DBPIA-NURIMEDIA

Size: px

Start display at page:

Download "DBPIA-NURIMEDIA"

지나 전
5 years ago
Views:

1 Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: /apiculture Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR Jung-Min Kim, Su-Jin Lim, Truong A Tai, Ki-Jeong Hong 1 and Byoung-Su Yoon* Department of Life Science, Kyonggi University, Suwon 16227, Korea 1 Department of Plant Medicine, College of Life Science and Natural Resources, Sunchon National University, Sunchon 57922, Korea (Received 2 June 217; Revised 28 June 217; Accepted 28 June 217) Abstract For the Rapid detection of small hive beetle (SHB; Aethina tumida) and for the mass-survey against SHB invasion, SHB-specific ultra-rapid PCR system was developed. Three different pairs of Aethina tumida-specific primers were deduced from cytochrome oxidase subunit I (COI) gene in mitochondrial DNA of SHB. Using optimized SHB-specific ultra-rapid PCR, molecules of COI gene belonged to SHB could be detected specifically and quantitatively within 18 minutes 4 seconds. For the purpose of the application in apiary field, a DNA extraction method from bee debris was separatedly developed. When 1 5 SHB-specific COI molecules (1/1 body of SHB larvae) are existed in 1g of bee debris, it could be verified inner 1 minutes as qualitative and quantitative manner. SHB-specific ultra-rapid PCR we proposed would be expected to apply widely, either in apiary field or laboratory, for the rapid detections and the control against SHBinvasion. Key words: Ultra-Rapid PCR, Small Hive Beetle, SHB, Parasites, Honeybee (Small Hive beetle; SHB; Aethina tumida Murray), 1998 (Thomas, 1998),.,,, 214,. Kodamaea ohmeri *Corresponding author. bsyoon@kyonggi.ac.kr 119

2 12,, (Benda et al., 28). Deformed Wing Virus (DWV) (Eyer et al., 28) ,, (, 217).,. 1998, 1, Trap., 216 9,,.,,,.,,,, (Murihas, 24; Spiewok and Neumann, 26)., PCR. PCR PCR (cycle) (step;,, ), 4 PCR 1, (Lee et al., 27; Han et al., 28; Yoo et al., 212)., COI(cytochrome oxidase subunit I) (Evans et al., 2; Evans et al., 22), 1, (mitochondrial DNA; mtdna), DNA(eDNA; environmental DNA), COI, 1 (Microenvironment)., Ward (27) PCR (Real-Time PCR),,.,., PCR, DNA SHB PCR. (SHB) SHB

3 121 Table 1. Recombinat DNA clone for Cytochrome Oxidase subunit I in Small Hive Beetle Target insect Recombinant DNA Identical sequence in GenBank Target gene Small hive beetle Cytochrome oxidase ptop-shb COI* KP Aethina tumida subunit I (COI) Honey bee ptop-rps 828** AADG636 Ribosomal Protein S18 Apis mellifera *DNA sequences of this clone is identical to reported sequences of KP (236-98), except only 563 position. **DNA sequences of this clone is 1% identical to reported sequences of AADG636 ( )., SHB 9% EtOH 2 C. COI SHB genomic DNA (gdna),, DNeasy Blood & Tissue kit (Qiagen Co, Germany). gdna COI mtdna, Biophotometer (Eppendorf Co, Germany) DNA 7 C. (Apis mellifera) gdna, SHB. SHB. SHB (Bee debris), 2g SHB 1 DNA. SHB DNeasy Blood & Tissue kit (Qiagen Co, Germany) gdna, 7 C. 2g SHB 1 gdna (mtdna ) 3.59µg, 37ng/µl. 3ng gdna COI. SHB SHB COI (molecular cloning) (Table 1). GenBank Database SHB COI, 683bp. primer SHB-COI F/R, (Table 2). SHB-COI F/R SHB gdna PCR 683 PCR ( ), T-vector cloning, ptop- SHB COI. ptop-shb COI ( ), GenBank KP134137( SHB, 214) ( ; ). PCR primer 2, NCBI primer Blast, SHB, (Apis mellifera) (Apis cerena), (213) (Galleria mellonella L.), (Achroia grisella F.), (Vespa mandarinia Smith), (Anax parthenope Julius), (Tenodera aridifolia Stoll), (Lasius niger).

4 122 Table 2. Specific primer pairs for SHB-specific COI gene and Honeybee-specific genes Target genes Name of primers Sequence (5 3 ) Reference Aethina tumida, Cytochrome oxidase subunit I (COI) Honey bee (β-actin) Honey bee (RPS) SHB-COI F TGCGACCCTCAGGCATAACC SHB-COI R TGGGAATCATTGAACAAATCCGGC This study SHB27F TCTAAATACTACTTTCTTCGACCCATC SHB315R TCCTGGTAGAATTAAAATATAAACTTCTGG Ward et al., 26 SHB-DP-F1 TGATTCTTCGGACACCCAGA SHB-DP-R1 AGGCTCGAGTATCAACGTCT This study SHB-DP-F2 CTACTTTCTTCGACCCATC SHB-DP-R2 AATGCTCATAGAGTTACTGG This study β-actin151-f ATGCCAACACTGTCCTTTCTGG Yang and Cox-. β-actin151-r GACCCACCAATCCATACGGA Foster 25 RPS F1 GTCATGGGCACGAATATTGA RPS R1 TTACTTCTTTTTCGATACACCCAC This study RPS F1 CATGGCTAATCCTAGACAATACAAG RPS R CCCAATAATGACGCAAACCT This study, Ward (27) SHB primer ptop-shb COI PCR,, PCR,, β-actin 4s Ribosomal Protein S18 (RPS) primer. primer (Table 2). SHB COI, primer annealing. 55 C 1 C PCR, DNA ptop-shb COI (.3 femtomole= 3 attomole), primer.5µm, 1µl 2xGreenstar qpcr Master Mix (Bioneer, Korea), 2µl PCR. PCR Exicycler TM Quantit ative Thermal Block (Bioneer, Korea), 95 C 5min, 95 C 3, annealing 55 C 1 C 3, 72 C Ct (Threshold Cycles) primer annealing, Genechecker (Genesystem, Korea) PCR. PCR ptop-shb COI , primer 1µM, 5µl 2 RapiMix (Genesystem, Korea), 1µl PCR. PCR 95 C, 3, 95 C 5, annealing 52~6 C 5, 72 C Ct annealing. SHB COI primer, primer 1µM, 5µM, 2µM, 1µM, 5nM PCR. 1µl, ptop- SHB COI , 2 RapiMix primer PCR.

5 C, 3, 95 C 5, annealing 52~6 C 5, 72 C SHB ptop-shb COI PCR, 2 RapiMix, primer Forward Reverse primer 1µl PCR. PCR 95 C, 3 5,,, annealing, 95 C( ), primer annealing (52~6 C), 72 C( ), 3, 2, 1 PCR. gdna SHB primer 1ng gdna, PCR SHB primer 3 PCR, rdna β-actin1 primer. 1, ptop- SHB COI ng gdna, primer, 2 RapiMix PCR. 95 C, 3, 95 C 2, annealing 52~6 C 2, 72 C gdna SHB ptop- SHB COI, PCR,. gdna 1ng, ptop-shb COI PCR 1ng gdna DNA, 2 Rapi master Mix, Primer, 95 C, 3, 95 C 2, annealing 52~6 C 2, 72 C PCR. SHB- PCR SHB. 2g 1 SHB gdna 3.59µg, 3ng SHB PCR. total DNA SHB PCR, SHB,. Ward (27) SHB PCR SHB-, Ct (29.69 cycles)., gdna RPS β-actin gene PCR. SHB primer 3 annealing PCR (Real-Time PCR) Exicycler TM Quantitative Thermal Block (Bioneer CO.,

6 124 Table 3. Ct and Tm values on each annealing temperature of three primer pairs Annealing temperature ( C) SHB-DP F1/R1 SHB-DP F2/R2 SHB 27F/315R Ct Final fluorescence Ct Final fluorescence Ct Final fluorescence Tm values ( C) Table 4. Ct and Tm values for each concentration of three primer pairs Final concentration SHB-DP F1/R1 SHB-DP F2/R2 SHB 27F/315R Ct Final fluorescence Ct Final fluorescence Ct Final fluorescence 1µM µM µM µM nM Tm values ( C) Korea) PCR. SHB primer SHB-DP F1/R1, SHB-DP F2/R2, 45~65 C, SHB-DP F1/R1 primer 56 C 4 C, SHB-DP F2/R2 primer 54 C 4 C. SHB 27F/315R primer 57 C 3 C annealing, 3 primer 52~6 C annealing PCR annealing ( ). PCR Genechecker (Genesystem, Korea), 52~6 C annealing Ct (Table 3). SHB-DP F1/R1 primer 56 C Ct, 54 C SHB-DP F2/R2 primer 54 C Ct, C. SHB 27F/315R primer Ct 54, 56 C Ct 56 C. PCR 3 SHB primer annealing, primer, 54 C. PCR primer 5nM(5pmole/µl), 1µM(1pmole/µl), 2µM(2pmole/µl), 5µM(5pmole/µl) 1µM(1pmole/µl) PCR (Table 4). primer 3, Ct Melting graph. SHB-DP F1, R1 primer 1µM Ct

7 125 Molecules of DNA (Log 1 ) y=-.2615x R 2 =.9989 y=-.2621x R 2 =.9981 y=-.353x R 2 = Ct (Threshold cycle) DP1 DP2 SHB Fig. 1. Detection limit and Tm using three primer pairs for SHB COI specific Ultra-rapid quantitative PCR. Ultra-rapid PCR with each primer pairs was performed using optimal condition. ptop-shb COI was used as template in PCR that was diluted from to molecules /PCR, respectively molecules template were amplified successfully by UR-PCR using SHB DP F2/R2 pairs and SHB 27F/315R pairs, except SHB DP F1/R1 pairs. primer, SHB-DP F2, R2 primer 2µM Ct. SHB 27F, 315R primer 2µM Ct 1µM, 5µM Primer Ct, 1µM,.5µM Primer Ct 2cycle 2µM. 3 primer annealing primer DNA PCR,, 2, 2, 2, 3 Ct Tm. PCR (Fig. 1). SHB-DP F1/R1 primer PCR, , Ct, Ct (Regression equation) Y=-.2615X (Regression coefficient; R 2 ).9989., Tm (Temperature of mid-point) 76. C, Tm 73.3 C, 73. C, Tm. SHB-DP F2/R2 primer PCR, , Y= X , R 2 = Tm 77.7 C, Tm 74.3 C, 72.3 C, Tm. SHB 27F/315R primer PCR, , Y=-.353X , R 2 = Tm 77.6 C, Tm 69. C, Tm (Table 5). SHB 3 primer DNA primer 1ng gdna. RPS gdna, RPA- DNA PCR Tm, gdna. SHB 3 primer gdna PCR,

8 126 Table 5. Ct and Tm using three primer pairs for SHB-specific Ultra-rapid qpcr Molecules of recombinant DNA SHB-DP F1/R1 SHB-DP F2/R2 SHB 27F/315R Ct Tm Ct Tm Ct Tm Negative Average Tm value (Positive) Average Tm value (Negative) Total reaction time 18min 4sec / 5 cycles RPS F1, 149R SHB DP F2, R Fig. 2. Melting temperature analysis of ultra-rapid PCR with genomic DNA from honeybee and/or SHB-specific DNA using various primer pairs. RPS genes were successfully amplified by both ultra-rapid PCRs with gdna from honeybee and/or RPA-specific DNA. All ultra-rapid PCRs using SHB-DP F1/R1, -DP F2/R2, -27F/315R pairs with gdna from honeybee and/or SHB-specific DNA produced correct or incorrect product, respectively SHB DP F1, R SHB 27F,315R , Tm PCR 3 C. gdna SHB DNA, SHB PCR (Fig. 2). gdna SHB DNA primer SHB. SHB ptop-shb COI , 1ng gdna PCR (Fig. 3; 1ng 3kb DNA.5 femtomole, molecules ). Primer 3 SHB PCR 1ng gdna , Tm SHB DP F1/R1 primer C.21 C, SHB DP F2/R2 primer C.25 C, SHB 27F/315R primer C.17 C

9 127 Molecules of DNA (Log 1 ) y=-.265x R 2 =.9945 y=-.2447x R 2 =.9847 y=-.2757x R 2 = Ct (Threshold cycle) DP1 DP2 SHB Fig. 3. Detection limit of ultra-rapid PCR using three SHB-specific primer pairs with SHB-specific DNA and honeybee gdna. Ultra-rapid PCR reactions were performed at optimal conditions for each primer pairs with 1ng honeybee gdna. All ultra-rapid PCRs using SHB DP1, SHB DP2, SHB 27F/315R primer pairs could be detected with molecules of SHB-specific DNA under 1 ng honeybee gdna.. SHB DNA, PCR,, primer Tm, C.59 C (SHB DP F1/R1 primer ), C 1.38 C(SHB DP F2/R2 primer ), C.57 C(SHB 27F/315R primer ), Tm SHB- Tm., 3 SHB primer SHB- PCR SHB SHB, (Table 6). SHB, gdna primer 2 (RPA, β-actin) SHB primer 3 (SHB-DP F1/R1, -DP F2/R2, -27F/315R) PCR (Fig. 4). β-actin RPS gdna, Tm, DNA ( ), gdna. SHB primer 3 PCR SHB COI, SHB Tm. Table 6. Ct and Tm values for each number of molecular copies with 3 primer pairs in 1ng Honeybee gdna Molecules of recombinant DNA SHB-DP F1/R1 SHB-DP F2/R2 SHB 27F/315R Ct Tm Ct Tm Ct Tm Negative Average Tm value (Positive) Average Tm value (Negative) Total reaction time 18min 4sec

10 128 β-actin 151 F, R RPS F1, 149R SHB DP F1, R1 SHB DP F2, R2 SHB 27F, 315R Fig. 4. Melting temperature analysis of Ultra-rapid PCRs using 5 different primer pairs with total DNA from bee debris and SHB larvae. 3.59µg total DNA was isolated from 2 gram bee debris and 1 SHB larvae. Ultra-rapid PCRs using each primer pairs with 3ng total DNA were performed. All results demonstrated successful amplification according to primers-specificity., 2g SHB, total DNA 3.59µg, 3ng total DNA 8/1, SHB SHB mtdna, PCR. SHB SHB PCR. SHB total DNA 1/1 total DNA SHB PCR (Fig. 5). total DNA 3ng, 3ng,.3ng,.3ng, SHB-DP F1/R1, -DP F2/R2 primer PCR SHB. total DNA 3ng, 3ng,.3ng,.3ng 8/1,, 8/1,, 8/1,, 8/1,, SHB DNA, 1 1 SHB,,. SHB DNA,.8 SHB SHB ,.8 SHB SHB ,.8 SHB SHB ,.8 SHB SHB

11 129 Amount of DNA (Log 1 ) y=-.268x R 2 = Ct (Threshold cycle) Standard 8/1 8/1 8/1 8/1 Fig. 5. CTs of Ultra-rapid PCRs using serially diluted total DNA from bee debris and SHB larvae on regression equation using C T s and SHB-specific DNAs. Total DNA was isolated from 2 gram of bee debris and 1 SHB larvae. Serially diluted total DNA were measured as.8 ( molecules),.8 ( molecules),.8 ( molecules),.8 ( molecules) SHB larvae, respectively. Standard is indicated PCRs using serially diluted SHB-specific DNA. 8/1, 8/1, 8/1, 8/1 are indicated.8,.8,.8,.8 SHB larvae, respectively SHB, SHB. (SHB). SHB, SHB SHB, SHB. SHB, SHB, SHB (,,, SHB ), SHB (Murihas, 24; Spiewok and Neumann, 26).,., (micro-environment).. SHB, DNA (edna; environmental DNA) SHB DNA, PCR total DNA SHB DNA. Ward (27) PCR PCR, PCR, 5 C 2 95 C 1, 95 C 15, 6 C 1 4. PCR 2 / PCR, (5 C, 95 C, 6 C) (Ramping time), 62, PCR 79 Sequence Detection System (Applied Biosystems, USA) PCR 2., PCR, 95 C 3, 95 C 2, 56 C 2, 72 C Genechecker (Genesystem, Korea). PCR 18 4, 4 (15 ) Ct (Table 6).

12 13, SHB PCR 4 cycles Ct (Table 6). PCR (polymerase) (95 C), 4 cycles PCR. PCR 1 (2 5 ), Ward (27) 4 1 (6 ), PCR, 2 (Table 6). 9 SHB, SHB.,, SHB. PCR,. 1, SHB (Small hive beetle; SHB; Aethina tumida) SHB. 3 Aethina tumida- cytochrome oxidase subunit I (COI). PCR COI 18 4., DNA, 1g 1 5 COI (1/1 SHB ), 1.,,,., ( , ), ( ) ( ), ; SHB. ( ) Journal of the Korean Veterinary Medical Association, 49(2): Benda, N. D., D. Boucias, B. Torto and P. Teal. 28. Detection and characterization of Kodamaea ohmeri associated with small hive beetle Aethina tumida infesting honey bee hive. J. Apic. Res. 47(3): Evans, J. D., J. S. Pettis and H. Shimanuki. 2. Mitochondrial DNA Relationships in an Emergent Pest of Honey Bees: Aethina tumid (Coleopters: Nitidulidae) From the United States and Africa. Entomological Society of America Vol. 93(3). Evans, J. D., J. S. Pettis, W. M. Hood and H. Shimanuki. 22. Tracking an invasive honey bee pest: mitochondrial DNA variation in North American small hive beetles.

13 131 Apidologie 34: Eyer, M., Y. P. Chen, M. O. Schafer, J. Petter and P. Neumann. 28. Small hive beetle, Aethina tumida, as a potential biological vector of honeybee viruses. Apidologie 4: Han, S. H., D. B. Lee, D. W. Lee, E. H. Kim and B. S. Yoon. 28. Ultra-rapid real-time PCR for the detection of Paenibacillus larvae, the causative agent of American Foulbrood (AFB). J. Invertebr. Pathol. 99: Lee, D. W., E. H. Kim, M. S. Yoo, S. H. Han and B. S. Yoon. 27. Ultra-rapid real-time PCR for the detection of human immunodeficiency virus (HIV). Kor. J. Microbiol. 43: Lee, S., K. J. Hong, Y. S. Cho, Y. S. Choi, M. S. Yoo and S. H. Lee Review of the subgenus Aethina Erichson s. str. (Coleoptera: Nitidulidae: Nitidulinae) in Korea, reporting recent invasion of small hive beetle, Aethina tumida. Journal of Asia-Pacific Entomology, 2(2): Murihas, A. M. 24. Aethina tumida arrives in Portugal. Will it be eradicated? Eurbee Newsletter 2: 7-9. Spiewok, S., P. Neumann. 26. Cryptic low-level reproduction of small hive beetles in honeybee colonies. J. Apic. Res. 45: Thomas, M. C Florida pest alert - the small hive beetle. American bee Journal 138(8): 565. Ward, L., M. Brown, P. Neumann, S. Wilkins, J. Pettis and N. Boonham. 27. A DNA method for screening hive debris for the presence of small hive beetle (Aethina tumida). Apidologie 38: 1-9. Yoo, M. S., K. C. N. Tai, P. V. Nguyen, S. H. Han, S. W. Kwon and B. S. Yoon Rapid detection of Sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction. J. Virol. Methods. Yang, X. and Cox-Foster, D. L. 25. Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification. PNAS 21:

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,