primer set. Based on the MLST analysis, the anemone obtained in this study was identified as Anthopleura artemisia. Also, the sequence of internal transcribed spacer-2 was most closely related to A. artemisia, indicating that this single region might be useful for anemone identification. This study shows significance of molecular identification for sea anemones, and will be helpful in studies of sea anemone identification using genotyping-by-sequencing. Key words: Sea anemone, Actiniaria, Molecular identification, Anthopleura artemisia, Multilocus sequence typing 서론 (order Actiniaria) (Cnidaria) (class Anthozoa) (Daly et al., 2008)., - (benthic-pelagic coupling) (Daly et al., 2008). 1,200 (synapomorphy) (Rodriquez et al., 2015). (column) (tentacle), (mesenteries) (Reft and Daly, 2012). (dinoflagellate) (Reft and Daly, 2012). Stephenson (1922) Endocoelantheae, Nynantheae Protantheae 3, Carlgren (1949) Ptychodactiaria 4. Nynantheae 1,100, 3 (Daly et al., 2008; 2010; Rodriguez and Daly, 2010; Rodriguez et al., 2012). Calgren (1949), (Fautin et al., 2013). (genus). (Daly et al., 2008) (Daly et al., 2010). 1962, (Anthopleura) Anthopleura japonica, A. midori, A. pacifica (Song, 1984) A. kurogane (Song, 1992),. Korean J Fish Aquat Sci 50(4) , August 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 7 June 2017; Revised 14 July 2017; Accepted 27 July 2017 *Corresponding author: Tel: Fax: address: dhkim@pknu.ac.kr Copyright 2017 The Korean Society of Fisheries and Aquatic Science 447 pissn: , eissn:

2 448 유상준ㆍ김도형,,,. (stark), (column), (pedal disk) (actinopharynx) 재료및방법 말미잘시료의채집 (N35, 15 ; E129, 14 ). 35, 18 o C, ph 8.1 (Artificial seawater, Kent, USA). Genomic DNA 의분리및 PCR Genomic DNA, (tentacle column),, ( g),, 1.5 ml DNeasy Blood and Tissue Kit (Qiagen Corporation, Santa Clarita, CA) DNA. 1 lysis Geller and Walton (2001) Rodriguez and Daly (2010; 2014). DNA (Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014) (mtdna) Cytochrome oxidase III (COIII), 12S rrna (12S) 16S rrna (16S) (nrdna) 18S rrna (18S) 28S rrna (28S). MyCycler (Bio-rad, Hercules, CA) PCR. internal transcribed spacer-2 (ITS2) PCR. primer PCR Table 1. PCR 1 µl 1% Mpid-2 plus (Takara, Japan) 25 AccuPrep TM PCR Purification Kit (Bioneer, Korea) Table 1. Primer sets and PCR conditions used in this study Set No Target region Cytochrome oxidase III (mtdna) 12S rrna (mtdna) 16S rrna (mtdna) Internal transcribed spacer-2 (nrdna) 18S rrna (nrdna) 28S rrna (nrdna) Marker Sequence (5ˊ-3ˊ) Cycling Profile Reference COIII-F COIII-R ANTMT12S-F ANTMT12S-R ANEM16SA ANEM16SB CATTTAGTTGATCCTAG- GCCTTGACC (95 C for 2 m) CAAACCACATCTACAAAAT- GCCAATATC AGCCACACTTTCACTGAAA- CAAGG GTTCCCYYWCYCTYACYAT- GTTACGAC CACTGACCGTGATAATG- TAGCGT CCCCATGGTAGCTTTTATTCG [(95 C for 30 s)(46 C for 45s)(72 C for 1 m)] x 30 (95 C for 4 m) [(94 C for 30 s)(50 C for 1 m)(72 C for 2 m)] x 4 [(94 C for 30 s)(55 C for 1 m)(72 C for 2 m)] x 30 (95 C for 2 m) [(95 C for 30 s)(60 C for 30s)(72 C for 1 m)] x 30 itsd GTGAATTGCAGAACTCCGTG (95 C for 7 m) (94 C for 45 s)(52 C for 45 s) (72 C for 45 s) x 35 ITS-2rev2 CCTCCGCTTACTTATATGCTT ss5 ss3z GGTGATCCTGCCAGTAGT- CATATGCTTG (95 C for 2 m) AGCACTGCGTCAGTCG- GAATATTCACCGG LSU D1-D2 fw1 AGCGGAGGAAAAGAAACTA (95 C for 5 m) LSU D1-D2 rev1 TACTAGAAGGTTCGATTAGTC [(95 C for 1 m)(54 C for 1 m)(72 C for 2 m)] x 30 [(94 C for 30 s)(45 C for 1 m)(65 C for 12 m)] x 30 (72 C for 10 m) Geller and Walton, 2001 Chen et al., 2002 Geller and Walton, 2001 Stat et al., 2009 Pochon and Ruth, 2010 Rowan et and Powers, 1991 Geller and Walton, 2001 Sonnenberg et al, 2007

3 449 말미잘의 분자생물학적 동정 을 이용하여 정제 하였으며, ABI Prism 3730 xl DNA Analyzer (PE Applied Biosystems, USA)를 사용하여 sequencing을 실 시 하였다. 염기서열 수집 및 분석 현재 데이터베이스에 있는 것과 이번 연구에서 나온 염기서 열을 분석하기 NCBI 데이터베이스로부터 5개 유전자(COIII, 12S, 16S, 18S 및 28S) 염기서열이 모두 존재하는 44개의 속 을 대표하는 각 종의 염기서열을 수집하였으며(Table 2), 이를 MUSCLE 프로그램(Robert et al., 2004)을 이용하여 동일한 크기로 정렬(alignment)하였다(Table 2). 각 유전자의 길이는 Table 2 (Parsimony informative characters)에 나타내었다. 본 연구에서 얻어진 염기서열을 포함하여 45종의 각 유전자 염기 서열을 MEGA 7을 이용하여 결합하였으며(concatenated sequence), Kimura 2-parameter로 1,000번의 bootstrap value를 샘플링을 하여 계통수(Neighbor-Joining tree)를 작성하였다. Table 2. Results of parsimony analysis of each data set and concatenated sequence Marker or data set Marker # Parsimony un-aligned Informative Characters (% informative) length COIII (mtdna) (91.11%) 12S rrna (mtdna) (88.13%) 16S rrna (mtdna) (98.25%) 18S rrna (nuclear) (94.67%) 28S rrna (nuclear) (74.75%) concatenated sequence (5 target genes) (88.37%) 결과 및 고찰 본 연구의 채집 말미잘은 조간대에서 부착 생활을 하기 위해 발판(pedal disc)이 잘 발달 했으며, 무게 6.6 g과 지름 2.2 cm의 크기(Fig. 1)로 촉수 주변으로 소낭(marginal spherules)이 관 찰 되었다. 또한 몸통(column) 상부 쪽으로부터 수직 열로 발 달 된 돌기(stark)가 도드라졌으며, 5줄의 원형으로 배치된 촉수 는 가장 안쪽의 원에서 촉수 2개씩, 12쌍으로 구성되어 육방산 호아강(Hexacorallia)의 특징을 잘 나타내었다. 형태와 서식지 로 볼 때, 국내 해변에서 흔하게 발견되는 꽃해변말미잘류(Anthopleura)로 판단되었다. 특히 형광 녹색을 띄는 몸체와 돌기 의 색은 Song (1984; 1992)에 의해 보고 된 풀색꽃해변말미잘 (Anthopleura midori)의 특징을 나타내었으나, 촉수가 자색으 로 기존 보고된 풀색해변꽃말미잘과는 차이가 있었다. 이러한 형태학적 특징은 국내 미 보고 종인 Anthopleura artemisia 와도 매우 유사하여 한 종으로 특정할 수는 없었다. 1958년 Uchida 와 Muramatsu (1958)에 의해 명명된 A. midori는 현재 World register of marine species (WoRMS, 등재되어 있지 않고 synonym으로 A. anjunae Den Hartog and Vennam (1993)라는 종명이 수용되고 있는 것 을 확인할 수 있다. 그러나 현재 NCBI에는 A. anjunae의 염기 서열은 없고 모두 A. midori의 것만 등재되어 있어 본 연구에서 도 이 종의 염기서열을 비교하는데 사용하였다. 일반적으로 말미잘의 4개 아목(suborder)의 분류 기준은 각 아목의 형태학적으로 특징이 이용되어 왔다. 예를 들어 장막 섬모(Mesenteric filament)의 경우 아목, Endocoelantheae와 Nynantheae에 특징적으로 존재하지만, Protantheae와 Ptychodacteae에는 없다. 또한 장막의 특이적인 배열은 Endocoelantheae와 Ptychodacteae에서만 보이는 특징이다(Calgren et 1cm Fig. 1. Sea anemone Anthopleura artemisia used in this study.

4 450 유상준ㆍ김도형 al., 1949). 1,100 Nynantheae. Rodriguez et al. (2014) Calgren Nynantheae. sequencing mtdna COIII, 12S 16S nrdna 18S 28S Identity. 5 Anthopleura Actinia Identity ( 93% 89%) (Fig. 2). NCBI Anthopleura 21, 4 (mtdna COIII, 12S, 16S nrdna 18S) 6 (A. artemisia, A. handi, A. elegantissima, A. rosea, A. kurogane, A. midori), Identity 99%, 97%, 97%, 97%, 95% 95% A. artemisia. ITS2 (342 bp) Anthopleura artemisia, Anthopleura atodi, Anthopleura rosea Anthopleura handi 99, 83, 83 92% Identity, 5 A. artemisia Identity. Pochon et al. (2001) ITS2. ITS2,. Stoletzki and Schierwater (2005) ITS2, Condylactis gigantea C. aurantiaca ITS2. ITS2, 5 Anthopleura artemisia Anthopleura. NCBI ITS2 Anthopleura 4 (A. artemisia, A. atodi, A. rosea Hormathia armata Antholoba achates Kadosactis Antarctica Phellia gausapata Calliactis parasitica Actinoscyphia plebeian Andvakia boninensis Amphianthus spp. Actinauge richardi Cereus pedunculatu Bathyphellia australis Haloclava product Hormosoma scotti Stomphia didemon Stomphia selaginella Nematostella vectensis Edwardsia japonica Edwardsia elegans Alvinactis chessi Edwardsia timida Antipodactis awii Diadumene cincta Haliplanella ineata Metridium senile Sagartia troglodytes Cactosoma spp. Anthosactis pearseae Sagartiogeton aceratus Verrillactis paguri Aiptasia pulchella Bartholomea annulata Paranthus niveus Epiactis lisbethae Bunodactis verrucosa Dactylanthus antarcticus Bunodosoma grandis Anthopleura elegantissima Actinia fragacea Stichodactyla gigantea Heteractis magnifica Macrodactyla doreenensis Urticina coriacea Isosicyonis striata Metedwardsia akkeshi Sea anemone sampled in this study Fig. 2. Parsimony tree of concatenated sequences (mitochondrial COIII, 12S and 16S, and nuclear 18S, and 28S rrna gene) obtained in this study. Species epithets are given only for genera represented by more than one species. Bootstrap values more than 50 are shown.

5 말미잘의분자생물학적동정 451 A. handi). (Daly et al., 2008)., (Daly et al., 2008)., (e.g., Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014). 12S, 16S COIII 18S 28S 5,. Eernisse and Kluge (1993) 5, (e.g., Daly et al., 2008; Daly et al., 2010; Rodriguez et al., 2012; 2014). cytochrome subunit I gene (COI) (interspecific variability) (Shearer et al., 2002; Flot et al., 2013). Keshavmurthy et al. (2013) COI, Stylophora. (Flot et al., 2008). (genus level).. A. artemisia.,., 18S rdna (Gilan et al, 2015)..,. 5 house-keeping gene Anthopleura NCBI A. artemisia. Song (1984; 1992) (Anthopleura midori), WoRMS, A. artemisia.. 사사 (2015 ). References Carlgren O A survey of the Ptychodactiaria, Corallimorpharia and Actiniaria. Almqvist Wiksells boktr 1, Chen CA, Wallace CC and Wolstenholme J Analysis of the mitochondrial 12S rrna gene supports a two-clade hypothesis of the evolutionary history of scleractinian corals. Mol Phylogenet Evol 23, Daly M, Chaudhuri A, Gusmao L and Rodriguez E Phylogenetic relationships among sea anemones (Cnidaria: Anthozoa: Actiniaria). Mol Phylogenet Evol 48, Daly M, Gusmao LC, Reft AJ and Rodriguez E Phylogenetic signal in mitochondrial and nuclear markers in sea anemones. Integrat Comparat Biol 50, /icb/icq081. Flot JF, Licuanan WY, Nakano Y, Payri C, Cruaud C and Tillier S Mitochondrial sequences of Seriatopora corals show little agreement with morphology and reveal the duplication of a trna gene near the control region. Coral Reefs 27, Flot JF, Dahl M and André C Lophelia pertusa corals from the Ionian and Barents seas share identical nuclear ITS2 and near-identical mitochondrial genome sequences. BMC Res Notes 6, Geller JB and Walton ED Breaking up and getting together: evolution of symbiosis and cloning by fission in sea anemones (genus Anthopleura). Evolution 55, doi.org/ / (2001)055[1781:buagte]2.0.co;2. Gilan AF, Pegah J and Arash S Morphology and phylogeny of the sea anemone Stichodactyla haddoni (Cnidaria: Anthozoa: Actiniaria) from Chabahar Bay. Turk J Zool 39, Hellberg and Michael E No variation and low syn-

6 452 유상준ㆍ김도형 onymous substitution rates in coral mtdna despite high nuclear variation. BMC Evol Biol 6, / Keshavmurthy S, Yang S, Alamaru A, Chuang Y, Pichon M, Obura D, Fontana S, De Palmas S, Stefani F, Benzoni F, MacDonald A, Noreen AME, Chen C, Wallace CC, Pillay RM, Denis V, Amri AY, Reimer JD, Mezaki T, Sheppard C, Loya Y, Abelson A, Mohammed MS, Baker AC, Mostafavi PG, Suharsono BA and Chen CA DNA barcoding reveals the coral laboratory-rat, Stylophora pistillata encompasses multiple identities. Sci Rep 3, org/ /srep Pochon X, Pawlowski J, Zaninetti L and Rowan R High genetic diversity and relative specificity among Symbiodinium-like endosymbiotic dinoflagellates in soritid foraminiferans. Mar Biol 139, s Pochon X and Ruth DG A new Symbiodinium clade (Dinophyceae) from soritid foraminifera in Hawai i. Mol phylogenet evol 56, Reft A and Daly M Morphology, distribution, and evolution of apical structure of nematocysts in Hexacorallia. J Morphol 273, Rodriguez E and Daly M Phylogenetic relationships among deep-sea and chemosynthetic sea anemones: Actinoscyphiidae and Actinostolidae (Actiniaria: Mesomyaria). PLoS ONE 5, e Rodriguez E, Barbeitos M, Daly M, Gusmao LC and Haussermann V Toward a natural classification: phylogeny of acontiate sea anemones (Cnidaria, Anthozoa, Actiniaria). Cladistics 1, x. Rodriguez, E, Barbeitos MS, Brugler MR, Crowley LM, Grajales A, Gusmao L and Daly M Hidden among sea anemones: the first comprehensive phylogenetic reconstruction of the order Actiniaria (Cnidaria, Anthozoa, and Hexacorallia) reveals a novel group of hexacorals. PLoS One 9, e96998, Rowan R and Powers DA A molecular genetic classification of zooxanthellae and the evolution of animal-algal symbioses. Science 251, Shearer TL, Van OSL, Romano G and Wörheide Slow mitochondrial DNA sequence evolution in the Anthozoa (Cnidaria). Mol Ecol 11, j x x. Song JI A systematic study on the Korean Anthozoa 8. Actiniaria (Hexacorallia). J Korean Res Instit Better Liv 34, 69. Song JI Systematic study on Anthozoa from the Korea Strait in Korea: subclasses Zoantharia and Ceriantipatharia. Anim Syst Evol Divers 8, Sonnenberg, Rainer, Arne WN and Diethard T An evaluation of LSU rdna D1-D2 sequences for their use in species identification. Front zool 4, 6. Stat M, Pochon X, Cowie R and Gates RD Specificity in communities of Symbiodinium in corals from Johnston Atoll. Mar Ecol Prog Ser 386, org/ /meps Stephenson TA On the classification of Actiniaria. Part III. Definitions connected with the forms dealt with in Part II. Q J Microscop Sci 66, Stoletzki N and Schierwater B Genetic and color morph differentiation in the Caribbean sea anemone Condylactis gigantea. Mar Biol 147, s y.

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

Microsoft Word - eco1201.doc

Microsoft Word - eco1201.doc 분지론의 과거, 현재, 미래 Past, present and future of the Cladistics 최 세 웅 목포대학교 환경교육학과 1. 서론 2. 본론 2-1. 과거 - 계통학의 역사 및 분지론의 탄생 2-2. 현재 - 분지론 2-3. 미래 및 결론 3. 참고문헌 1 1. 서론 우리나라에서는 매년 여름 비무장지대를 중심으로 말라리아가 말썽을

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   * A Research Trend Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR

More information

http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

04±èºÎ¼º

04±èºÎ¼º Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

PJTROHMPCJPS.hwp

PJTROHMPCJPS.hwp 제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

step 1-1

step 1-1 Written by Dr. In Ku Kim-Marshall STEP BY STEP Korean 1 through 15 Action Verbs Table of Contents Unit 1 The Korean Alphabet, hangeul Unit 2 Korean Sentences with 15 Action Verbs Introduction Review Exercises

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

Microsoft PowerPoint - 27.pptx

Microsoft PowerPoint - 27.pptx 이산수학 () n-항관계 (n-ary Relations) 2011년봄학기 강원대학교컴퓨터과학전공문양세 n-ary Relations (n-항관계 ) An n-ary relation R on sets A 1,,A n, written R:A 1,,A n, is a subset R A 1 A n. (A 1,,A n 에대한 n- 항관계 R 은 A 1 A n 의부분집합이다.)

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume

Development of culture technic for practical cultivation under structure in Gastrodia elate Blume Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,

More information

<28C3D6C1BE29312DC0CCBDC2BEC62E687770>

<28C3D6C1BE29312DC0CCBDC2BEC62E687770> 한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연

More information

05-08 087ÀÌÁÖÈñ.hwp

05-08 087ÀÌÁÖÈñ.hwp 산별교섭에 대한 평가 및 만족도의 영향요인 분석(이주희) ꌙ 87 노 동 정 책 연 구 2005. 제5권 제2호 pp. 87118 c 한 국 노 동 연 구 원 산별교섭에 대한 평가 및 만족도의 영향요인 분석: 보건의료노조의 사례 이주희 * 2004,,,.. 1990. : 2005 4 7, :4 7, :6 10 * (jlee@ewha.ac.kr) 88 ꌙ 노동정책연구

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

歯15-ROMPLD.PDF

歯15-ROMPLD.PDF MSI & PLD MSI (Medium Scale Integrate Circuit) gate adder, subtractor, comparator, decoder, encoder, multiplexer, demultiplexer, ROM, PLA PLD (programmable logic device) fuse( ) array IC AND OR array sum

More information

한수지 51(3), , 2018 Original Article Korean J Fish Aquat Sci 51(3), ,2018 확률신경망에의한해저저질의식별 이대재 * 부경대학교해양생산시스템관리학부 Classifying Seafloor Sedim

한수지 51(3), , 2018 Original Article Korean J Fish Aquat Sci 51(3), ,2018 확률신경망에의한해저저질의식별 이대재 * 부경대학교해양생산시스템관리학부 Classifying Seafloor Sedim 한수지 51(3), 321-327, 2018 Original Article Korean J Fish Aquat Sci 51(3),321-327,2018 확률신경망에의한해저저질의식별 이대재 * 부경대학교해양생산시스템관리학부 Classifying Seafloor Sediments Using a Probabilistic Neural Network Dae-Jae Lee*

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: * The Grounds and Cons

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI:   * The Grounds and Cons Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.63-81 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.63 * The Grounds and Consequences of the Elementary School Teachers' Trust Formation

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2

2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2 (Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: * Early Childhood T

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   * Early Childhood T Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.243-269 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.243 * Early Childhood Teachers' Perception on Reconstruction of Curriculum

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * Experiences of Af

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI:   * Experiences of Af Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp.201-229 DOI: http://dx.doi.org/10.21024/pnuedi.26.2.201608.201 * Experiences of After-school Class Caring by Married Early Childhood

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap

Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI:   * Strenghening the Cap Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

<35BFCFBCBA2E687770>

<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

아니라 일본 지리지, 수로지 5, 지도 6 등을 함께 검토해야 하지만 여기서는 근대기 일본이 편찬한 조선 지리지와 부속지도만으로 연구대상을 한정하 기로 한다. Ⅱ. 1876~1905년 울릉도 독도 서술의 추이 1. 울릉도 독도 호칭의 혼란과 지도상의 불일치 일본이 조선

아니라 일본 지리지, 수로지 5, 지도 6 등을 함께 검토해야 하지만 여기서는 근대기 일본이 편찬한 조선 지리지와 부속지도만으로 연구대상을 한정하 기로 한다. Ⅱ. 1876~1905년 울릉도 독도 서술의 추이 1. 울릉도 독도 호칭의 혼란과 지도상의 불일치 일본이 조선 근대기 조선 지리지에 보이는 일본의 울릉도 독도 인식 호칭의 혼란을 중심으로 Ⅰ. 머리말 이 글은 근대기 일본인 편찬 조선 지리지에 나타난 울릉도 독도 관련 인식을 호칭의 변화에 초점을 맞춰 고찰한 것이다. 일본은 메이지유신 이후 부국강병을 기도하는 과정에서 수집된 정보에 의존하여 지리지를 펴냈고, 이를 제국주의 확장에 원용하였다. 특히 일본이 제국주의 확장을

More information

<B3EDB9AEC1FD5F3235C1FD2E687770>

<B3EDB9AEC1FD5F3235C1FD2E687770> 경상북도 자연태음악의 소박집합, 장단유형, 전단후장 경상북도 자연태음악의 소박집합, 장단유형, 전단후장 - 전통 동요 및 부녀요를 중심으로 - 이 보 형 1) * 한국의 자연태 음악 특성 가운데 보편적인 특성은 대충 밝혀졌지만 소박집합에 의한 장단주기 박자유형, 장단유형, 같은 층위 전후 구성성분의 시가( 時 價 )형태 등 은 밝혀지지 않았으므로

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are

More information

02Á¶ÇýÁø

02Á¶ÇýÁø Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study

More information

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소

KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소 1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지

More information

歯M991101.PDF

歯M991101.PDF 2 0 0 0 2000 12 2 0 0 0 2000 12 ( ) ( ) ( ) < >. 1 1. 1 2. 5. 6 1. 7 1.1. 7 1.2. 9 1.3. 10 2. 17 3. 25 3.1. 25 3.2. 29 3.3. 29. 31 1. 31 1.1. ( ) 32 1.2. ( ) 38 1.3. ( ) 40 1.4. ( ) 42 2. 43 3. 69 4. 74.

More information

09김정식.PDF

09김정식.PDF 00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>

More information

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: / ,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>

<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770> 디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

민속지_이건욱T 최종

민속지_이건욱T 최종 441 450 458 466 474 477 480 This book examines the research conducted on urban ethnography by the National Folk Museum of Korea. Although most people in Korea

More information

182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연

182 동북아역사논총 42호 금융정책이 조선에 어떤 영향을 미쳤는지를 살펴보고자 한다. 일제 대외금융 정책의 기본원칙은 각 식민지와 점령지마다 별도의 발권은행을 수립하여 일본 은행권이 아닌 각 지역 통화를 발행케 한 점에 있다. 이들 통화는 일본은행권 과 等 價 로 연 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 181 越 境 하는 화폐, 분열되는 제국 - 滿 洲 國 幣 의 조선 유입 실태를 중심으로 - 조명근 고려대학교 BK21+ 한국사학 미래인재 양성사업단 연구교수 Ⅰ. 머리말 근대 국민국가는 대내적으로는 특정하게 구획된 영토에 대한 배타적 지배와 대외적 자주성을 본질로 하는데, 그

More information

<B3EDB9AEC1FD5F3235C1FD2E687770>

<B3EDB9AEC1FD5F3235C1FD2E687770> 오용록의 작품세계 윤 혜 진 1) * 이 논문은 생전( 生 前 )에 학자로 주로 활동하였던 오용록(1955~2012)이 작곡한 작품들을 살펴보고 그의 작품세계를 파악하고자 하는 것이다. 한국음악이론이 원 래 작곡과 이론을 포함하였던 초기 작곡이론전공의 형태를 염두에 둔다면 그의 연 구에서 기존연구의 방법론을 넘어서 창의적인 분석 개념과 체계를 적용하려는

More information

Microsoft Word - 크릴전쟁_당신이 모르는 남극 바닷속 쟁탈전_FINAL.docx

Microsoft Word - 크릴전쟁_당신이 모르는 남극 바닷속 쟁탈전_FINAL.docx 2 3 20. 1 2 4 4. 7.7. 8. 9. 9. 30 3 4 5 6 7 8 9 10 11 그림 2. 남극해 지도, 보호구역 지정이 합의되었거나 제안된 구역 12 13 14 15 16 17 18 20 21 22 23 24 25 26 27 28 29 30 31 1 O'Leary, B. C., Winther-Janson, M., Bainbridge, J.

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

02À±¼ø¿Á

02À±¼ø¿Á Geomorphic Development of Marine Terraces at Jeongdongjin-Daejin area on the East Coast, Central Part of Korean Peninsula Soon-Ock Yoon*, Sang-Ill Hwang** and Hak-Kyun Ban*** Abstract : In this paper we

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

07_À±¿ø±æ3ÀüºÎ¼öÁ¤

07_À±¿ø±æ3ÀüºÎ¼öÁ¤ 232 233 1) 2) Agenda 3) 4) 234 Invention Capital Agenda 5) 6) 235 7) 8) 9) 236 10) 11) 237 12) 13) 14) 15) knowledge 16) 17) 238 239 18) 240 19) 241 20) 242 243 244 21) 245 22) 246 23) 247 24) 248 25)

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

한수지 50(5), , 2017 Original Article Korean J Fish Aquat Sci 50(5), ,2017 한국산육각복과 (Aracanidae) 어류 1 미기록종, 황줄육각복 (Kentrocapros flavofasciatu

한수지 50(5), , 2017 Original Article Korean J Fish Aquat Sci 50(5), ,2017 한국산육각복과 (Aracanidae) 어류 1 미기록종, 황줄육각복 (Kentrocapros flavofasciatu 한수지 50(5), 589-593, 2017 Original Article Korean J Fish Aquat Sci 50(5),589-593,2017 한국산육각복과 (Aracanidae) 어류 1 미기록종, 황줄육각복 (Kentrocapros flavofasciatus) (Kamohara, 1938) 김경무 김진구 * 부경대학교자원생물학과 New Record

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI:   : Researc Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

45-51 ¹Ú¼ø¸¸

45-51 ¹Ú¼ø¸¸ A Study on the Automation of Classification of Volume Reconstruction for CT Images S.M. Park 1, I.S. Hong 2, D.S. Kim 1, D.Y. Kim 1 1 Dept. of Biomedical Engineering, Yonsei University, 2 Dept. of Radiology,

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI:   * A Study on Teache Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational

More information

-02-......

-02-...... Characteristics of Blue Costumes in Contemporary Fashion Department of Fashion Design, Sunchon National University Associate Professor : Sun Young Kim This paper purports to find the characteristics

More information

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201 4 21.,,,.,,. 1, 2, 3, 4.,,,,,,.,,,,., ( ). 60-66,,,,,.. (Corresponding Author): / / 303 Tel: 063-220-2495/ E-mail: ikkim@jj.ac.kr .,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 28(2),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 28(2), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Feb.; 28(2), 129138. http://dx.doi.org/10.5515/kjkiees.2017.28.2.129 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) PT- Doppler

More information

Output file

Output file 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI:   Awareness, Supports Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction

More information

63 19 2 1989 90 2013 3 4 2 54 15 2002 p 19; 1 2008 pp 32 37; 2013 p 23 3 2001 ㆍ 2002 2009 新 興 寺 大 光 殿 2010 2013 2013 4 大 光 殿 壁 畵 考 察 193 1992 ; : 2006

63 19 2 1989 90 2013 3 4 2 54 15 2002 p 19; 1 2008 pp 32 37; 2013 p 23 3 2001 ㆍ 2002 2009 新 興 寺 大 光 殿 2010 2013 2013 4 大 光 殿 壁 畵 考 察 193 1992 ; : 2006 DOI http:ddoi org 10 14380 AHF 2015 41 113 新 興 寺 佛 殿 莊 嚴 壁 畵 考 I. 머리말 朴 銀 卿 동아대학교 인문과학대학 고고미술사학과 교수 규슈대학 문학박사 불교회화사 15 3 3 1 1 * 2013 NRF 2013S1A5A2A03045496 ** : 26 2014; 高 麗 佛 畵 : 本 地 畵 幅 奉 安 問 題 美 術

More information

230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등

230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이 229 한국교육학연구 제20권 제3호 The Korea Educational Review 2014. 10. Vol.20. No.3. pp.229-251. 1) 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이* 강기수 조규판(동아대학교) [요 약] 본 연구의 목적은 청소년의 개인변인인

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

<372E20B9DAC0B1C8F12DB0E62E687770>

<372E20B9DAC0B1C8F12DB0E62E687770> 7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net

More information