DBPIA-NURIMEDIA

Size: px

Start display at page:

Download "DBPIA-NURIMEDIA"

민환 시
5 years ago
Views:

Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT

1 Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA) Su Jin Lim, Giang Thi Huong Luong, Sang Hyun Min, Ji Hee Wang and Byoung-Su Yoon* Department of Life Science, College of Natural Science, Kyonggi University, Suwon 16227, Korea (Received 15 April 2016; Revised 25 April 2016; Accepted 26 April 2016) Abstract Black Queen Cell Virus (BQCV) is one of pathogenic virus in honeybee which could be detected using reverse transcription real-time PCR (RT/RT-PCR). In this study, for rapid detection of BQCV, Recombinase Polymerase Amplification (RPA) was applied, and BQCV-specific reverse transcription real-time RPA (RT/RT-RPA) method was newly developed based on BQCV-specific RT/RT PCR. The Real-time RPA (RT-RPA) was performed at 37 C isothermal condition for 40 minutes. During the experiments, specific DNA amplifications were real-timely monitored using fluorescent detector. BQCV-specific DNA amplification could be detected from 3 min 26 sec after RPA reaction with specific DNA templates by RT-RPA, while 41 min 42 sec was required by qrt- PCR with same quantities of initial templates. With generated cdna from BQCV-infected honeybee, specific DNA amplification was recognized at 4 min 18 sec using RT-RPA, however, 66 min 5 sec was needed using Real-time PCR. Moreover, with reverse transcriptase and RPA solution, BQCVspecific DNA amplification could be detected at 8 min 36 sec from total RNA of BQCV-infected honeybee using one-step Reverse Transcription/Real-Time RPA (RT/RT-RPA). Key words: Black queen cell virus, BQCV, Virus detection, Recombinase Polymerase Amplification, RPA, Real-time RPA *Corresponding author. bsyoon@kgu.ac.kr 41

2 42,,,,. Acute Bee Paralysis Virus (ABPV), Chronic Bee Paralysis Virus (CBPV), Sacbrood Virus (SBV), Kashmir Bee Virus (KBV), Deformed Wing Virus (DWV), Black Queen Cell Virus (BQCV), 18 (Tentcheva et al., 2004; Berényi et al., 2006). Black Queen Cell Virus (BQCV), (Chen et al., 2007), family Dicistroviridae,, (Mayo, 2002). BQCV RNA ORF, replicase 5 - ORF capsid protein 3 - ORF (Leat et al., 2000). BQCV (Yoo et al., 2008; Kang et al., 2012). BQCV, Multiplex reverse transcription-pcr (Grabensteiner et al., 2007), One-step real-time PCR (Kukielka et al., 2008) BQCV. PCR PCR (quantitative Real-Time PCR; qrt-pcr) BQCV (Yoo et al., 2008)., qrt-pcr, thermo cycling,,. PCR PCR (Ultra-Rapid PCR; UR- PCR) PCR (Ultra-Fast PCR; UF-PCR), 30 PCR 5 ~8 (Yoo et al., 2011; Giang et al., 2015). Recombinase Polymerase Amplification (RPA), PCR, (Piepenburg et al., 2006),. RPA recombinase, single strand binding protein (SSBP), strand displacing DNA polymerase, specific primer, 37 C, 30. RPA,., RPA, RPA., RPA BQCV,,,. Apis mellifera, mL conical tube, 70 C. BQCV-specific PCR, BQCV. DWV (Deformed Wing Virus)-specific PCR,

3 43 Table 1. Sequences of specific BQCV-VP3 primers Oligo name Sequence (5 3 ) PCR product (bp) Reference BQCV-VP3-F1 BQCV-VP3-R1 CTGGGCGAACATCTACCTTTCC GCAATGGGTAAGAGAGGCTTCG 131 Giang et al., 2015 DWV., MagNA Lyser green Beads (Roche, Switzerland). RNA Allspin TM (GeneAll, Korea). RNA Biophotometer (Eppendorf, Germany), 1µg RNA AccuPower RT Premix (Bioneer, Korea) cdna 70 C. cdna real-time RPA real-time PCR. pgem-bqcv-vp3 BQCV VP3 (Giang et al., 2015). pgem-3zf(+) vector (Promega, USA) BQCV VP3, DH5α. DNA clone DNA-spin TM Plasmid DNA Purification Kit (intron Biotechnology, Korea) pgem-bqcv-vp3, Biophotometer (Eppendorf, Germany) DNA, DNA 20 C. qrt-pcr SYBR green Exicycler TM Quantitative Thermal Block (Bioneer, Korea). 20µl, HiPi Real-Time PCR 2x Master Mix, 1x SYBR green (Elpisbio, Korea), 10 pmole, pgem-bqcv-vp3 DNA cdna. BQCV VP3. GenBank database (Accession No. KR074231), BQCV-VP3-F1 (forward) BQCV-VP3-R1 (reverse) KR bp 269 bp, 131 bp PCR, (Bionics, Korea) (Table 1). RT-RPA Twist Amp Basic kit (TwistDx, UK). RPA reaction mix kit freeze-dried reaction 280mM MgAc, 2.4 pmole (BQCV-VP3-F1/R1), 1x rehydration buffer, 1x SYBR green I, vortex, freeze-dried reaction tube pipetting (Table 2). qrt-pcr 200µl white tube, tube 10 7 molecules 1µl pgem- BQCV-VP3. RPA 280mM MgAc, 37 C, 1 1 cycle, cycle Table 2. Compositon of BQCV-RPA Composition Volume (µl) Distillted water 7.2 BQCV-VP3-F1 (10pmole/µl) 2.4 BQCV-VP3-R1 (10pmole/µl) 2.4 Primer free rehydration buffer x SYBR green 5.0 Total 46.5

44 Table 3. Qauntitative Real time PCR instrument set up for RPA 1 37 C 1min 2 scan 3 Go to step 1 Repeat 40 cycle 4 Melting 60-94 C 1 C/1sec 5 store 8 C (Table 3).

4 44 Table 3. Qauntitative Real time PCR instrument set up for RPA 1 37 C 1min 2 scan 3 Go to step 1 Repeat 40 cycle 4 Melting C 1 C/1sec 5 store 8 C (Table 3). DNA SYBR green I (Elpisbio, Korea) Exicycler TM Quantitative Thermal Block (Bioneer, Korea) RPA. cdna RT-RPA, RNA Reverse transcription RT-RPA one-step. AccuPower RT Premix (Bioneer, Korea), 1µg RNA, 100 pmoles Oligo dt 70 C 5 pre-denaturation,, RPA-kit freeze-dried reaction (dried pellet) pippet. RPA kit 280mM MgAc, 37 C RPA. one-step reverse transcription RPA cdna DNA, 40 DNA. Real-Time PCR Real-Time RPA DNA pgem-bqcv-vp3, DNA. (Table 1) BQCV-VP3-F1 BQCV-VP3-R1. Fig. 1. Fluorescence curves of specific DNA amplification using real-time RPA. Real-time RPAs were performed with 1 ng of pgem-bqcv-vp3 as template (Positive) or without template (Negative). Fluorescence based on DNA amplification was rapidly increased and passed through the base line on 3.44 cycles, on the time of 3 min 26 sec after beginning of Positive reaction. However, fluorescence from Negative was not reached the base line until 40 cycles (40 min). Real-Time PCR, 94 C 30 Pre-denaturation, denaturaion 94 C, 15, Annealing 62 C, 15 Extension 72 C, 15 Total 35 cycle. Real-Time RPA 37 C 40 cycle (Table 3). Real time RPA Real time PCR BQCV-VP3 melting, agarose gel 131 bp DNA (Fig. 1, Fig. 2, Fig. 3). Real-time RPA 3 26 (3.44 cycles) DNA, 40., template RPA 40 DNA. Final Fluorescent value 40 (40 cycles) 5301, Negative 167 (Fig. 1)., Real-time PCR Ct ( ) DNA, 26 cycles( ) 5514, 35 cycles( 90 ) 4988

45 Fig. 2. Fluorescence curves of specific DNA amplification using real-time PCR. Real-time PCRs were performed with 1 ng of pgem-bqcv-vp3 as template (Positive) or without template (Negative).

However, fluorescence from Negative was passed through the base line on 30.88 cycles, on the time of 79 min 24 sec.., template Real-time PCR 30.88 Ct ( 79 24 ), DNA, 35 cycles( 90 ) 1521 (Fig. 2).

5 45 Fig. 2. Fluorescence curves of specific DNA amplification using real-time PCR. Real-time PCRs were performed with 1 ng of pgem-bqcv-vp3 as template (Positive) or without template (Negative). Fluorescence based on DNA amplification was passed through the base line on cycles, on the time of 41 min 42 sec after beginning of Positive reaction. However, fluorescence from Negative was passed through the base line on cycles, on the time of 79 min 24 sec.., template Real-time PCR Ct ( ), DNA, 35 cycles( 90 ) 1521 (Fig. 2). Real time RPA Real time PCR,, DNA 1.5% Agarose gel DNA. Real-time PCR 131bp (Positive), template PCR negative DNA (Fig. 3A). RPA DNA 131 bp DNA., RPA Negative DNA, (Fig. 3B). unspecific single strand DNA 131 bp DNA band, negative DNA. RPA DNA Fig. 3. Agarose gel electrophoresis of amplified DNAs using RPA or PCR. Panel A. PCR products from real-time PCRs in Fig. 2. Panel B. RPA products before purification from real-time RPAs in Fig. 1. Panel C. RPA products after purification. In each panel, Lane 1 is the amplified product with 1 ng of pgem-bqcv-vp3 as template, and lane 2 is Negative reaction without template. The expected size of BQCV-DNA was 131 bp long., unspecific single strand DNA RPA single strand binding protein (SSBP) gel mobility shift (Fig. 3C). Real-time RPA Real-time PCR,, Real-time RPA Real-time PCR DNA.. Real-time PCR Real-time RPA, cdna. BQCV RNA, 1µg RNA Reverse transcriptase, cdna. RPA PCR cdna (Table 1)., cdna Real-time RPA 4.31 cycles( 4 18 ) DNA,

46 Fig. 4. Amplification of BQCV-VP3 sequences from cdna using real-time RPA. cdna from BQCV-infected honeybee was used for the template of Real-time RPA.

Ct values and final fluorescence values were estimated for each RPA, 3.73 and 4402 (Positive), 4.31 and 3280 (cdna), 8.67 and 1145 (Negative), respectively.

cdna from BQCV-infected honeybee was used for the template of Real-time PCR. As negative control, Real-time RPA without template were also performed. 24.

6 46 Fig. 4. Amplification of BQCV-VP3 sequences from cdna using real-time RPA. cdna from BQCV-infected honeybee was used for the template of Real-time RPA. As positive or negative control, with 10 6 copies of pgem-bqcv-vp3 or without template, Real-time RPAs were performed, respectively. Ct values and final fluorescence values were estimated for each RPA, 3.73 and 4402 (Positive), 4.31 and 3280 (cdna), 8.67 and 1145 (Negative), respectively. In right, BQCV-specific 131 bp long products were only observed on lane 1 (Positive) and lane 2 (cdna). Fig. 5. Amplification of BQCV-VP3 sequences from cdna using real-time PCR. cdna from BQCV-infected honeybee was used for the template of Real-time PCR. As negative control, Real-time RPA without template were also performed cycles (Ct values) and 5173 final fluorescence values were estimated, only in RPA with cdna. pgem-bqcv-vp3 RPA 3.73 cycles( 3 43 ) DNA. negative RPA 8.67 cycles( 8 40 ) DNA. 3 RPA, 3 Ct value. 4402, 3280, 1145, Ct 3.73, 4.31, 8.67 cycles. Threshold cycles (Ct ), (Regression coefficience; R 2 ) DNA, 1.5% agarose gel, cdna pgem- BQCV-VP3 Real-time RPA 131bp (Fig. 4)., BQCV cdna, RT-RPA, Real-time PCR, BQCV-specific sequence, Ct cycles( 66 5 ) DNA. 40 cycles, 5173 Fig. 6. Melting temperature analysis and gel electrophoresis after real-time PCR. (Left) The temperature of mid-point (Tm) was measured at 80.5 C in only PCR with cdna, as same as expected. (Right) In agarose gel electrophoresis, expected 131bp long DNA was only observed in PCR with cdna (lane 1).., negative DNA (Fig. 5). Real-time PCR cdna PCR (Melting temperature analysis) Tm(temperature of mid-point). Tm 80.5 C, DNA pgem-bqcv-vp3 BQCV-VP3-F1/R1 PCR Tm, cdna (Fig. 6). BQCV cdna, Real-time RPA Real-time PCR

7 47 Fig. 7. Specificity of Real-time RPAs with cdnas generated from BQCV- or DWV-infected honeybee. With BQCV-cDNA using BQCV-specific real-time RPA, BQCV-specific DNA amplification was recognized at 5 min 53 sec (5.89 cycles). With DWV-cDNA using BQCV-specific real-time RPA, unspecific DNA amplification was recognized at 10 min 15 sec (10.25 cycles). Without templates using BQCV-specific realtime RPA, un-specific DNA amplification was also recognized at 16 min 51 sec (16.85 cycles). (Right), BQCVspecfic DNA, 131 bp long, was well observed by agarose electrophoresis (lane 2). Un-specifc DNAs were also recognized by RPAs with DWV-cDNA (lane 1), or without templates (lane 3), respectively. BQCV 131 bp VP3 gene., Real-time RPA 4 18, Real-time PCR, ,, RPA. Real-time RPA Real-time PCR, (specificity). BQCV DWV(Deformed Wing Virus) RNA, cdna. BQCV cdna DWV cdna, BQCV VP3 BQCV-VP3-F1/R1 (Table 1). Real-time RPA BQCV cdna 5 53 (5.89 cycles) DNA, DWV cdna (10.25 cycles) DNA., RPA (16.85 cycles) DNA (Fig. 7). RT-RPA 40, , 936, 519, Ct value 5.89, 10.25, cycle (initial template). Real-time RPA, 1.5% agarose gel, BQCV cdna 131 bp BQCV DNA, DWV cdna 131 bp BQCV DNA. DNA,., DNA realtime RPA DNA DNA ( ; Ct,, RPA )., BQCV-cDNA BQCV Realtime PCR, PCR Ct DNA. PCR Ct 30, , DWV-cDNA BQCV Real-time PCR Ct DNA, 1324., BQCV Real-time PCR, Ct DNA, 2009 (Fig. 8). 3 PCR (specificity)

48 Fig. 9. One-step Reverse Transcription Real-Time RPA (RT/RT RPA) assay. For the detection of BQCV, BQCV-specific one-step RT/RT RPA were performed with total RNA from BQCV-infected honeybee.

131 bp long BQCV-specific DNA was observed only in RT/RT-RPA product with BQCV-total RNA (lane 1; right). Fig. 8. Real-time PCR with cdnas generated from BQCV-, or DWV-infected honeybee.

8 48 Fig. 9. One-step Reverse Transcription Real-Time RPA (RT/RT RPA) assay. For the detection of BQCV, BQCV-specific one-step RT/RT RPA were performed with total RNA from BQCV-infected honeybee. With total RNA or without template, 8.61 cycles (8 min 36 sec) or cycles (23 min 33 sec) were recorded using BQCV-specific RT/RT-RPAs. 131 bp long BQCV-specific DNA was observed only in RT/RT-RPA product with BQCV-total RNA (lane 1; right). Fig. 8. Real-time PCR with cdnas generated from BQCV-, or DWV-infected honeybee. The fluorescent graphs of Realtime PCRs with BQCV-cDNA or DWV-cDNA, or without template. The total time of 35 cycles PCR is 90 minutes. Times to Ct values were measured 43 min 51 sec (17.85 cycles), 69 min 12 sec (27.21 cycles), and 74 min 22 sec (29.37 cycles), respectively. (Bottom) Tm (Temperature of mid-point) 80.5 C in PCR product with BQCV-cDNA is identical as Tm of BQCV-specific PCR product., DNA (Melting temperature analysis)., BQCV-cDNA BQCV Real-time PCR BQCV PCR (Tm=80.5), DWVcDNA BQCV Real-time PCR DNA (Fig. 8). BQCV, DWV cdna, BQCV Realtime RPA BQCV Real-time PCR BQCV-cDNA BQCV DNA, DWV-cDNA BQCV DNA., DNA Real-time RPA 5 53, Real-time PCR 43 51,. Real-time RPA DNA DNA. RNA Real-time RPA BQCV RPA (BQCV-specific One-step Reverse transcription Real-Time RPA; RT/RT-RPA). BQCV RNA, 1µg RNA, 200 unit M-MLV reverse transcriptase RPA solution one-step 37 C 40. BQCV-specific one-step RT/RT RPA 8 36 (8.61 cycles) BQCV DNA, negative (23.56 cycles) DNA. 1181, 353

9 49 RPA 37 C, BQCVspecific RPA., Heat block, PCR. 40 ( ), RPA 1.5% agarose gel. 37 C, 131bp BQCV DNA, 37 C heat block PCR BQCV DNA band. RPA RPA (Fig. 10). Fig. 10. BQCV-specific RPAs using different incubation devices. Lane 1 to 4 were RPA products using 37 C heat block, 37 C water bath, at room temperature (25 C) and Real- Time PCR machine, respectively. Without template, same RPA reactions were performed in 37 C water bath (lane 5). 131bp long BQCV-specific DNA were observed only in lane 1, 2, 4, respectively. (Fig. 9). One-step RT/RT RPA RNA BQCV RPA. RPA 37 C., RNA,, RNA, BQCV RPA. (BQCV), (RT/RT PCR). BQCV Recombinase polymerase amplification (RPA) BQCV RPA BQCV DNA. Real-time RPA 37 C 40 DNA. Real-time RPA BQCV DNA, RPA 3 26, Real-time PCR BQCV cdna Real-time RPA 4 18, Real-time PCR 66 5., BQCV RNA RPA RPA (onestep RT/RT RPA) 8 36 BQCV DNA.

10 50 ( ), ( , ), ( ) Allen, M., & Ball, B The incidence and world distribution of honey bee viruses. Bee world, 77(3): Berényi, O., Bakönyi, T., Derakhshifar, I., Köglberger, H., Nowotny, N Occurrence of six honeybee viruses in diseased Austrian apiaries. Appl. Environ. Microbiol. 72(4): Chen, Y.P. and Siede, R Honey bee viruses. Adv. Virus Res. 70: Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A.,... & Martinson, V A metagenomic survey of microbes in honey bee colony collapse disorder. Science, 318(5848): Ellis, J.D., & Munn, P.A The worldwide health status of honey bees. Bee world, 86(4): Euler, M., Wang, Y., Nentwich, O., Piepenburg, O., Hufert, F.T., & Weidmann, M Recombinase polymerase amplification assay for rapid detection of Rift Valley fever virus. Journal of Clinical Virology, 54(4): Euler, M., Wang, Y., Otto, P., Tomaso, H., Escudero, R., Anda, P.,... & Weidmann, M Recombinase polymerase amplification assay for rapid detection of Francisella tularensis. Journal of clinical microbiology, 50(7): Grabensteiner, E., Bakonyi, T., Ritter, W., Pechhacker, H., & Nowotny, N Development of a multiplex RT-PCR for the simultaneous detection of three viruses of the honeybee (Apis mellifera L.): Acute bee paralysis virus, Black queen cell virus and Sacbrood virus. Journal of invertebrate pathology, 94(3): Jung, C.E Economic value of honeybee pollination on major fruit and vegetable crops in Korea. Korean Journal of Apiculture. 23(2): Kang, S.W., Yoo, M.S., Noh, J.H., Park, H.S., Jeon, D.M., Park, S.C.,... & Lee, M.K Occurrence and Prevalence of Honeybee Disease in Apis mellifera and Apis cerana in Korea. Journal of Apiculture, 27(3): Kukielka, D., Esperón, F., Higes, M., & Sánchez-Vizcaíno, J.M A sensitive one-step real-time RT-PCR method for detection of deformed wing virus and black queen cell virus in honeybee Apis mellifera. Journal of virological methods, 147(2): Leat, N., Ball, B., Govan, V., & Davison, S Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. Journal of General Virology, 81(8): Luong, G.T.H., Lee, J.S., Yong, S.J., & Yoon, B.S Development of Ultra-Rapid Reverse Transcription Real- Time PCR for Detection against Black Queen Cell Virus in Honeybee. Journal of Apiculture, 30(3): Mayo, M.A Virus taxonomy-houston Archives of virology, 147(5): Piepenburg, O., Williams, C.H., Stemple, D.L., & Armes, N.A DNA detection using recombination proteins. PLoS Biol, 4(7): e204. Tentcheva, D., Gauthier, L., Zappulla, N., Dainat, B., Cousserans, F., Colin, M. E., & Bergoin, M Prevalence and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in France. Applied and environmental microbiology, 70(12): Yoo, M.S., Kim, I.W., Kang, M.H., Han, S.H., & Yoon, B.S Development of Real-Time PCR Method for Black Queen Cell Virus. Korean Journal of Apiculture. 23(1): Yoo, M.S., Han, S.H., & Yoon, B.S Development of Ultra-Rapid Real-Time PCR Method for Detection of Black Queen Cell Virus. Journal of Apiculture, 26(3): Zhang, S., Ravelonandro, M., Russell, P., McOwen, N., Briard, P., Bohannon, S., & Vrient, A Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP using reverse transcription-recombinase polymerase amplification. Journal of virological methods, 207:

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun