43(4)-13(063)(p ).fm

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "43(4)-13(063)(p ).fm"

Transcription

1 The Korean Journal of Microbiology, Vol. 43, No. 4, December 2007, p Copyrightc2007, The Microbiological Society of Korea Human Immunodeficiency Virus (HIV) 검출을위한초고속이단계 PCR 진단법 이동우 김을환 유미선 김일욱 윤병수 * 경기대학교자연과학대학생명과학과 인간면역결핍바이러스 (Human Immunodeficiency Virus; HIV) 진단을위한초고속실시간 PCR 법을개발하였다. 검출대상의 DNA 염기서열은 495 염기 HIV-1 특이 env 유전자 (gi_ ) 및 294 염기 HIV-2 특이 env 유전자 (gi_ ) 를사용하였다. 초고속실시간 PCR 은 microchip 에 6μl 의 PCR 용액을탑재하는 Genspector TM (Samsung, Korea) 을사용하였으며, PCR 의각회전중단지두단계 (denaturation, annealing/extension) 를극단적으로짧은시간을주어수행하게하였다. 융점분석을포함한 30 회전의 PCR 검색시간은총 7 분 30 초이내에완료되었으며, HIV-1 특이 117 염기와 HIV-2 특이 119 염기의 PCR 산물은최소 개의각 env 유전자로부터 30 회전의 2 단계초고속 PCR 에의해성공적으로증폭시킬수있었다. 이러한초고속실시간 PCR 법은 HIV 의빠른검색뿐아니라, 다른병원체의빠른검색에도유용하게적용될수있을것이다. Key words HIV, human immunodeficiency virus, two step PCR, ultra-rapid real-time PCR 후천성면역결핍증후군 (acquired immunodeficiency syndrome; AIDS) 은전세계적으로가장중요한공중보건문제중에하나이다 (5). 후천성면역결핍증후군의병인체인 HIV (human immunodeficiency virus) 는 retrovirus로써, T 림프구, 마크로파지, 뇌세포등에주로감염되며, 잠복기를거친후, 이들세포의용해를일으키고, 결국면역계의손상을야기시킨다 (16). 다른 retrovirus들에의한질병과는달리피감염자가상대적으로긴생존기간을가지는 AIDS에서는피감염자가감염사실을분명히인지하여타인에게전파되는것을스스로차단하게하는것이매우중요하다. 일반적바이러스검색법과같이 HIV의검색에서도바이러스배양, Immuno Fluorescence Assay (IFA), Enzyme Linked Immunosorbant Assay (ELISA) 등이사용되고있으며, 이중바이러스배양법은민감도가높고정확하지만상대적으로배양등에많은시간을필요로하고, IFA와 ELISA는상대적으로빠른시간내에진단이가능하지만, 바이러스배양법에비해민감도와특이성이떨어지는것으로알려져있다 (13). 또한 branched DNA (b-dna), nucleic acid sequence-based amplification (NASBA) 과같은방법들은 HIV 입자의정량적인측정을위해유용하게사용되고있으나 (11), 이러한방법들도판정까지의검사시간에상대적으로많은시간을필요로한다. 이들에비해 PCR 방법은높은민감도를가지고다량의검체를특이적이고도빠르게진단할수있다는장점이있으며, PCR *To whom correspondence should be addressed. Tel: , Fax: bsyoon@kyonggi.ac.kr 기술이발달함에따라여러가지 PCR 방법들이계속개발되어왔다 (4). 그중 real-time PCR은 PCR 산물의양적변화를형광시약을이용하여실시간으로측정할수있기에, 또한전기영동에의한시각적분석시간을줄이고, 보다민감하게 PCR 산물의정량적측정이가능하기에 (15), 근래바이러스를포함한다양한질병진단및특정유전자의검사등에 real-time PCR의적용에의한검사법이매우폭넓게응용되고있다 (2, 14). 진단에있어서검사에소요되는시간은피검사자가검사결과를인지하는데매우중요한요소이다. 일반적으로 AIDS감염자의 25~43% 만이, 그리고비감염자의 33~48% 만이그들의진단결과를통보받았다고보고되고있다 (1). 이러한 AIDS 진단결과에대한피검사자의낮은인지도는검체의채취부터진단결과통보까지이르는시간이현실적으로매우긴것이주된원인이며, 이는주로 1시간미만의즉석진단이기술적이유로불가능하기때문이라사료된다. 피검사자가자신의검사결과, 즉감염여부를인지하지못하는것은감염자자신의의지및공중보건이지향하는바와달리 HIV 감염을보다확산시키는결과를초래한다. 따라서신속한진단그리고검사결과의신속한통보는감염된개개인이그들의 AIDS 감염여부를정확하게인지하게하며즉시진료를받을수있도록하고, 더나아가 HIV 전파를감소시킬수있을것으로기대되고있다 (6, 12). 이와같이즉석진단을지향하는신속한 AIDS 진단법의필요성은큰기대를모으고있으나, 가장민감도가높은것으로기대되고있는 real-time PCR에근간을둔 AIDS 진단법에서도보통 1시간수준의 PCR 시간을필요로하고있기에즉석진단에이르기까지큰기술적장애가되고있었다. 이는기존의 real-time PCR 기기들이 96 well tube에적합한 thermal-block을사용하기 264

2 Vol. 43, No. 4 HIV 검출을위한초고속이단계 PCR 진단법 265 때문이며, thermal-block은 PCR의 3단계온도변화에적정온도로신속하게변화하는것과 block내균일하게적정온도를전달하는것에구조적문제점이있었기때문이다. 따라서상기의 thermal block을채용한 PCR 기기에서일반적으로사용되고있는 30회전의 PCR 시간을획기적으로감소시키는것은현실적으로어려우며, 실제로 PCR 용액내에 3단계의 PCR 설정온도를전달시키기위하여 thermal-block과기존의 PCR tube는일정한시간적한계가있는것으로알려져있다 (3). 보다빠른실시간 PCR을수행하기위하여열전도성이우수한실리콘과유리재질로제작된, micro-chip을기반으로한새로운 real-time PCR 기기가개발되었으며, 이는 1μl의 PCR 용액을사용하고, 실험적으로증명된빠른온도변화시간 (lamping time) 의구현을통해신속한 PCR이가능하게하였다 (3). Lee 등 (9) 은상기의 micro-chip을기반으로한 real-time PCR 기기를사용하고, 합성 HIV DNA를주형으로하여, 30회전의 1 μl-pcr로써 12~14분만에 HIV 특이유전자의존재를진단할수있는방법을개발하였고, 이런방식의빠른 PCR법을초고속 PCR (ultra-rapid PCR) 이라명명하였다. 또한 avian influenza virus (AIV) 를대상으로한 Kim 등 (8) 의연구는합성 AIV 특이염기서열 10 3 개 DNA분자를주형으로하여, 최단 12분 28초만에 AIV 특이염기서열에대한 30회전 PCR 증폭이가능함을보여주었다. 이러한연구들은우선일반 PCR에비하여초고속 PCR이실험에소요되는시간을획기적으로단축시킬수있음을보여주었고, PCR 용액내의분자들또한초고속에상응하는분자의운동, 즉 DNA 및 primer의 denaturation, annealing, Taq polymerase에의한중합반응등을충분히빠르게수행할수있음을추측하게하였다. 또한초고속 PCR을보다초고속으로진보시키기위하여 PCR 시간단축을위한기기의성능개선뿐아니라초고속에걸맞은최적 PCR 조건의확립이보다긴요할수있음을시사하였다. 병원체에대한유전자검사로써초고속 PCR법은우선병원체에대한즉석검사에보다근접할수있도록보다시간단축을추구하여야할것이며, 정확성과민감도를보다개선할수있도록개발되어야할것이다. 따라서, 본연구에서는초고속 PCR의시간을보다단축하기위하여, 합성 HIV-1 및 HIV-2 특이염기서열을주형으로이단계 (two step) PCR법을초고속 PCR에적용하였고이를최적화하였으며, 이를통하여융점분석시간을포함한 30회전의 HIV 특이초고속 PCR검출법에서최소 7분 24초의검출시간을기록하였기에이를보고하는바이다. 재료및방법 HIV1 및 HIV2 특이기질및검색용 primers 본연구에서사용한 PCR 검사용기질은 Lee 등 (9) 의연구에서설계및합성된 HIV1 및 HIV2 특이기질인 pbx-hiv1과 pbx-hiv2를사용하였다. pbx-hiv1과 pbx-hiv2는 HIV가다양한유전적변이를일으키는특성을가지고있기에미국생명공학정보센터 (National Center for Biotechnology Information) 에보고된 45종의 HIV1 env 유전자와 33종의 HIV2 env 유전자의염기서열을비교분석하여가장상동성이높은부분을선정한것이며, 이를인공유전자합성법인 long-nucleotide extension법 (7) 을사용하여제작하고클론화한것이다 (9). 또한상기의 HIV 특이기질에대한검색용 primer들도이등의연구 (9) 에서사용한 primer들을그대로사용하였으며, 이들 primer에대한정보는 Table 1에나타내었다. 초고속삼단계 PCR에서 annealing 온도증가의효과일반적 PCR에서사용되고있는각회전 (cycle) 의 3단계 (step), 즉 denaturation, annealing, polymerization을, 2단계 PCR (two steps PCR), 즉 denaturation, annealing 및 polymerization으로개선하고, 이를초고속 PCR에적용시키기위하여, 본연구에서는 annealing 온도상승에따른초고속삼단계 PCR에서 DNA 증폭효과를측정하였다. PCR의조성은최종반응액 6μl 내에 HIV1에대한 template DNA인 pbx-hiv1 ( copies), 10 pmole의 HIV1-dF primer, 10 pmole의 HIV1-dR primer, 2 greenstar master mix (Genetbio, Korea) 로조성하였으며 HIV2에대하여는 copies의 pbx-hiv2, 10 pmole의 HIV2-dF, 10 pmole의 HIV2- dr, 2 greenstar master mix로조성하였다. Real-time PCR 기기는 Genspector TM TMC-1000 (Samsung, Korea) 을사용하였으며, 차후모든 real-time PCR 반응은동일한기기를사용하였다. 반응조건은 pre-denaturation 94 o C 30초를수행하고, denaturation 94 o C 1초, annealing 56~72 o C 1초, extension 72 o C 3초과정을 30회반복하였으며, 이후융점분석 (melting point analysis) 은 75~85 o C 구간을 lamping rate 0.1 o C/sec의속도로 1 o C 간격으로측정하여 Tm값을결정하였다. 초고속이단계 PCR과초고속삼단계 PCR의비교 HIV1 및 HIV2 특이기질을대상으로 annealing 온도를최적화시킨이단계초고속 PCR과 3단계초고속 PCR을각각수행하여각초고속 PCR의특성을비교하였다. PCR 조성은삼단계 PCR과이단계 PCR 모두최종반응액 6 μl 내에 HIV1의 template DNA인 pbx-hiv1 ( copies), 10 pmole의 HIV1-dF, 10 pmole의 HIV1-dR, 2 greenstar master mix (Genetbio, Korea) 로조성하였으며 HIV2에대하여는 template로 copies의 pbx-hiv2를, primer쌍으로 10 pmole의 HIV2-dF, 10 pmole의 HIV2-dF를사용하고나머지는같은조성으로하였다. 반응조건은 three step PCR의경우 predenaturation 94 o C 30초를수행하고, denaturation 94 o C 1초, annealing 67 o C (HIV-1의경우 ), 68 o C(HIV-2 의경우 ) 1초, extension 72 o C 3초과정을 30회반복하였으며, two step PCR은 pre-denaturation 94 o C 30초를수행하고, denaturation 94 o C 1초, annealing 및 extension으로 67 o C (HIV1), 68 o C (HIV2) 3초과정을 30회반복하였다. Melting point analysis는삼단계 PCR과이단계 PCR 모두 75~85 o C 구간을 lamping rate 0.1 o C/sec의속도로 1 o C 간격으로측정하여 Tm값을결정하였다.

3 266 Dong-Woo Lee et al. Kor. J. Microbiol 이단계초고속 PCR 에서 denaturation 온도감소효과 이단계초고속실시간 PCR에서 denaturation 온도가낮을수록실험소요시간을보다단축할수있을것으로판단되었으며, 이단계초고속 PCR에서 denaturation 온도의감소가 DNA 증폭에미치는효과를측정하였다. PCR의조성은최종반응액 6μl 안에 HIV1의특이 template DNA인 pbx-hiv1 ( copies), 10 pmole의 HIV1-dF, 10 pmole의 HIV1-dR, 2 greenstar master mix (Genetbio, Korea) 로조성하였으며 HIV2에대하여는 copies의 pbx-hiv2, 10 pmole의 HIV2-dF, 10 pmole의 HIV2-dR, 2 greenstar master mix로조성하였다. 반응조건은 pre-denaturation 94 o C 30 초를수행하고, denaturation 88~94 o C 1초, annealing 및 extension으로 67 o C (HIV-1의경우 ), 68 o C (HIV-2 의경우 ) 각기 3초과정을 30회반복하였으며, 이후융점분석은앞의실험과같은조건으로수행하였다. 의최적조건 의최적조건을확립하기위하여 primer 농도별, MgCl 2 농도별, Taq polymerase 농도별 PCR에미치는영향을측정하였다. 우선 PCR 조성에서최적의 primer 농도를구하기위하여해당 primer쌍을각각 10 pmole, 20 pmole, 30 pmole, 40 pmole 로조정하고, primer를제외한나머지조성은 copies의 template DNA와 2 greenstar master mix로하여동일조건에서초고속 PCR을수행하였다. 반응조건은 pre-denaturation 94 o C 30 초를수행하고, denaturation 90 o C 1초, annealing 및 extension으로 67 o C (HIV-1), 68 o C (HIV-2) 3초과정을 30회반복하였으며융점분석은앞의실험과동일하게수행하였다. 최적 MgCl 2 농도를구하기위하여 primer 농도별이단계실시간 PCR을통하여얻어진최적 primer 농도를기준으로, 최종부피 6μl에 copies의 template DNA와각 10 pmole의 forward/reverse primer, 2 greenstar master mix로조성하고, 각각의반응액에최종농도 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm이되도록 MgCl 2 를첨가하였다. 반응온도조건은 primer 최적조건을구한실험과동일한조건으로수행하였다. 또한, 얻어진최적 primer 농도와 MgCl 2 농도에서최적 Taq polymerase 농도를측정하기위해최종부피 6μl에 copies의 template DNA와 10 pmole 농도의 forward/reverse primer, 2 greenstar master mix로조성하고, 각각의반응액에 0.6 U, 1.0 U, 1.4 U, 1.8 U의 Taq polymerase가포함되도록하였으며, 반응조건은앞의실험과동일하게수행하였다. 의민감도측정 본연구에서확립한이단계초고속실시간 PCR의제반최적조건을사용하여 HIV 특이유전자를검출할수있는최소한계를측정하였다. HIV1 및 HIV2 특이유전자를 1 pg ( copies) 에서 1 fg ( copies) 까지단계별희석하여각기 PCR용액의조성에사용하였으며, 해당 primer쌍각 10 pmole, 2 greenstar master mix를첨가하여최종부피 6μl가되도록조성하였다. 이 PCR용액에서 MgCl 2 의최종농도는 2.0 mm이었으며, 6 μl의 PCR용액중 0.6 U Taq polymerase가포함되도록 master mix를새롭게조성하였다. 반응조건은 pre-denaturation 94 o C 30초를수행하고, denaturation 90 o C 1초, annealing-extension으로 67 o C (HIV-1), 68 o C (HIV-2) 3초과정을 30회반복하였으며, 융점분석은 75~85 o C 구간을 lamping rate 0.2 o C/sec의속도로 1 o C 간격으로측정하여 Tm값을결정하였다. 의재현성 본연구에서확립한이단계초고속실시간 PCR의제반최적조건을사용하여 HIV 특이유전자의농도별재현성을측정하였다. PCR의조성은최종반응액 6μl 내에 10 pg ( copies) 에서 10 fg ( copies) 까지의 pbx-hiv1 DNA를포함시켰고, 또한 10 pmole의 HIV1-dF, 10 pmole의 HIV1-dR, 2 greenstar master mix로조성하였으며 HIV-2에대하여는 10 pg ( copies) 에서 1 fg ( copies) 의 pbx-hiv2를각기사용하였으며, 10 pmole의 HIV2-dF, 10 pmole의 HIV2-dR, 2 greenstar master mix로조성하였다. 반응조건은 pre-denaturation 94 o C 30초를수행하고, denaturation 90 o C 1초, annealingextension으로 67 o C (HIV-1), 68 o C (HIV-2) 3초과정을 30회반복하였으며, 융점분석은전의실험과동일하게하였고, 이를 3회반복하여 Ct값및 Tm값의평균을측정하였다. 결과및고찰 초고속삼단계 PCR 에서 annealing 온도증가의효과 초고속실시간 PCR을사용한 HIV 검출법의기존연구 (9) 는삼단계 PCR법을사용하였고, 30회전의 PCR검출에서 12분대의실험시간이소요되는것으로보고되었다. 초고속실시간 PCR을보다초고속으로수행하기위하여이단계 PCR법의적용은보다효과적일것으로예측되었으며, 이를위하여삼단계 PCR에서 annealing 온도의상승이초고속실시간 PCR에미치는영향을측정하였다. HIV-1 특이유전자를기질로한실험에서 annealing 온도의설정범위는일반적인 extension 온도인 72 o C까지, 즉 62 o C에서 72 o C 까지로측정하였으며, HIV-2 특이유전자의경우 56 o C 에서 72 o C까지를측정하였다. HIV-1 및 HIV-2 특이유전자를증폭시키는 30회전의초고속 PCR에서양자모두 annealing 온도를증가시킬수록초고속 PCR 에필요한총소요시간은크게단축되는것이확인되었다. 그러나 HIV-1 의경우 70 o C, 72 o C의 annealing 온도에서의초고속 PCR은 Ct값이측정되지아니하였으며, Tm값도 72 o C에서는측정

4 Vol. 43, No. 4 HIV 검출을위한초고속이단계 PCR 진단법 267 되지아니하였다. 또한 HIV-2 의경우 Ct값은 56에서 72 o C까지모두측정되었으나, annealing 온도 72 o C의초고속 PCR에서 Ct 값이크게증가된것을볼수있었다 (Fig. 1). 초고속 PCR에서 annealing 온도를증가시킬수록초고속 PCR 에필요한총소요시간은크게단축되는것은 denaturation 온도와 annealing 온도의차가좁혀지기때문에각회전에서온도이동에소요되는시간이각기감소되었기때문으로해석되었다. 한편, Ct값이측정되지아니한 HIV-1 의 70 o C의 annealing 온도에서의초고속 PCR은 PCR 생성물의양을의미하는형광강도가동실험의 25 cycle 부분에서부터증가되는것이확인되었으나, 72 o C에서의같은실험의경우 30회전이후에도형광값의변화를확인할수없었다 ( 자료미제시 ). 이는실험에사용된 HIV-1 특이염기서열과 HIV1-dF 및 HIV1-dR primer 쌍의염기서열간 annealing의강도가이온도및초고속의시간조건에서효과적인 annealing이되지않는다는것을의미하는것으로해석되었다. HIV-1 특이유전자를증폭시키는 30회전의초고속 PCR에서최적 annealing온도는우선가장낮은 Ct값과가장높은 Tm값을보여준 65 o C로나타났으나, 본연구에서는초고속 PCR의목적 Table 1. Sequence of HIV env specific detection primers (Lee et al., 2007) Name Sequence (5'-3') nt a GC% GC%3' b Amplicon HIV1-dF cgcctcaatagccctcagca 20 60% 70% 117 bp HIV1-dR ttgggagcagcaggaagcac 20 60% 60% HIV2-dF cagccagccaacgaaggaac 20 60% 50% 119 bp HIV2-dR cccgatcaagaggcgagtca 20 60% 60% a nucleotides GC% of half primer in 3' direction 을추구하기위하여 annealing 온도 65 o C에서나타난 Ct값보다 0.4 회전이증가되었으나, 최종반응시간에서약 35초를단축시킨 annealing 온도 67 o C를최적온도로선정하였다. 한편 HIV-2 특이유전자를증폭시키는 30회전의초고속 PCR 에서최적 annealing 온도는가장낮은 Ct값을보여준 68 o C로나타났으며, 그이상의 annealing 온도에서초고속 PCR은 PCR 산물의생성량이크게감소되고또한 Ct값이크게증가하여초고속 PCR에적합하지아니한것으로판단되었다. 본연구에서사용된 primer들은염기의길이, GC% 및 amplicon의크기가모두일정한 primer들이며 (Table 1), 이런 primer들도초고속 PCR에서 HIV-1 과 HIV-2 의경우와같이다른 annealing 강도를보이는것은 primer 쌍의염기서열간의차이로해석되며, 초고속 PCR에적합한 primer의염기서열은더연구될필요가있을것으로판단되었다. Fig. 1. Effects of annealing-temperature in HIV specific ultra-rapid real-time PCR. (A) Annealing-temperature gradient ultra-rapid PCR for HIV1. Ct values could not be calculated with 30 cycled PCR in the annealing temperature between 70 o C and 72 o C. Tm was also not estimated in 72 o C of annealing. (B) Annealing-temperature gradient ultra-rapid PCR for HIV2. Ct values rapidly increased around 72 o C of annealing. Optimum temperatures for annealing were determined on 67 o C (HIV 1) and 68 o C (HIV2) in HIV specific ultra-rapid real-time PCR, respectively. 이단계초고속 PCR과삼단계초고속 PCR의비교초고속삼단계실시간 PCR을통하여얻어진최적의 annealing 온도에서초고속이단계 PCR의결과와초고속삼단계 PCR의결과를비교하였다. 우선, 융점분석 (Melting-temperature analysis) 과 30회전의 PCR 을포함한전체검색시간에서초고속이단계 PCR이초고속삼단계 PCR보다 30초내외의시간을단축할수있는것으로측정되었다. 한편, 반복된실험에서동일한초고속 PCR에서도총검색시간이약 4초수준의차이가나는것이발견되었으며, 이는초고속 PCR 기기의적정온도보정과정에서미세한시간차가증폭되기때문에발생되는시간적오차로판단되었다. HIV1 및 HIV2 특이서열을각기대상으로한실험모두에서이단계초고속 PCR과삼단계초고속 PCR의 Ct값은실험오차범위의차이만을보였으며, 이는이단계와삼단계 PCR간의 DNA 증폭효과에서는차이가없는것으로해석되었다. 한편 Tm값에서도 HIV-1 과 HIV-2 의실험모두, 이단계초고속 PCR과삼단계초고속 PCR은실험오차범위의작은차이만을보였으며, 이역시이단계및삼단계초고속 PCR에서 DNA 증폭효과에서는별다른차이가없는것으로해석되었다. 본실험에서초고속 PCR 기기를통하여적용된삼단계초고속 PCR과이단계초고속 PCR의차이는, 사실각 annealing 온도에서반응시간을 2초에서 1초로줄인것이다. 결과적으로초고

5 268 Dong-Woo Lee et al. Kor. J. Microbiol 속 PCR에이단계 PCR법을적용시킨것은삼단계초고속 PCR 에서보여준 Ct값과 Tm값의변화없이총실험시간만을 30초줄일수있었던것으로나타났으며, 이는이단계초고속 PCR이총검색시간의단축에서보다유리함이확인된것이다 (Fig. 2). 이단계초고속 PCR에서 denaturation 온도감소효과이단계초고속 PCR에서보다검사시간을단축하기위하여, 정확한 PCR 증폭이손상되지않는범위에서가장낮은수준의 denaturation 온도를측정하고자하였다. 모든조건은이단계초고속 PCR의기본조건과동일하게수행하였으며 denaturation 온도를 88~94 o C까지 2 o C 간격으로측정하며비교하였다. 결과는 HIV1과 HIV2 특이서열을대상으로한실험모두에서 94 o C, 92 o C, 90 o C에서는정상적 PCR산물의증폭에의한형광값의증가를확인할수있었으나, 88 o C에서는형광값의증가, 즉 PCR 산물의증폭을관찰할수없었다. 또한 denaturation 온도 90~94 o C에서모든초고속 PCR의 Ct값및 Tm값은큰차이를보이지않았기에, 최소의 PCR 소요시간을보여준, 가장낮은 denaturation 온도인 90 o C를 HIV1과 HIV2 특이서열의검출을위한초고속이단계 PCR의최적 denaturation 온도로결정하였다. 실제로본실험에서 90 o C를 denaturation 온도로적용한초고 속이단계 PCR은 30회전의 PCR 실험과융점분석시간을포함하여, 94 o C를 denaturation 온도로적용한동일실험보다 40초이상소요시간감소효과를보였으며, 최종적으로 HIV1을증폭대상으로한이단계초고속 PCR의경우 30회전의 PCR 실험과융점분석시간을포함하여, 7분 32초, HIV-2 의경우 7분 24초에해당특이 DNA 검출이가능하였다 (Fig. 3). 의최적조건 의최적온도및시간의조건에서, primer 농도, MgCl 2 농도, Taq polymerase 농도등제반조성조건의영향을측정하였다 (Fig. 4). 각실험은 Ct값을기준으로특이 DNA의 PCR 증폭효과의증감으로판정하였다. 먼저 primer 농도에따른초고속 PCR의 DNA 증폭효과는 10 pmole에서 40 pmole까지의범위에는큰차이가없는것으로나타났으나, 30 pmole 이상의 primer 농도 Fig. 2. Comparison between three-step PCR and two-step PCR in ultra-rapid real-time PCR. (A) HIV1 ultra-rapid real-time PCR. Differences between two kind of PCRs were 0.06 cycle in Ct value, 0.23 o C in Tm and 23 sec in total time of 30 cycled PCR. (B) HIV2 ultra-rapid real-time PCR. Differences between PCRs were 0.65 cycle in Ct value, 0.19 o C in Tm and 31 sec in total time of PCR. Fig. 3. Effects of denaturation-temperature in HIV specific ultra-rapid real-time PCR. (A) Denaturation-temperature gradient ultra-rapid PCR for HIV1. Ct values and Tm could not be calculated with 30 cycled ultra-rapid PCR in 88 o C of denaturation. (B) Denaturationtemperature gradient ultra-rapid PCR for HIV2. Ct values and Tm were also not calculated in 88 o C of denaturation. Optimum temperature for denaturation was determined on 90 o C for HIV specific ultra-rapid real-time PCR.

6 Vol. 43, No. 4 HIV 검출을위한초고속이단계 PCR 진단법 269 값이크게증가하는것을볼수있었다. HIV-2 의경우는 MgCl 2 의농도를 2 mm에서그이상으로증가시킬수록 Ct값이증가하였으나, 그증가의정도가 HIV-1 의경우에비하여상대적으로적게나타났다. 따라서일반 PCR의경우와같이 MgCl 2 의농도는초고속 PCR에서도성공적 PCR을위한중요변수로판단되었으며, 이는 template와 primer들의염기서열에따라변화될수있음을확인하였다. 본 HIV 이단계초고속 PCR에서최적 MgCl 2 의농도는모두 2 mm로결정하였다 (Fig. 4B). 한편 Taq polymerase 농도에따른초고속 PCR의 Ct값, 즉 DNA 증폭효과에대한실험결과는 HIV-1 과 HIV-2 모두에서 Taq polymerase의농도가 0.6 unit 이상으로증가할수록 Ct값이높아지는것으로나타났으며, 결과적으로 PCR 산물의생산량이낮아지는것으로나타났다. 이는본연구에서사용된 micro-chip based PCR의반응액총량이 6μl의소량이기에, 0.6 unit이상은이미과량으로기질및 primer들의원활한활동을제한하기때문으로해석되었다 (Fig. 4C). Fig. 4. Optimum conditions of HIV specific two-step ultra-rapid realtime PCR. (A) Effects of primer concentrations. (B) Effects of MgCl 2 concentration. (C) Effects of Taq polymerase concentration. Optimum conditions of HIV specific two-step ultra-rapid real-time PCR were determinated on 10 pmole of each primers, 2.0 mm of MgCl 2 concentration, and 0.6 unit of Taq polymerase. 에서는형광의절대값, 즉 PCR 생성물의양이상대적으로조금감소되는결과를보여주었다. 또한 30 pmole 이상의 primer 농도에서 Tm값들도상대적으로조금낮아진것이관찰되었으며, 이는상대적으로적게생성된 PCR 산물들이과다투여로잔류된 primer의영향을받아 Tm의측정에서상대적으로낮게나온것으로추론되었다. Primer의과다투여가긍정적영향을보이지아니하는것을감안하여 의최적 primer의농도는 10 pmole로결정하였다 (Fig. 4A). 또한 MgCl 2 농도에따른초고속 PCR의 Ct값, 즉 DNA 증폭효과는 MgCl 2 농도에따라 Ct값이크게변화되는것으로관찰되었으며, 특히 HIV-1 의특이염기서열을증폭대상으로하였을경우, MgCl 2 의농도를 2 mm에서그이상으로증가시킬수록 Ct 의민감도 본연구를통하여확립된 의최적조건을사용하여 HIV-1 및 HIV-2 특이유전자의각검출한계를측정하였다. 초기기질의양은각특이유전자의분자량에따른분자의수를계산하였으며, 이분자수를검출한계의단위로사용하였다 (Fig. 5). 민감도측정의결과, HIV-1 또는 HIV-2 특이유전자 1 pg ( copies), 100 fg ( copies), 10 fg ( copies) 에서초고속이단계 PCR은각각의유전자를성공적으로증폭할수있었으며, 각초기기질의양에대한각 Ct값의비에서매우우수한정량성을보여주었다. 또한이초고속 PCR에소요된총검출시간도, 융점분석의시간을포함하여, 7분 24초에서 7분 35초로측정되어이단계초고속 PCR의우수성을보여주었다. 그러나 HIV1 및 HIV2 각기 1 fg ( copies) 에대한 30회전의초고속 PCR에서는 Ct값이측정되지아니하였으며, 이는본실험의초기기질의양에대한정량성에비추어 Ct값이각기 30 회전이후나타나기때문으로해석되었다. 사실본연구의초고속이단계 PCR의조건에서 PCR의회전수만 40 회전으로증가시켰을경우, 총소요시간은 9분대로증가되나민감도는각기이등의연구 (9) 와같이초기기질 0.01 fg (2.3 copies) 의 HIV1 및 HIV2의유전자를증폭시킬수있었으며, 각기 35회전이내에서 Ct값이형성되는것을볼수있었다 ( 자료미제시 ). PCR 산물에대한정성적측정의방법인융점분석 (melting point analysis) 에서 Tm값은 HIV1의경우 82.5(±0.1) o C로측정되었으며, HIV2는 82.6(±0.3) o C로측정되어, 각기동일한 PCR 산물을증폭시켰음을확인하였다. 의정확성 본연구에서개발된 HIV 특이유전자검출을위한이단계초

7 270 Dong-Woo Lee et al. Kor. J. Microbiol Fig. 6. Reproducibility of HIV two-step ultra-rapid real-time PCR. (A) HIV1 specific ultra-rapid PCR. PCRs were triplicated with 10- fold serially diluted initial templates. Ct values and error range were calculated 28.09±0.32 cycles in 10 fg ( copies), 24.56± 0.30 cycles in 100 fg, 21.55±0.29 cycles in 1 pg, 18.25±0.05 cycles in 10 pg, respectively. R 2 is coefficient of regression. (B) HIV2-specific ultra-rapid PCR. Ct values and error range were calculated 27.45± 0.73 cycles in 10 fg ( copies), 24.91±0.14 cycles in 100 fg, 21.91±0.30 cycles in 1 pg, 19.02±0.21 cycles in 10 pg, respectively. Fig. 5. The sensitivity of HIV specific two-step ultra-rapid real-time PCR. Ultra-rapid real-time PCRs were performed with 10-fold serially diluted initial template ranging from 1 fg ( copies) to 1 pg ( copies). (A) The fluorescence (F) curves of each PCRs with initial HIV1 specific templates. The Ct values (vertical dotted lines) were calculated from the curves of -df/dt cycles in 1pg of initial template, cycles in 100 fg, cycles in 10 fg. Ct value in 1 fg could not be determined. (B) Melting temperature analysis between 75 o C and 85 o C in HIV1-specific ultra-rapid PCR. Tm values (vertical dotted lines) were calculated on 82.5±0.1 o C. Total detection times including 30 cycled PCR and melting temperature analysis was estimated 7 min and 33±2 sec. (C) The fluorescence (F) curves of each PCRs with HIV2-specific templates. The CT values (vertical dotted lines) were calculated, cycles in 1 pg of initial template, cycles in 100 fg, cycles in 10 fg. Ct value in 1 fg was not determinated. (D) Melting temperature analysis in HIV2- specific ultra-rapid PCR. Tm values were calculated on 82.5±0.3 o C. Total detection times were estimated 7 min and 25±3 sec. 고속실시간 PCR의정확성을측정하기위하여, 동일한양의초기기질을증폭대상으로하여 HIV1 및 HIV2의초고속 PCR을반복실험하였다. 사용된초기기질의양은 HIV1 및 HIV2 각기 10 pg ( copies), 1 pg ( copies), 100 fg ( copies), 1 fg ( copies) 이었으며이를각기삼반복측정하여그오차를계산하였다 (Fig. 6). 측정결과중 HIV-1 의경우, 각농도별 Ct값의평균과오차의범위는초기기질의양 10 pg에서 18.25±0.05, 1 pg에서 21.55± 0.29, 100 fg에서 24.56±0.30, 10 fg에서 28.09±0.32로측정되었으며, 회귀식은 Y=-3.194X+31.22로, 회귀상수 (R 2 ) 는 로계산되었고, Tm값은 82.5±0.2 o C로나타났다. 한편, HIV-2 의경우는회귀식이 Y=-2.829X 로, 회귀상수 (R 2 ) 는 로계산되었으며, Tm값은 82.5±0.35 o C로측정되어양자모두에서우수한재현성을보여주었다.

8 Vol. 43, No. 4 HIV 검출을위한초고속이단계 PCR 진단법 271 본연구는 12분수준의진단시간을보여준 HIV 초고속 PCR 에대한기존연구 (9) 에새로이이단계 PCR법을적용하여동등의진단, 즉융점분석을포함한 30회전의 HIV 특이 DNA의 PCR 증폭이 7분대수준에서가능함을보여줄수있었다. 사실, 본연구에서보여준 7분 24초의검색시간은융점분석에필요한 100초, 즉 1분 40초가포함된것이며, 따라서 pre-denaturation을포함한 30회전의 PCR 증폭에소요된시간은정확히 5분 44초에불과한것이다. 5분-PCR을목표로한초고속 PCR은우선그소요시간으로목표에거의근접하고있으며관련기술들의발전으로더욱빠른초고속 PCR이가능할것으로예상된다. PCR을이용한병원체의유전자진단법들은일반적으로병원체의특이항원을특이항체로검색하는 immunochromatography법에비하여현장적용에서불리한것으로평가되어왔다. PCR법의민감도는일반적으로면역학적방법에비하여크게우수한것으로평가되고있으나, 특히별도의장비가필요없는 rapid kit (lateral flow immunochromatography법 ) 들은그간편성과 15분이내라는짧은진단시간, 즉신속성으로인하여일반적으로낮은민감도를보임에도불구하고현장에서선호되어왔다. 본연구에서보여준 7분대의초고속 PCR 진단법은 PCR이가지고있는높은민감도를크게희생시키지아니하며, rapid kit에서보여준 15분대의진단이라는신속성을앞지를수있는가능성을보여준것이다. PCR 기기라는특수기기를필요로한다는단점은차후수요에따른 PCR 기기의소형화개발등의노력으로쉽게극복될수있을것이라기대하며, 실시간 PCR이가지고있는또다른장점인정량성, 즉병원체의정량적진단이가능한점을감안한다면, 초고속실시간 PCR 진단법은간이진단이아닌정밀진단을현장에서바로적용시킬수있는민감하고도신속한진단방법이될수있을것이다. 본연구에서는초고속실시간 PCR법의개발에집중하여 RNA virus인 HIV의진단에필요한과정인초고속역전사반응 (reverse transcription) 을제시하지아니하였으며, 임상시료를사용한검출실험등의결과를보여주지는못하였다. 이러한후속실험들은본연구의주제인 HIV에대한초고속 PCR 진단법의현장적용에꼭필요한과정이며향후상기연구의정립으로 HIV의임상진단에초고속 PCR법이활용되기를기대하며더나아가많은 RNA virus에의한진단법에도초고속실시간 PCR법이적용되기를기대한다. 감사의말본연구는농림부농림기술개발사업 ( 과제번호 HD120) 과농촌진흥청바이오그린21사업 ( 과제번호 ) 의지원에의해수행되었으며, 지원에감사드리는바입니다. 참고문헌 1. Arens, M.Q., L.M. Mundy, D. Amsterdam, J.T. Barrett, D. Bigg, D. Bruckner, B. Hanna, H. Prince, T. Purington, T. Hanna, R. Hewitt, C. Kalinka, T. Koppes, S. Maxwell, A. Moe, M. Doymaz, M. Poulter, M.S. Tehrani, L. Simard, D.W. Carmody, J. Vidaver, C. Berger, A.H. Davis, and M.T. Alzona Preclinical and clinical performance of the efoora test, a rapid test for detection of human immunodeficiency virus-specific antibodies. J. Clin. Microbiol. 43, Baczynska, A., H.F. Svenstrup, J. Fedder, and S. Birkelund Development of real-time PCR for detection of mycoplasma hominis. BMC Microbiol. 35, Cho, Y.K., J.T. Kim, Y.S. Lee, Y.A. Kim, K. Namkoong, H.K. Lim, K.W. Oh, S.H. Kim, J.I. Han, C.S. Park, Y.E. Pak, C.S. Ki, J.R. Chio, H.K. Myeong, and C. Ko Clinical evaluation of micro-scale chip-based PCR system for rapid detection of hepatitis B virus. Biosens. Bioelectron. 21, Ellis, J.S. and M.C. Zambon Molecular diagnosis of influenza. Rev. Med. Virol. 12, Graham, N.M.H Epidemiology of acquired immunodeficiency syndrome: advancing to an endemic era. Am. J. Med. 102, Gupta, A. and V.K. Chaudhary Bifunctional recombinant fusion proteins for rapid detection of antibodies to both HIV-1 and HIV-2 in whole blood. BMC Biotechnol. 6, Han, S.H., Y.K. Lim, and B.S. Yoon Manual of methods for molecular biology, 3rd (ed.), p Kyonggi University Press, Suwon, Korea. 8. Kim, E.H., D.W. Lee, S.H. Han, S.H. Kwon, and B.S. Yoon Rapid detection method of Avian Influenza subtype H5N1 using quick real-time PCR. Kor. J. Microbiol. 43, Lee, D.W., E.H. Kim, M.S. Yoo, S.H. Han, and B.S. Yoon Ultra-rapid real-time PCR for the detection of human immunodeficiency virus (HIV). Kor. J. Microbiol. 43, Mello, A.J DNA amplification moves on. Nature 422, O Shea, J., I. Chrystie, R. Cranston, J. Mullen, K. Corbett, G. Murphy, J.V. Parry, A.D. Ruiter, and J. Banatvala Problems in the interpretation of HIV-1 viral load assays using commercial reagents. J. Med. Virol. 61, Palmer, S., A.P. Wiegand, F. Maldarelli, H. Bazmi, J.M. Mican, M. Polis, R.L. Dewar, A. Planta, S. Liu, J.A. Metcalf, J.W. Mellors, and M. Coffin New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 41, Poddar, S.K Influenza virus types and subtypes detection by single step single tube multiplex reverse transcription polymerase chain reaction (RT-PCR) and agarose gel electrophoresis. J. Virol. Methods 99, Ratti, C., G. Budge, L. Ward, G. Clover, C. Autonell, and C. Henry Detection and real-time quantitation of soil-bornecereal mosaic virus (SBCMV) and polymyxa graminis in winter wheat using real-time PCR (Taqman). J. Virol. Methods 122, Wilhelm, J. and A. Pingoud Real-time polymerase chain reaction. Chem. Bio. Chem. 4, Yapijakis, C., V. Panis, N. Koufaliotis, G. Yfanti, S. Karachalios, A. Roumeliotou, and Z. Mantzavinos Immunological and molecular detection of human immunodeficiency virus in saliva, and comparison with blood testing. Eur. J. Oral Sci. 114, (Received November 29, 2007/Accepted December 17, 2007)

9 272 Dong-Woo Lee et al. Kor. J. Microbiol ABSTRACT : Ultra-Rapid Two-Step Real-Time PCR for the Detection of Human Immunodeficiency Virus (HIV) Dong-Woo Lee, Eul-Hwan Kim, Il-Uk Kim, Mi-Sun Yoo, and Byoung-Su Yoon* (Department of Life Science, Kyonggi University, Suwon , Korea) For the detection of human immunodeficiency virus (HIV), ultra-rapid real-time PCR methods were developed. The target DNA sequences were used 495 bp HIV-1-specific env gene (gi_ ) and 294 bp HIV-2-specific env gene (gi_ ). Ultra-rapid real-time PCR was performed by Genspector TM (Samsung, Korea) using microchip-based, 6 μl of reaction volume with extremely short running time in only 2 steps (denaturation, annealing/extension) in each cycle of PCR. Total reaction for 30 cycled ultra-rapid PCR detection including melting temperature analysis was completed in 7 min and 30 sec. The HIV-1-specific 117 bp-long or HIV-2-specific 119 bp-long PCR products were successfully amplified from the minimum of template, copies of each env gene using 30 cycled two-steps ultra-rapid PCR. This kind of ultra-rapid real-time PCR method would be useful not only for the rapid-detection of HIV, but also rapid-detection of other pathogens.

43(1)-4(p.23-30).fm

43(1)-4(p.23-30).fm The Korean Journal of Microbiology, Vol. 43, No. 1, March 2007, p. 23-30 Copyright 2007, The Microbiological Society of Korea Quick Real-time PCR w Avian Influenza Virus Subtype H5N1 ½ yá Áw zá«y 1 Á *»

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양

실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양 실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme

TOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 32(2) : 119~131 (217) DOI: 1.17519/apiculture.217.6.32.2.119 Development of Rapid Detection System for Small Hive Beetle (Aethina tumida) by using Ultra-Rapid PCR

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)

More information

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn

고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna

More information

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli

DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix

More information

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets

Automated high multiplex qPCR platform for simultaneous detection and quantification of multiple nucleic acid targets PCR FlashGel System 2013. 04. 24 PCR 2013. 04. 24 순서 1. PCR 이란 2. PCR 실험의기본조건 3. PCR 효소선택가이드 4. Hot Start PCR의원리 5. PCR 실험시 Troubleshooting 6. PCR 장비 _TP350 소개 PCR(Polymerase Chain Reaction) PCR 이란? -

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

<31372DB9DABAB4C8A32E687770>

<31372DB9DABAB4C8A32E687770> 김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

슬라이드 1

슬라이드 1 Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) +

Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (International) + 20170402 Ver.3(KR) All about Real-Time PCR 8-11, Munpyeongseoro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Real-Time

More information

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를

미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를 Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는

More information

Cloning

Cloning Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

Slide 1

Slide 1 PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa

Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

SMARTer 시리즈

SMARTer 시리즈 SMARTer 시리즈 SMARTer Solutions 2014.12.17 다카라코리아바이오메디칼 SMART 하게실험하고 SMARTer 한결과를얻는방법 Clontech SMARTer 시리즈 Contents 1. Introduction 1. 역전사반응이란? 2. 기존역전사반응의한계 2. SMARTer 시리즈 1. SMARTer 란? 2. SMARTer 시리즈와적용

More information

29(2)-04(임시근).fm

29(2)-04(임시근).fm Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler

More information

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소

서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소 2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in

More information

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR

cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

82-01.fm

82-01.fm w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot

ITEM 1 PCR Enzyme 20% DNA Polymerase Enzyme Quick Selection Guide for Effective PCR DNA Polymerase General PCR / Colony PCR Long PCR (Max. 23 kb) Hot 2017 Summer BIG SALE 2017.7.3 ~ 9.8 ITEM 1 P C R Enzyme cpcr Enzyme 20% High Quality Enzyme ITEM 2 cdna Synthesis cdna Synthesis Kit 최대 33 % off ITEM 3 q P C R Enzyme Two-Step / One-Step Kit NGS Library

More information

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error

PCR DNA Polymerase 선택가이드 일반적인 PCR 실험 Blend Taq / Blend Taq -Plus- Repairing 일반 DNA polymerase와 proofreading 기능의효소가섞인제품 Taq polymerase 보다 3~4 배낮은 error TOYOBO HOT SUMMER BIG SALE 행사기간ㅣ 2015 년 6 월 22 일 ~ 8 월 28 일까지 2+1 PCR DNA Polymerase cdna Synthesis Kit ㅣ KOD Series ㅣ Blend Taq Series ㅣ Quick Taq HS DyeMix ㅣ ReverTra Ace Series 플러스혜택 Set 구매시, 최대 45%

More information

Microsoft Word - KSR2012A021.doc

Microsoft Word - KSR2012A021.doc YWXY G ºG ºG t G G GGGGGGGGGrzyYWXYhWYXG Ÿƒ Ÿ ± k ¹Ÿˆ Review about the pantograph field test result adapted for HEMU-430X (1) ÕÕÛ äñ ã G Ki-Nam Kim, Tae-Hwan Ko * Abstract In this paper, explain differences

More information

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.

2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2. 2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

슬라이드 1

슬라이드 1 TAKARA 1. PCR 2. qpcr 2014. 02. 13. 최유미 DNA? DNA 생물체 > 기관 > 세포 >DNA DNA (Deoxyribonucleic acid) 세포내에서생물의유젂정보를보관하는물질 구성 : Adenine, Thymine, Cytosine, Guanine 종특이적, 개체특이적 PCR (Polymerase Chain Reaction)

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio

Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea) (Internatio 20170619 Ver.4 (KR) All about RT (cdna Synthesis) 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 34302, Republic of Korea Tel: (Korea)1588-9788 (International) +82-42 - 930-8777 Email: sales@bioneer.com Selection

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

슬라이드 1

슬라이드 1 EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

±èÇ¥³â

±èÇ¥³â 533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural

More information

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -

Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

현대패션의 로맨틱 이미지에 관한 연구

현대패션의 로맨틱 이미지에 관한 연구 한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

08.hwp

08.hwp 박 기 식 여주대학 토목과 (2001. 10. 24. 접수 / 2002. 6. 14. 채택) A Study on the Longitudinal Vibration of Finite Elastic Medium using Laboratory Test Ki-Shik Park Department of Civil Engineering, Yeojoo Institute of

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터

Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No ) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 Spring SALE 개나리 꽃이 피었습니다! 당신의 얼굴에도 웃음 꽃이 피었습니다! Seakem LE Agarose (Cat. No. 50004) One하면 덤으로 한 개 더! 1+1 기간 : 2011년 3월 2일 ~ 4월 15일 ~ 30 % Sa le 고객지원센터 (학술/제품문의) 02-2081 - 2510 www.takara.co.kr support@takara.co.kr

More information

10(3)-12.fm

10(3)-12.fm w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long

ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H domain 부위에유전자조작을시켜, Rnase H activity를낮추어 mrna의 degradation을방지하여 cdna 합성효율을높임 Long 2016 TOYOBO SUMMER SALE 2016.7.4 ~ 9.9 cdna Synthesis Kit qpcr Master Mix KOD Polymerase Enzyme DNA Polymerase Enzyme Immuno Enhancer ReverTra Ace cdna Synthesis Kit d ReverTra Ace M-MLV RTase의 RNase H

More information

EZ-Cloning kit

EZ-Cloning kit EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

untitled

untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information

Print

Print 2018-09-11 Ver.4 (KR) 8-11, Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: (Korea) 1588-9788 (International) +82-42-930-8777 Email: sales@bioneer.com Real-Time PCR Reagents Selection

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * , 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

Microsoft Word - Genolution RNAi Manual.doc

Microsoft Word - Genolution RNAi Manual.doc 1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

Microsoft Word - KSR2016S168

Microsoft Word - KSR2016S168 2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

KAERITR hwp

KAERITR hwp - i - - ii - - iii - Minimum Detectable Activity(MDA) for Analysis of Noble Gas in Atmosphere It is important to determine whether radioactivity of noble gas in atmosphere exist or not. It is also difficult

More information

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin

Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombin Chapter 6. Nucleotides and Nucleic Acids 세포대사에서뉴클레오타이드 (nucleotide) 의기능은무엇인가? Objective 유전체학 (genomics) 과단백체학 (proteomics) 기본개념이해 재조합 DNA 기술 (recombinant DNA technology) 란? - 효소의보조인자, 대사중간산물구성성분, 유전정보함유등

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

<31335FB1C7B0E6C7CABFDC2E687770>

<31335FB1C7B0E6C7CABFDC2E687770> 에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.

More information

05052유식안101.hwp

05052유식안101.hwp 제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------

More information

step 1-1

step 1-1 Written by Dr. In Ku Kim-Marshall STEP BY STEP Korean 1 through 15 Action Verbs Table of Contents Unit 1 The Korean Alphabet, hangeul Unit 2 Korean Sentences with 15 Action Verbs Introduction Review Exercises

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

(5차 편집).hwp

(5차 편집).hwp (215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)

More information

#Ȳ¿ë¼®

#Ȳ¿ë¼® http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research

More information

12È«±â¼±¿Ü339~370

12È«±â¼±¿Ü339~370 http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

ABSTRACT Development of statistical method to modeling tooth healthspan curves in Korean Jung Hoi In Department of Dentistry The Graduate School, Yonsei University Development of statistical method to

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31() : 133~1 (1) Development of a Detection Method against 11 Major Pathogens of Honey Bee using Amplification of Multiplex PCR and Specific DNA-chip Ji-Hee Wang,

More information