43(1)-4(p.23-30).fm
|
|
- 현영 반
- 6 years ago
- Views:
Transcription
1 The Korean Journal of Microbiology, Vol. 43, No. 1, March 2007, p Copyright 2007, The Microbiological Society of Korea Quick Real-time PCR w Avian Influenza Virus Subtype H5N1 ½ yá Áw zá«y 1 Á *» w w w w w w y k v (AIV) H5N1 x Real-time PCR w ƒ w w.» AIV H5N1 x hemagglutinin ƒ 387 bp kw š, x w œw w. Microchip» w Real-time PCR w, PCR 1 µl, PCR ƒ, w, w, ƒ 1, 1, 3 w x w. w x PCR 12 28, d 2.4 hemaggutinin» w w p 189 bp PCR sw», š PCR x Quick Real-time PCR w. ƒ q AIV H5N1 x, PCR» w. Key words ý avian influenza, detection, hemagglutinin, H5N1, Real-time PCR v (influenza) y» y, v (influenza virus) w. v jš x w, w 2-3 ü m 10-20%ƒ w (1, 3). v Orithomyxoviridae w, negative single strand RNA 8 r y. polymerase yyw PB1, PB2, PA, š glycoprotein hemagglutinin, neuraminidase y w NP M, NS1 NS2 (12). wr v (Avian Influenza Virus, AIV) nucleoprotein matrix (M1) protein w w Ax, w x t glycoprotein hemagglutinin (HA) neuraminidase (NA) w w (19, 20). x ¾ 16 HA 9 NAƒ v Ax x, HA NA w w w w (9, 14). HA NA x w, 3 HA x(h1-h3) 2 NA x(n1 N2) (5, 10). AIV H5N1, H7N7, H7N3, H9N2 w *To whom correspondence should be addressed. Tel: , Fax: bsyoon@kyonggi.ac.kr x v A (influenza A virus)ƒ j š (17). AIV H5N1 w ù, % ƒ¾ e š H5N1 x š, 1997, AIV w y, 18 6 w š, q» w ƒ (8, 13). z 2001 l x ¾ AI ü sw, pû, k, ƒ, š AIV H5N1 ƒ, y, š, p w e (2003 pû 93 42, 2006 k ) w Ÿ»¾ ƒw vw û (4, 7, 15, 18). ƒw AI H5N1» ƒ w, š q» w» w j š, ƒ» y w w, w y, x, œw w, x p š. x AIV w» w, x x (Hemagglutination Inhibition, HI), xÿ (Immunofluorescence Assay, IFA), z x (Enzyme Linked Immunosorbant Assay, ELISA), wz (Polymerase Chain 23
2 24 Eul hwan Kim et al. Kor. J. Microbiol Reaction, PCR) š. HI ƒ š yw v wš, IFA ELISA w p (16). w PCR ƒ š p š w š multiplex PCR, Realtime PCR, NASBA, PCR-ELISA PCR» w w AIV ƒ w (6). PCR w w x, x w (Immunochromatography) w y ùù,, r x», q» w œw, w w wš, w w., AIV w, Realtime PCR w 10 w x wš w, w» Real-time PCR w Quick Real-time PCR w. AI w,, 13 ü y x e», AIV H5N1 x w x x wš w, šw. w oligo primer AIV H5N1 t x DNA Primer w GenBank database (National Center of Biotechnology Information, NCBI) x avian influenza A virus subtype H5N1 82 hemagglutinin (HA)» šw.» w ww (CLUSTAL X program, Version 1.81, ftp://ftp-igbmc.u-strasbg.fr/ pub/clustalx),» ƒ» ww œ» w.» avian influenza A virus subtype H5N1 (GenBank accession number, AY651322) hemagglutinin ƒ w», ƒ ƒ» 387 bp kw Fig. 1. Synthesis of partial hemagglutinin gene from avian influenza A virus subtype H5N1 by templateless gene synthesis. 387 bp-long hemagglutinin (HA) DNA was synthesized through 7-step templateless oligonucleotide extension. This electrophoretic image shows the result of each extension step. Lane 1 to lane 7 were 77 bp, 119 bp, 182 bp, 244 bp, 309 bp, 330 bp, and 387 bp of HA DNA, respectively. Lane M and M' represents two different DNA size markers. w AIV t» w, œw w (Fig. 1, 2). t»» (AY651322) 820 nt 1206 nt¾» w, Primer3 (Version 0.2, primer design software) w w oligonuclotide primer w. oligonucleotide ( ) w (Bionics, Korea), œ oligonucleotide œw primer. primer» Table 1, t x DNA e Fig. 2 ùkü. Hemagglutinin w 7 HA w oligonucleotide w (» ), PCR (PTC-200, MJ Research, USA), 387 bp hemagglutinin t w w. 20 µl ƒ 10 pmole oligonucleotide ƒ 1.25 mm dntp, 1.25 unit Ex Taq DNA polymerase (TaKaRa, Japan), 2 µl 10 reaction buffer (25 mm MgCl 2 ) w 94 o C 3 predenaturation z, denaturation 94 o C 12, annealing 61 o C 12, Table 1. Oligonucleotide sequence of AIV detection primers Name Sequence(5'->3') mer Amplicon HA HF TCCACAACATACACCCTCTC bp HR ACCCATACCAACCATCTACC 20 Fig. 2. DNA sequences of an artificial synthesis of hemagglutinin genes (387 bp, partial sequence). The bold letters represent two position of AIV detection primers pairs named HA-HF and HA-HR, 5' 3' respectively, in this study.
3 Vol. 43, No. 1 Avian Influenza 25 extension 72 o C cycles ww, 72 C o 5 final extension w. ƒ w DNA 2.5 % agarose gel» z ethidium bromide w UV transilluminator ƒ j» y wš MEGA-spin TM agarose gel elution kit (Intron, Korea) w DNA w PCRw» DNA w. 7 w w dsdna pbx vector (2) cloning w z,» (Bionics, Korea) y w š, phc16 w. Real-time PCR Real-time PCR»» Exicycler TM Quantitative Thermal Block (Bioneer, Korea) w. s d w SYBR Green w, t phc16 HA primer w PCR ww (Table 1). AIV Real-time PCR w annealing y w» w primer ƒ 10 pmole phc16 1 ng template w 5µl 4 GreenStar PCR premix (Bioneer, Korea), 2.0 mm MgCl 2 20 µl w (temperature gradient) Real-time PCR ww. PCR 94 C 3 o pre-denaturation z, denaturation 94 o C 20, annealing o C 15, extension cycles ww š, z 94 C l o 50 C¾ û ƒ o 1C xÿ o d w PCR ƒƒ (melting temperature analysis) w. w MgCl 2 y w» w MgCl 2 2 mm l 6 mm¾ 1 mm MgCl 2 ƒ g MgCl 2 PCR PCR cycle ww w. d AIV Real-time PCR w» w w w hemagglutinin pbx vector ww AIV plasmid (phc16) 10 ng l 10 ag¾ 1/10 w z template w y PCR Real-time PCR ww. Real-time PCR w t avian influenza A virus H5N1 w hemagglutinin (387 bp) w phc16, DNA spectrophotometer d w š plasmid copy (11) (copies/mol) concentration (g/µl) MW (g/mol) = amount (copies/µl) Quick real-time PCR Quick Real-time PCR 10 Real-time PCR óù Real-time PCR w,» Real-time PCR w» w w.»» GenSpector TMC-1000 (Samsung, Korea), ge» w, 1 µl PCR w v w w. Quick Real-time PCR w w» w PCR, phc16 DNA 1 pg-10 ag w ww. reaction volume 1µl w, ƒ 1µl template 2µl 10 mm MgCl 2, 7 µl yw z 1µl wš, detection primer ƒ 1µl ƒw z, 1µl 1µl 2 premix (GeNet Bio, Korea) yww 1µl w PCR-chip ww. GenSpector TMC-1000 (Samsung, Korea) w ³ Real-time PCR 94 o C 1 pre-denaturation e z denaturation 94 o C 10, annealing 58 o C 7, extention 72 o C 7 35 cycles w. z 96 C l o 66 C¾ û ƒ o 1 C xÿ o d w, PCR ƒƒ w (melting temperature analysis) w. w AIV w PCR ƒ ww, 94 o C, 1 pre-denaturation e z, PCR 3, denaturation 1, annealing 1, extension 3 ƒ w. Quick PCR w 30 cycles ww w. w (melting temperature analysis) 85 C l o 75 C¾ o û xÿ d w. š Hemagglutinin w Avian influenza A virus (AIV) subtype H5N1 hemmaglutinin (HA) 1.69 kb j» ƒ š neuraminidase (NA) w w ƒ x w. HA w» w w e e (hydrophilicity analysis) mw w»ƒ w, 82 AIV H5N1 x HA homologyƒ š w 387 bp HA w, œ w w Real-time PCR w w. HA w w» w 7 HA w oligonucleotide w š, 7 HA 387 bp w w 2.5% agarose gel ƒ size ƒ ew y w (Fig. 1). w z HA pbx vector cloningw» mw HA ew y w, phc16 w. phc16 DNA spectrophotometer w, d w, 100 ag phc DNA 24 AIV HA sww (Fig. 2). Real-time PCR w HA phc16 1 ng template w Real-time
4 26 Eul hwan Kim et al. Kor. J. Microbiol PCR detection w. 53 o C-64 o C annealing gradient Real-time PCR 2-6 mm MgCl 2 w Real-time PCR ww 189 bp p PCR product sw. AIV HA PCR-detection annealing temperature 58æ š, MgCl 2 3 mm d ( ). Real-time PCR d AIV HA detection d w, AIV HA sww phc16 DNA» w 10 pg phc16 10 ag¾ 1/10 w z,»» w Real-time PCR w Real-time PCR ww. d»» w PCR amplification fluorescence curve standard curve mw ùkü š,»» 10 pg l 1 fg ( 240 HA sw)» Ct yw ƒ y (Fig. 3A). wr, 100 ag (27 HA )»» Real-time PCR AIV p» ƒ wù, yw w ùkû, 10 ag (2.7 HA )»» w Real-time PCR, z e x, ƒ w w q w (Fig. 3, 4B). x ƒ w HA copy 24 w. w,»» 10 pg l 100 ag ¾ PCR 83.1 C o Tm (Mid-point of melting temperature) d, w -(df/dt) curve ƒ w xk ƒ ùkù w PCR q (Fig. 3B). phc16 DNA 10 pg l 10 ag¾, 1/10 w 7»» Real-time PCR d Ct z (Regression equation) Y(»» ; log ag) = X (C T ; cycles) , z (Regression coefficiency) R 2 = (Fig. 4A). x q w»» 100 ag (24 HA ) 10 ag sww w, wš w z R 2 = ù kû ( ). ƒ PCR» ww j» PCR y w, 10 ag w»» 10 pg l 100 ag¾ PCR 189 bp j» (Fig. 4). Quick real-time PCR PCR 1µl PCR ƒ w ƒ thermocycler, GenSpector TMC-1000 (Samsung, Korea) w, Quick Real-time PCR w.,»» e, w w» w AIV HA sww phc16» w,»» 1 pg, 100 fg, 10 fg, 1 fg, 100 ag, 10 ag ( 2.4 phc16 ) ƒ» w PCR ww. x plasmid DNA 100 fg l 100 ag¾ C T (Threshold cycles) ù, 1 pg, 10 ag PCR»» C T w (Fig. 5). GenSpector TMC-1000 (Samsung, Korea) w Exicycler TM Quantitative Thermal Block (Bioneer, Korea) w, ƒ ƒ j ƒ ù ùkû, plasmid phc fg l 100 ag ( 24 HA )¾ C T ƒ q ù, z 10 pg l 1 fg ( 240 HA sw)»» C T ƒ y. z w yw ù, 1 pg yw. GenSpector TMC µl PCR w w»,»» DNA w PCR w» d. wr, ƒ w»» e, w w Fig. 3. Real-time PCR with serially diluted templates of AIV HA gene using Exicycler TM Quantitative Thermal Cycler. Real-time PCR was performed with the standard condition in this studies. Initial quantities of templates in each experiments were 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100 ag (24 copies of AIV gene) and 10 ag, respectively. Panel (A) Fluorescence curve. The Ct values were shown initial quantity-dependent manner in the range of 10 pg to 1 fg. Distilled water was used in blank instead of DNA template. Panel (B) Melting point analysis of same PCR products. All products were identical, depending on same temperature of midpoint around 83.1 o C, except 10 ag and blank.
5 Avian Influenza의 신속검출법 개발 Vol. 43, No Standard curve and electrophoresis of Real-time PCR with serially diluted templates of AIV HA gene using ExicyclerTM. Panel (A) Regression analysis of PCR products. The linear relationship between the quantities of initial template and Ct values was fairly accepted. Regression equation was calculated as Y = X Regression coefficient was R2 = Panel (B) Electrophoresis of same PCR products. Lane M is 100 bp DNA size marker; Lane 1-7 were loaded 7 PCR products amplified from initial template plasmid, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100 ag (24 copies of AIV gene) and 10 ag, respectively. Lane N; negative control (distilled water). PCR products of 189 bp were shown in all lanes, except 10 ag and blank. Fig. 4. The sensitivity of Quick Real-time PCR by 10-fold serially diluted template DNA. Quick Real-time PCRs were performed with 1 pg ( copies of AIV gene) - 10 ag plasmid template using GenSpector under 10 seconds - 7s - 7s of 3 steps (denaturation-annealing-extension) in 35 cycles. Panel (A) Fluorescence curve of template-diluted Quick Real-time PCRs. 1 pg, 1 fg, 10 ag etc. represent each weight of template DNA, 1 picogram, 1 femtogram, 10 attogram etc., respectively. PCR with 10 ag template (2.4 copies of AIV gene) was detectable. Panel (B) Melting point analysis in the range of temperature 96oC to 65oC. All 6 PCR products were identical, depends on same melting temperature. The temperatures of mid point (Tm) were calculated in range of oC. Fig. 5. 여는 전자가 10 ag의 plasmid phc16 (AIV HA 유전자 2.4개)을 성공적으로 증폭시켰기에, 후자가 보인 검출한계의 수준(100 ag 의 phc 16, 24개 AIV HA 유전자)을 분명히 뛰어 넘는 것으로 나타났다. 10 ag에서 100 ag까지 10 ag단위의 보다 정밀한 검출 한계에 대한 실험은 수행하지 아니하였지만, 10 ag과 100 ag을 단위를 사용한 양자의 반복 실험을 통하여 전자의 우수한 검출 한계를 분명하게 볼 수 있었으며, 이는 GenSpector TMC-1000이 1 µl수준의 총 PCR 반응액을 사용하기에, 20 µl의 총 PCR 반응 액을 사용하는 Exicycler Quantitative Thermal Block보다 초기 TM 기질 농도의 면에서 유리하고, 이 수준의 저농도 기질 DNA의 PCR 증폭은 전자가 보다 유리할 수 있을 것이라 해석하였다(자 료 미제시). 또한 PCR 산물들의 용융온도분석에서 이 PCR 산물들이 모두 동일한 Tm (Temperature of midpoint; 약 82 C)을 가지는 것으 로 나타났고, 이는 모두 성공적 증폭에 의한 동일한 DNA들임을 시사하는 것이라 하겠다. 이 PCR산물들은 1 µl수준의 극소량이 기에 건조에 의한 정량적 회수가 불가능하나, 각기 회수하여 전 기영동을 실시하였으며, 모두 AIV HA유전자의 예상된 크기인 o
6 28 Eul hwan Kim et al. Kor. J. Microbiol Fig. 6. Electrophoresis of Quick Real-time PCR products. Quick Real-time PCRs were performed with 1 pg - 10 ag plasmid template. 10 fg plasmid was calculated as copies of AIV gene. Lane M was DNA size marker in 100, 200, 300 bp, respectively. PCR with 10 ag template (2.4 copies of AIV gene) was detectable in the level of fluorescence (Fig. 5A), but hard to detect in this electrophoresis. 189 bp DNA y w (Fig. 5, 6). wr, AIV HA ƒ w» w PCR ƒ Quick Real-time PCR ww. Rapid kit (Lateral flow Immunochromatography ) 10, AIV HA Quick Real-time PCR q w d wš w.» ƒ 10 fg AIV HA phc16 DNA w, PCR w ƒ cycle ƒ, 94 o C 1 pre-denaturation e z denaturation 94 o C 1, annealing 58 o C 1, extension 72 o C 3 30 cylces ww š ww. ¾ AIV A 12 28, C T cycles, mw PCR product Tm 82.8 o C ü PCR ü y (Fig. 7). C T» š w, 189 bp DNA sw ü x polymerization ƒ j w e q, w denaturation annealing w e d. AIV hemagglutinin p 10 š q ƒ w Real-time PCR w š w. w PCR ƒ cycles denaturation, annealing, polymerization ƒ 1 w PCR ƒ w ƒƒ x. x mw, PCR ƒ cycle ƒ 1, 1, 3, Template (10 fg; 2400 AIV HA phc16 DNA) w ý, GenSpector TMC-1000 (Samsung, Korea) w polymerization 3 ¾», w w ù, z»» w ƒ w» PCR Fig. 7. Detection-time limit of Quick Real-time PCR. Quick Real-time PCR was performed with 10 fg plasmid template DNA ( copies of AIV gene) using GenSpector. To save time of PCR-experiment, times of each 3 steps (denaturation-annealing-extension) were reduced serially, and PCR were performed with 30 cycles and in the range of temperature in melting point analysis 85 o C to 75 o C (except PCR 1; 35 cycles, 96 o C to 65 o C; see Fig. 5). Panel A. Fluorescence curve of time-reduced Quick Real-time PCR. The numbers of 1-6 represent each time-reduced PCR independently performed with 3 different times of denaturation-annealing-extension step in PCR cycles. 1 was 10 seconds - 7 s - 7 s (denaturationanealing-extension); 2, 2 s - 6 s - 4 s; 3, 2 s - 8 s - 3 s; 4, 2 s - 3 s - 4 s, 5, 2 s - 2 s - 4 s; 6, 1 s - 1 s - 3 s, respectively. Panel B. Melting point analysis of same PCR products. All 6 PCR products were identical, depends on same melting temperature. The temperatures of mid-point (Tm) were calculated in the range of to o C. Only PCR 1 was performed
7 Vol. 43, No. 1 Avian Influenza 29 l s ƒ w (Melting point analysis) óù ƒ¾, x w w z (reverse transcriptase) ww w, 12 PCR q ¾, AI w PCR, l q ¾ z sww 20 óý ƒ w. Quick Real-time PCR x, x ƒ PCR x Immunochromatography w Rapid kitƒ ƒ š x w ƒ ƒ. x GenSpector TMC-1000 (Samsung, Korea) Real-time PCR»» wì j»ƒ, w x ƒ w ƒ. w PCR k w chip 1µl w w x x Rapid kit w w. AI w Quick PCR ƒ w, x e w q w, w š AI w œw w 1 w» w. w AIV» Real-time PCR w ƒw, AIV ³ w PCR w, w ³ w PCR w x ƒ» ƒ» w. w w,» š, ( ) l j z w». š x 1. û,,,, x ; y x 3q w z, ³, w III.» w q Alexander, D.J The epidemiology and control of avian influenza and Newcastle disease. J. Comp. Pathol. 112, CDC Outbreaks of avian influenza A (H5N1) in Asia and interim recommendations for evaluation and reporting of suspected cases? United States. MMWR 13, Claas, E.C.J., A.D. Osterhaus, R. Van Beck, J.C. de Jong, G.F. Rimmelzwaan, D.A. Senne, S. Krauss, K.F. Shortridge, and R.G. Webster Human influenza A (H5N1) virus related to highly pathogenic avian influenza virus. Lancet 351, Ellis, J.S., and M.C. Zambon Molecular diagnosis of influenza. Rev. Med. Virol. 12, Fauci, A.S. Emerging and re-emerging infectious diseases: Influenza as a prototype of the host-pathogen balancing act. Cell 124, Fleming, D.M., P. Chakraverty, C. Sadler, and P. Litton Combined clinical and virological surveillance of influenza in winters of 1992 and BMJ 29, Fouchier, R.A., V. Munster, A. Wallensten, T.M. Bestebroer S. Herfst, D. Smith, G.F. Rimmelzwaan, B. Olsen, and A.D. Osterhaus Characterization of a Novel Influenza A Virus Hemagglutinin Subtype (H16) Obtained from Black-Headed Gulls. J. Virol. 79, Gamblin, S.J., L.F. Haire, R.J. Russell, D.J. Stevens, B. Xiao, Y. Ha, N. Vasisht, D.A. Steinhauer, R.S. Daniels, A. Elliot, D.C. Wiley, and J.J. Skehel The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303, Guan, M.K., L.C. Hsueh, Y.K. Liang, T.J. Wen, L.C.J. Chulu, H.M. Liao, T.J. Chang, and H.J. Liu Development of a quantitative Light Cycler real-time RT-PCR for detection of avian reovirus. J. Virol. Methods 133, Horimoto, T. and Y. Kawaoka Pandemic threat posed by avian influenza A viruses. Clin. Microbiol. Rev. 14, Lau, L.T., J. Banks, R. Aherne, I.H. Brown, N. Dillon, R.A. Collins, K.Y. Chan, Y. W. Fung, J. Xing, and A.C.H. Yu Nucleic acid sequence-based amplification methods to detect avian influenza virus. Biochem. Biophys. Res. Commun. 313, Nicholson, K.G., J.M. Wood, and M. Zambon Influenza. Lancet 362, Payungporn, S., P. Phakdeewirot, S. Chutinimitkul, A. Theamboonlers, J. Keawcharoen, K. Oraveerakul, A. Amonsin, and Y. Poovorawan Single step multiplex reverse transcription polymerase chain reaction for Influenza A virus subtype H5N1 detection. J. Vir. Immun. 17, Poddar, S.K Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription. polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. J. Virol. Methods 99: Trampuz, A., R.M. Prabhu, T.F. Smith, and L.M. Baddour Avian influenza: a new pandemic threat? Mayo Clin. Proc. 79, Tran, T.H., T.L. Nguyen, T.D. Nguyen, T.S. Luong, P.M. Pham, V.C. Nguyen, T.S. Pham, C.D. Vo, T.Q. Le, T.T. Ngo, B.K. Dao, P.P. Le, T.T. Nguyen, T.L Hoang, V.T. Cao, T.G. Le, D.T. Nguyen, H.N. Le, K.T. Nguyen, H.S. Le, et al Avian influenza A (H5N1) in 10 patients in Vietnam. N. Engl. J. Med. 350, Yuen, K.Y., P.K.S. Chan, M. Peiris, D.N. Tsang, T.L. Que, K.F. Shortridge, P.T. Cheung, W.K. To, E.T. Ho, R. Sung, and A.F. Cheng Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 351, Xie, Z., Y.S. Pang, J. Liu, X. Deng, X. Tang, J. Sun, and M.I. Khan A multiplex RT-PCR for detection of type A influenza virus and differentiation of avian H5, H7, and H9 hemagglutinin subtypes. Mol. Cell Probes. 20, (Received December 5, 2006/Accepted February 13, 2007)
8 30 Eul hwan Kim et al. Kor. J. Microbiol ABSTRACT : Rapid Detection Method of Avian Influenza Subtype H5N1 using Quick Real-Time PCR Eul hwan Kim, Dong woo Lee, Sang hoon Han, Soon hwan Kwon 1, and Byoung Su Yoon* (Department of Life Science, College of Natural Science, Kyonggi University, Suwon , Korea, 1 Chronic Inflammatory Disease Research Center, School of Medicine, Ajou University, Suwon , Korea) The most rapid Real-time PCR based detection method for Avian influenza A virus (AIV) subtype H5N1 was developed. The target DNA sequence in this study was deduced from H5N1 subtype-specific 387 bp partial gene of hemagglutinin, and was synthesized by using PCR-based gene synthesis on the ground of safety. Real- Time PCR was performed by GenSpector TM using microchip-based, total 1 µl of reaction mixture with extremely short time in each steps in PCR. The detection including PCR-amplication and analysis of melting temperature was totally completed within 13 min. The H5N1-specific 189 bp PCR product was correctly amplified until 2.4 molecules of hemagglutinin gene as minimum of templates. This kind of PCR was designated as Quick Real-Time PCR in this study and it could be applied to detect not only AIV H5N1, but also other pathogens using PCR-based detection.
16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
More information304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationuntitled
ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective
More information10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
More information< DC1A4C3A5B5BFC7E22E666D>
¼ (Jeong, Jung Chae)*, ý (Kim, Yoon Soo), (Shin, Woo Young), Þ Ñ (Park, Jong Man) ò ý ƒ Ð (Korea Evaluation Institute of Industrial Technology) (Shin, Jae-Heyg) Š æ (Ministry of Knowledge Economy) 1. :
More information50(1)-09.fm
2006, Vol. 50, No. 1 Printed in the Republic of Korea 언빨래가마르는현상에대한중등학교화학전공교사들의인식조사 ½x Á» Á½ # Á x* w w yw y š w w # w w (2005. 5. 11 ) A Research of Secondary School Chemistry Major Teachers Perceptions
More information10(3)-02.fm
w y wz 10«3y 203~211 (2010.12.) Journal of Korean Society of Urban Environment w ù p yá k«áyw *Á xá½k w y œw Á* y w (2010 9 15, 2010 12 2 k) Characterization of Nonpoint Source Pollutant Loads from the
More information12(3) 10.fm
KIGAS Vol. 12, No. 3, September, 2008 (Journal of the Korean Institute of Gas) ü LP ƒ š Database w š Á Á½z w ywœw (2008 6 10, 2008 8 12 (1 ), 2008 9 5 (2 ), 2008 9 5 k) Constructing a Database Structure
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information14.fm
Journal of the Korean Ceramic Society Vol. 44, No. 2, pp. 93~97, 2007. Preparation of High Purity Si Powder by SHS Chang Yun Shin, Hyun Hong Min, Ki Seok Yun, and Chang Whan Won Engineering Research Center
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)
More information15.101~109(174-하천방재).fm
w wz 8«4y 2008 8 pp. 101 ~ 109 w» m -,, - A Study on Warnning Criteria Investigation of Automated Rainfall Warning System -Focused on Realationship of Water Level, Discharge and Precipitation - Á Á Á Ahn,
More information<30332DB9E8B0E6BCAE2E666D>
kœw» y w k p y w k» z wš ye z w mdkqvqrg üœ» y» Ÿ w kœwgeqgpikpggtkpiy glj GEQVGEJPQNQI[ œw w k w yz š y j œ w m w y ˆ mw y» kœ w k û ³ y ƒ ƒ» ƒ w œw w w y ƒƒ» k z w» %NGCP 9CVGT #EV wšw y ù» œ w w w t
More information69-1(p.1-27).fm
99 A 380 B 787 : wœ z w * w w wœ» A380 B787 wœ» w. wœ» ww r. w wœ» p j y w r» w. I. II. z III. A380 B787 IV. A380 V. wœ» : x VI. z VII. I. A380 B787»ƒ z wœ w, w w p j w w ƒ r. t wœ w ƒ w w wœ» š œm wš,
More information11(5)-12(09-10)p fm
w wz J. Kor. Soc. Cloth. Ind. 11«5y, 2009 Vol. 11, No. 5, pp.799-807(2009) w w * k ƒm w pg p w, ƒm w q w A Qualitative Research on Pursuing Image and Appearance Management Behavior of Brides Eun-Joo Bae
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
More information50(5)-07.fm
Printed in the Republic of Korea w 3w yû x w w w Á x* w w w yw (2006. 3. 14 ) A research of the Difference in Teaching Styles and Understanding of 9 th Grade Students About Lead-iodide Precipitation Reaction
More information10(1)-08.fm
w y wz 10«( 1y) 47~52, 2007 J. of the Korean Society for Environmental Analysis œ w t y ½ xá Á x Á½ Á x* Ÿ œ, * w œw Optimization of Coagulation In The Conventional Water Treatment Plant Jun-Hyun Kim,
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information04-46(1)-06(조현태).fm
w œwz, 46«1y 2009 Textile Science and Engineering Vol. 46, No. 1, 2009 ù 2'6 wx xk Á «w œ w» Áq œw k 1PG $CVJ1PG 5VGR &[GKPI H 0[NP2'6 5RNKV 6[RG /KETHKDGT *[GP 6CG %J CPF%JWN-YP2CTM &GRCTVOGPV H 1TICPKE
More information19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
More information<30312DC0CCC7E2B9FC2E666D>
균류의다양성과역할 이향범 û w œw 머리말 k w š ³ q š yw < Ð >» w ww k w w v š q w Á Á w tyw š 2QKPVKPI CPF *[FG ú ƒ x %QPXGPVKQP QP $KQNQIKECN &KXGTUKV[ %$&» w w ««wš y w» š x ƒ w œ ƒ» ƒ œsw w ³ wš ù š y š ƒ t š ƒ wš»ƒ
More information43(4)-13(063)(p ).fm
The Korean Journal of Microbiology, Vol. 43, No. 4, December 2007, p. 264-272 Copyrightc2007, The Microbiological Society of Korea Human Immunodeficiency Virus (HIV) 검출을위한초고속이단계 PCR 진단법 이동우 김을환 유미선 김일욱
More information8(2)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 8«2y, 2006 Vol. 8, No. 2, pp.177-182(2006) x w e w 1) Á Ÿ 1) Á»û 2) 1) ƒm w q w 2) w w w The Effect of Media on Taking Plastic Surgery Chong-Hee Yun 1), Su-Kwang Sung 1) and
More informationw w l v e p ƒ ü x mw sƒw. ü w v e p p ƒ w ƒ w š (½kz, 2005; ½xy, 2007). ù w l w gv ¾ y w ww.» w v e p p ƒ(½kz, 2008a; ½kz, 2008b) gv w x w x, w mw gv
ª Œª Œ 30ƒ 5A Á 2010 9œ pp. 475 ~ 484 gj p ª v e p p PSC ƒ gv : II. x w Precast Concrete Copings for Precast Segmental PSC Bridge Columns : II. Experiments and Analyses ½kzÁ½ Á zá x Kim, Tae-HoonÁKim,
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationuntitled
[ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings
More information10.063~070(B04_윤성식).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 63-70 Mg-3%Al-1%Zn w ƒœ» y Á x*á **Á Á w œw *w s l I ûer ** t Effect of Thermomechanical Treatment on Microstructure and Mechanical Properties
More information49(6)-06.fm
Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 중학교과학교과서불꽃반응실험에서선스펙트럼관찰의문제점분석및개선연구 ½ Á Á * w w yw (2005. 10. 4 ) An Analysis and Improvement of the Line Spectrum
More informationfm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
More information32(4B)-04(7455).fm
32«4ByÁ 2012 7 pp. 233 ~ 242 œ w w w y œ r Estimation of Domestic Water Supply Benefit Using Demand Function Approach ³ Á Á½¼yÁ Yeo, Kyu DongÁYi, Choong SungÁKim, Gil HoÁLee, Sang Won Abstract In the past,
More information12(4) 10.fm
KIGAS Vol. 12, No. 4, December, 2008 (Journal of the Korean Institute of Gas) l x CNG» v m s w ½ Á y w» œw (2008 9 30, 2008 12 10, 2008 12 10 k) Numerical Analysis for Temperature Distribution and Thermal
More information12(2)-04.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 12, No. 2, pp 106~111(2005) w y y w z œ k üœ» p ½ Á Á Á ³ Á Á½Ÿ w w w, *g», ** w w Effects of Strategies to Improve Indoor Air Quality at Pre-occupancy Stage
More information07.051~058(345).fm
w wz 8«3y 2008 6 pp. 51 ~ 58 m qp yp š w k sƒ Evaluation of Dynamic Modulus based on Aged Asphalt Binder y*á **Á***Á**** Lee, Kwan-HoÁCho, Kyung-RaeÁLee, Byung-SikÁSong, Yong-Seon Abstract Development
More information416.fm
Journal of the Korean Housing Association Vol. 20, No. 4, 2009 œ qp œ y An Analysis of Change on the Apartment Unit Plans and the Interior Spaces Related to Women * Choi, ByungSook ** Park, JungA "CTUSBDU
More information50(6)-03.fm
Journal of the Korean Chemical Society Printed in the Republic of Korea w yw w w ½ Á Áw Á k * w yw w w w w w (2006. 8. 9 ) Relationship between Conceptual Understanding and Mapping Errors Induced in Learning
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More information202.fm
Journal of the Korean Housing Association Vol. 19, No. 2, 2008 w w w w Physical Identities of Bukchon Hanok Area Viewed from Literary Geography * Park, Cheol-Soo "CTUSBDU This study explores the beneficial
More information82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
More information07.045~051(D04_신상욱).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 45-51 f m s p» w Á xá zá Ÿ Á w m œw Image Retrieval Based on Gray Scale Histogram Refinement and Horizontal Edge Features Sang-Uk Shin,
More information11(1)-15.fm
w y wz 11«1y 73~80 (2011.8.) Journal of Korean Society of Urban Environment SWMM 을이용한도시지역비점오염부하저류시설용량산정 Áw«Á *Áy **Á½ yá½ Á x w w Á* û w y œw Á** w y lœw (2011 6 13, 2011 6 27 k) Determine Capacity of
More information26(3D)-17.fm
26ƒ 3D Á 2006 5œ pp. ~ ª y w qp yw k d Predictive Equation of Dynamic Modulus for Hot Mix Asphalt with Granite Aggregates yá½x Á Lee, Kwan-HoÁKim, Hyun-OÁJang, Min-Seok Abstract The presented work provided
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More information93.fm
Journal of the Korean Ceramic Society Vol. 45, No. 10, pp. 625~630, 2008. Effect of Storage Conditions on the Setting Properties of Brushite Bone Cement Containing Granular β-tricalcium Phosphate Sun-Ae
More information84-01.fm
w y wz 8«( 4y) 00~00, 2005 J. of the Korean Society for Environmental Analysis HPLC f y e t p»wá½»x w y w»y Detection Characteristics of a HPLC Method on Carbonyl-DNPH Derivatives in Relation with Column
More information슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information(2)-02(최경자).fm
Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information14(2) 02.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 2, pp 117~125(2007) w y y w z sm Ÿ š w œ l ³Á½ * w, **w w w Impact of Photosensor Sensitivity on the Control Performance of a Daylight Dimming System
More information31(3B)-07(7055).fm
ª Œª Œ 31ƒ 3B Á 2011 5œ pp. 265 ~ 276 ª w w s³ The Correlation Between the Moving Average of Precipitation and Groundwater Level in Korea Á½û» Yang, Jeong-SeokÁKim, Nam-Ki Abstract Precipitation data and
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31() : 133~1 (1) Development of a Detection Method against 11 Major Pathogens of Honey Bee using Amplification of Multiplex PCR and Specific DNA-chip Ji-Hee Wang,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information82.fm
Journal of the Korean Ceramic Society Vol. 44, No. 9, pp. 524~528, 2007. Determination of Critical Chloride Content of Ordinary Portland Cement Concrete by Linear Polarization Technique Hong-Sam Kim, Hai-Moon
More information<312D303128C1B6BAB4BFC1292E666D>
k Ÿy y y + ûz m Ì ˆw k Ÿ ø ky w y y» wk Ÿ v w k w w ƒ Ÿ ew k Ÿy yø k Ÿ ý k z» w ƒ w Ÿ y k y w x mw w w ³Ÿ wšy v mw y w r œw yÿ ý w z»ÿ Ÿ»» Ÿ ¾ Ÿ 6TCXGN 9GGMN[ ýw k Ÿ Ÿ ƒ š wš y w k Ÿ ƒ m ³ w w y y y 'EQVQWTKUO
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information41(6)-09(김창일).fm
269 Ar v Na 0.5 K 0.5 NbO 3 t ½ t,, ½ w,, ½ w»œw Surface Reaction of Na 0.5 K 0.5 NbO 3 Thin Films in Inductively Coupled Ar Plasma w t œwz J. Kor. Inst. Surf. Eng. Vol. 41, No. 6, 2008. < > Dong-Pyo Kim,
More information3.fm
Journal of the Korean Ceramic Society Vol. 44, No. 1, pp. 12~17, 2007. A Study on the Preparation of Bone Ash and Celadon Bone Body Using Pig Bone Jae-Jin Jeong, Sang-Hee Lee, Yong-Seok Lee,* and Byung-Ha
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information26(2)-04(손정국).fm
Ñ s k w 1Á y 2 Á û 1 Á½ z 1 Á½ 1* 1 ³ w yw, 2 w» (*E-mail: jimankim@skku.edu) 1. m ƒ w»» w 4»» y š. w 4»» l, l, l w» w» k. w»» { ƒ j. x š x w ƒwš k (Direct Methanol Fuel Cell: DMFC)[1]ƒ wù ƒ w š. DMFC
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information( )-123.fm
Journal of the Korean Ceramic Society Vol. 48, No. 1, pp. 63~68, 2011. DOI:10.4191/KCERS.2011.48.1.063 Effects of Substituting B 2 O 3 for P 2 O 5 on the Structure and Properties of SnO-P 2 O 5 Glass Systems
More information14(4) 09.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 4, pp 343~350(2007) w y y w z 14 «4 y 2007 yw» l s p»xá ³ *w w w œw, **w w w The Property of Pressure Distribution of Hybrid Underfloor Air Distribution
More informationSelection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
More information16(5)-06(58).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.336 y-y w Sm-Fe w ƒ w zá *Á w»» The Effect of Excess Samarium Oxide on the PreparationG of Sm-Fe Alloy Powder by Reduction-diffusion
More information( )-83.fm
Journal of the Korean Ceramic Society Vol. 8, No. 1, pp. 0~5, 011. DOI:10.191/KCERS.011.8.1.00 Solidification of Heavy Metal Ions Using Magnesia-phosphate Cement HunG Choi, Hyun Ju Kang, Myung Shin Song,
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information51(4)-13.fm
Journal of the Korean Chemical Society 2007, Vol. 51, No. 4 Printed in the Republic of Korea w x - w y *Á š w w w yw (2007. 3. 28 ) Case Study on Verbal Interactions of Teacher-Small Group StudentsG in
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information4.fm
Journal of the Korean Ceramic Society Vol. 46, No. 1, pp. 30~34, 2009. Optimization of Glass Wafer Dicing Process using Sand Blast Won Seo, Young-mo Koo*, Jae-Woong Ko**, and Gusung Kim Department of Electronic
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information8(3)-15(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 8«3y, 2006 Vol. 8, No. 3, pp.357-362(2006) w p k sƒ ½ Á Á w w w A Study on the Mechanical and Hand Properties of the Lining Fabrics Myung-Ok Kim, Mi-Kyung Uh and Myung-Ja
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information27(5A)-07(5806).fm
ª Œª Œ 27ƒ 5A Á 2007 9œ pp. 753 ~ 758 gj pœw gj p { x A New Test Method for Pure Isotropic Flexural Tensile Strength of Concretes Ÿ Á y Á x Zi, GoangseupÁOh, HongseobÁChoi, Jinhyek Abstract Proposed is
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information06.177~184(10-079).fm
Journal of the Korea Concrete Institute Vol. 23, No. 2, pp. 177~184, April, 2011 GGGGG DOI 10.4334/JKCI.2011.23.2.177 x w w MRS w p s y 1) Á z 2) Á x 3) * 1) wû w œw 2) w œw 3) w Nonlinear Analysis for
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information16(5)-03(56).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.316 ƒ w Fe œ w Cu wy SPS (I) I. ƒ wy y Á xá½ Á½ *Á½{ a w œw, a w» gœ Production of Fe Amorphous Powders by Gas-atomization Process
More informationDBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 436-443, 2005,1"$ w Q) t p z Á 1w w œw 2 w œ yw Effects of surface properties and solution ph on the pollutants removal of
More informationfm
w y wz 9«( 1y) 34~40, 2006 J. f the Krean Sciety fr Envirnmental Analysis V/ w y Áy yá váy * w» ( )», *» w y œw Simultaneus Remval f Dixin and Nitrgen Oxide n V/ Catalyst Jun-Yub Lee, Sung-H Hng, Sung-Pill
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information18(3)-10(33).fm
Journal of Korean Powder Metallurgy Institute Vol 18 No 3 011 DOI: 10150/KPMI01118383 e x 5Mg(OH) MgSO 3H O x w MgO NH OH w a báv y aá½xk aá½ aá½ cá½ bá½ a * aw» l bš w œw ck Effect of MgO and NH OH on
More information