316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
|
|
- 승준 황
- 6 years ago
- Views:
Transcription
1 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : (2015) Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection of Soybean mosaic virus by Reverse Transcription Loop-mediated Isothermal Amplification Bishwo P. Mainali * 1 1, 2 *Corresponding author Tel : Fax: suheon@knu.ac.kr Yeong-Hoon Lee 1, Dae-Hyeon Bae 2, Bong-Sub Kim 2, Young-Nam Yoon 1, Soon-Do Bae 1, Hyun-Joo Kim 1, Bishwo P. Mainali 1, In-Hee Park 1, Su-Heon Lee 2 * and Hang-Won Kang 1 1 Crop Production Technology Research Division, National Institutes of Crop Science, Rural Development Administration, Miryang , Korea 2 School of Applied bioscience, Kyungpook National University, Daegu , Korea Received August 22, 2015 Revised October 17, 2015 Accepted November 12, 2015 Soybean mosaic virus (SMV) is a prevalent pathogen that causes significant yield reduction in soybean production worldwide. SMV belongs to potyvirus and causes typical symptoms such as mild mosaic, mosaic and necrosis. SMV is seed-borne and also transmitted by aphid. Eleven SMV strains, G1 to G7, G5H, G6H, G7H, and G7a were reported in soybean varieties in Korea. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) method allowed one-step detection of gene amplification by simple procedure and needed only a simple incubator for isothermal template. This RT-LAMP method allowed direct detection of RNA from virus-infected plants without thermal cycling and gel electrophoresis. In this study, we designed RT-LAMP primers named SML-F3/B3/FIP/BIP from coat protein gene sequence of SMV. After the reaction of RT-LAMP, products were identified by electrophoresis and with the detective fluorescent dye, SYBR Green I under daylight and UV light. Optimal reaction condition was at 58 o C for 60 min and the primers of RT-LAMP showed the specificity for nine SMV strains tested in this study. Keywords : Detection, RT-LAMP, SMV, Soybean, Virus (Glycine max) (Rosales) (Leguminosae), ,000, Research in Plant Disease The Korean Society of Plant Pathology pissn , eissn , (Ann, 2012). (Soybean mosaic virus, SMV) Potyviridae, Potyvirus, 43%.,, (Domier, 2007, 2011). SMV 11 This is an open access article distributed under the terms of the Creative Commons Attribution License ( which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
2 316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(RT-PCR). ELISA (Lee, 2010). RT-PCR, (Li Mock, 2005).. Notomi (2000) strand displacement activity Bst polymerase loop Loop-mediated isothermal amplification(lamp). PCR 2 primer, LAMP 6 4 primer., template , DNA. PCR (denaturation), (annealing), (extention), (Blomstrom, 2008; Nagamine, 2002). RNA DNA., RT-LAMP LAMP RT LAMP RT- LAMP (Fukuta, 2003; Parida, 2004). heating block Thermocycler. SYBR Green I ethidium bromide(etbr),.,, RT-LAMP SMV. 시험재료. SMV SMV. (-70 o C). 전체 RNA 분리. 100 mg Lysis (intron bio., Korea). RNA 30 ml elution buffer RT-LAMP RT-PCR. RT-LAMP primer 제작. primer NCBI GeneBank SMV 11 G1(Accession no. FJ640977), G2(S42280), G3(FJ640978), G4(FJ640979), G5(AY294044), G6(FJ640980), G7(AY216010), G5H(FJ376388), G6H(FJ640981), G7A(FJ640982), G7H(AY294045) SMV TNP(HQ845735) DNASTAR(DNASTAR, Inc., USA). LAMP primer designing software Primer Explorer( RT-LAMP primer. 4 SMV RT-LAMP primer SML-FIP SML-BIP loop TTTT spacer 42 nt, SML-F3 SML-B3 inner primer 18 nt, 19 nt (Table 1). primer Bioneer(Daejeon, Korea), inner primer PAGE. 최적조건확립. RT-LAMP RT-LAMP kit(eiken Chemicals Co., Japan). RT-LAMP kit. total RNA 1 ml 40 pm inner primers, 5 pm outer primers, 8 U Bst DNA polymerase large fragment(new England Biolabs, USA), 1 Table 1. Specially designed set of four target-specific primers (F3, B3, FIP and BIP) Virus (NCBI No.) Primers Length Sequence (5 3 ) SMV (HQ845735) SML-F3 18 GACGATGAACAGATGGGC SML-B3 19 TCTCAGAGTTGGTTTTGCA SML-FIP 42 GCATCTGGAGATGTGCTTTTGTGGTTATGAATGGTTTCATGG SML-BIP 42 GCGTGTGGGTGATGATGGATTTTTTCGACAATGGGTTTCAGC
3 Research in Plant Disease Vol. 21 No ThermoPol Reaction Buffer [20 mm Tris-HCl, 10 mm KCl, 10 mm (NH 4 ) 2 SO 4, 2 mm MgSO 4, 0.1% Triton X-100, New England Biolabs, USA], 10 mm dntp, 5% DMSO, DW 20 ml o C, o C 10. LAMP 2% agarose gel (HOEFER, USA) EtBr. Primer 의특이성확인. primer. 6 SMV Soybean yellow mottle mosaic virus(symmv), Soybean yellow common mosaic virus(sycmv), Peanut stunt virus(psv), Bean common mosaic virus(bcmv) Peanut mottle virus(pemov). SMV 9 G1, G2, G3, G5, G5H, G6, G6H, G7 G7H., RT-LAMP primer primer. Fig. 1. Optimal reaction temperature of RT-LAMP. LAMP was performed under range of 48 to 66 o C. Lane M, 100 bp DNA ladder (Solgent, Korea); lanes 1-7 (48, 51, 54, 57, 60, 63 and 66 o C, respectively); lane 8, negative control. 민감도확인. RT-LAMP total RNA RNA mrna, SMV RT-LAMP DNA clone. DNA clone primer SM_LN2(5 -GTA CAA TGC AGT TAA AGA TGA ATA- 3 ) SM_LC2 (5 -TCT CAA ATT CCT CAG TAG TCC ATA 3 ). DNA clone RT-LAMP RT-PCR. 기기에따른재현성확인. Thermocycler (Applied Biosystems, USA), (EYELA, Japan) heating block(seoulin Bio, Korea). 육안확인. SYBR Green I(Lonza, USA) tube., portable UV light(spectronic, USA), UV transilluminator(corebiosystem, Korea). RT-LAMP 48- Fig. 2. Optimal reaction time of RT-LAMP. LAMP was performed under range of 10 to 120 min. Lane M, 100 bp DNA ladder; lanes 1-8 (10, 20, 30, 40, 50, 60, 90 and 120 min, respectively); lane 9, negative control. 66 o C. 51 o C 63 o C, o C (Fig. 1). 58 o C. 10, 20, 30, 40, 50, 60, 90, , 60 (Fig. 2). 60. Primer 6 SMV SMV RT-LAMP primer (Fig. 3). SMV 9 G1, G2, G3, G5, G5H, G6, G6H, G7 G7H (Fig. 4). primer SMV
4 318 Research in Plant Disease Vol. 21 No. 4 Fig. 3. Specific reaction of primers for target virus. Lane M, 100 bp DNA ladder; lane 1, SMV; lane 2, SYMMV; lane 3, SYCMV; lane 4, PSV; lane 5, BCMV; lane 6, PeMoV; lane 7, negative control. Fig. 5. Requirements for four LAMP primers. Lane M, 100 bp DNA ladder; lane 1, negative control; lane 2, B+C+D; lane 3, A+C+D; lane 4, A+B+C+D lane 5, C+D; lane 6, A+B(A: FIP, B: BIP, C: F3, D: B3). Fig. 4. Specific reaction of primers for nine Soybean mosaic virus strains. Lane M, 100 bp DNA ladder; lanes 1-9 (SMV strain G1, G2, G3, G5, G5H, G6, G6H, G7 and G7H, respectively); lane 10, negative control.. SMV, 9. 4 SMV RT-LAMP primer primer 4 primer positive control. SMV RT-LAMP 4 primer (Fig. 5). RT-LAMP total RNA RNA mrna, SMV RT- LAMP DNA clone. DNA clone product size 295 bp, 147 ng/ul. DNA clone RT-LAMP Fig. 6. Sensitivities of (A) RT-LAMP and (B) RT-PCR for detection of Soybean mosaic virus. LAMP was performed under 58 o C and 60 min. Lane M, 100 bp DNA ladder; lanes 1-8 (1 10 0,1 10-1,1 10-2,1 10-3, ,1 10-5, and , respectively). RT-PCR RT-LAMP (Fig. 6A). RT-PCR RT-LAMP 10 (Fig. 6B). RT-LAMP Thermocycler. heating block Thermocycler. 58 o C, 60 (Fig. 7)., SYBR Green I
5 Research in Plant Disease Vol. 21 No Fig. 7. Specific reaction of primers depends on using machine. The total RNA from infected plant by SMV and healthy plant were used as a positive and negative control, respectively. Lane M, 100 bp DNA ladder; lanes 1-2 (positive and negative control in Thermocycler machine); lanes 3-4 (positive and negative control in water bath); lanes 5-6 (positive and negative control in heating block). Soybean mosaic virus(smv) potyvirus,,, 11 (G1 to G7, G5H, G6H, G7H, G7a). Reverse transcription loop-mediated isothermal amplification(rt-lamp), PCR. RT-LAMP 58 o C, 60. SMV 9. SMV RT-LAMP primer, SMV. heating block Thermocycler. RT- LAMP, SYBR Green I UV.,, portable UV light UV transilluminator. Acknowledgement This study was carried out with the support of Research & Development Program (Project No. PJ ) of National Institute of Crop Science, RDA, Republic of Korea. References Fig. 8. Fluorescent dye mediated visual detection for RT-LAMP. The total RNA from infected plant by SMV and healthy plant were used as a positive and negative control, respectively. A: Fluorescent detection from positive (white, left) and negative (colorless, right) under UV transilluminator; B: Fluorescent detection from positive (green, left) and negative (colorless, right) under portable UV light; C: Naked-eye detection from positive (green, left) and negative (yellow, right) under normal light. tube., portable UV light UV transilluminator. portable UV light UV transilluminator (Fig. 8). viral RNA. Ann, Y. G Jang(Fermented Soybean) in official and royal documents in Chosun dynasty period. Korea J. Food Nutr. 25: Blomstrom, A. L., Hakhverdyan, M., Reid, S. M., Dukes, J. P., King, D. P., Belak, S. and Berg, M A one-setpreverse transcriptase loop-mediated isothermal amplificationassay for simple and rapid detection of swimevesicular disease virus. J. Virol. Meth. 147: Domier, L. L., Steinlage,T. A., Hobbs, H. A., Wang, Y., Herrera-Rodriguez, G., Haudenshield, J. S., McCoppin, N. K. and Hartman, G. L Similarities in seed and aphid transmission among Soybean mosaic virus isolates. Plant Dis. 91: Domier, L. L., Hobbs, H. A., McCoppin, N. K., Bowen, C. R., Steinlage, T. A., Chang, S. Y., Wang, Y. and Hartman, G. L Multiple loci condition seed transmission of Soybeanmosaic virus (SMV) and SMV-induced seed coat mottling in soybean. Phytopathology 101: Fukuta, S., Iida, T., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y Detection of Japanese yam mosaic virus by RT-
6 320 Research in Plant Disease Vol. 21 No. 4 LAMP. Arch Virol. 148: Lee, H. I., Kim, J. H. and Yea, M. C Immunocapture RT-PCR for detection of seed-borne viruses on cucurbitaceae crops. Res. Plant Dis. 16: Li, R. and Mock, R An imporved reverse transcription polymerase chain reaction(rt-pcr) assay for the detection of two cherry flexiviruses in Prunus spp. J. Virol. Meth. 129: Nagamine, K., Hase, T. and Notomi, T Accelerated reactionby loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes. 16: Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: e63. Parida, M., Posadas, G., Inoue, S., Hasebe, F. and Morita, K Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42: Seo, J. K., Ohshima, K., Lee, H. G., Son, M., Choi, H. S., Lee, S. H., Sohn, S. H. and Kim, K. H Molecular variability and genetic structure of the population of Soybean mosaic virus based on the analysis of complete genome sequences. Virol. J. 393:
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): 178-183 (2016) http://dx.doi.org/10.5423/rpd.2016.22.3.178 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification
More information01_HM hwp
The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
More informationTOYOBO Reagent 만의독보적인기술 ReverTra Ace M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고,mRNA 의 degradation 을막아 cdna 합성효율을높임 KOD Polyme
PCR Enzyme 부터 qpcr 까지! PCR 실험은 TOYOBO 로해결하세요! 행사기간 : 7 월 15 일 ~ 9 월 13 일까지 TOYOBO Reagent PCR Enzyme High Quality PCR Enzyme cdna Synthesis Kit qpcr One-step RT Kit Immunoreaction Enhancer Solution 추가
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information현대패션의 로맨틱 이미지에 관한 연구
한지닥섬유제품의인체생리반응및쾌적성평가 임순 Evaluation of Thermal Physiological Responses and Comfort in Dox Fabric Soon Im Professor, Dept. of Fashion Industry, Incheon National University This study performed the evaluation
More information한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationSlide 1
PrimeScript 1st strand cdna Synthesis Kit 1 Central Dogma replication transcription 0 processing translation 오늘의내용은? 조직추출 RNAiso Plus 5 mrna 우리가관심있는 mrna가차지하는비율이극히일부이기때문에관심있는 mrna를증폭해서그것을눈으로확인할정도로만들어주는것이다.
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.
2018 ASF Standard Operation Procedure 아프리카돼지열병진단개요 : - African swine fever, Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter2.8.1. OIE 2012 ver. - EU ASF reference lab CISA-INIA(Spain)
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More informationmau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More informationTechnical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Len
Technical/Specs Sequencing 서비스안내 Standard Sequencing Plasmid/PCR product 를 primer 를이용하여고객이원하는 region 을분석하는서비스이며, 대부분의 normal 샘플에대해 최적화되어있습니다. Full Length Sequencing (Primer walking) 길이가긴 insert 를포함한 plasmid
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2
(Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More information폐비닐수거기-김태욱.hwp
, 11, 1, pp. 113-118 (2012. 2) Journal of the Korean Society of Manufacturing Process Engineers, Vol. 11, No. 1, pp. 113-118 (2012. 2) Twist Wheel 방식폐비닐수거기개발에관한연구 (Ⅰ) - 자주형비닐수거기의개발 - 하유신 *, 박규식 *, 김진현
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information歯5-2-13(전미희외).PDF
The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More informationDNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information00 ³»Áö 4µµ
바이오안전성백서 2007 Biosafety white paper Ministry of Commerce, Industry and Energy Korea Research Institute of Bioscience and Biotechnology 추 천 사 농업혁명, 산업혁명, 정보통신혁명을 이은 제4의 혁명 이라고 일컬어지는 바이오혁명이 우리 지구촌을 뜨겁게 달구고
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
More information82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More informationKIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
More informationmain.hwp
열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information아태연구(송석원)13-2-05.hwp
아태연구 제 13권 제 2호 2006년 11월 30일 pp.81~103 일본에서의 한국학연구 - 회고와 전망 宋 錫 源 경희대학교 사회과학부 정치외교학과 조교수 Ⅰ. 머리말 Ⅱ. 1945년 이전의 한국연구 Ⅲ. 1945년 이후의 한국연구 < 목 차 > Ⅳ. 맺음말 참고문헌 Abstract Key words(중심용어): 한국학(Korean studies), 식민지지배(colonial
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More information........
Investigation of the Korean Traditional Hobun Manufacturing Technique NATIONAL RESEARCH INSTITUTE OF CULTURAL HERITAGE 2008 Investigation of the Korean Traditional Hobun Manufacturing Technique - Centering
More information식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio
식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *
More information실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationSelection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTa
Selection chart of Bioneer s cdna synthesis products Categories Application Product cdna Synthesis Kits One step RT-PCR Kits One step RT-qPCR Kits RTase 표준 cdna 합성 높은효율의 cdna 합성 복잡한 2 차구조 RNA 의 cdna 합성
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More information05052유식안101.hwp
제 출 문 식품의약품안전청장 귀 하 이 보고서를 유전자재조합식품 모니터링(부산광역시보건환경연구원/정구영) 과제의 연구 결과보고서로 제출합니다. 2005. 11. 30 주관연구기관명 : 부산광역시보건환경연구원 주관연구책임자 : 정구영 목 차 Ⅰ. 연구개발결과 요약문----------------------------------- 1 (한글)------------------------------------------
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A S
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.461-487 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.461 * - 2008 2018 - A Study on the Change of Issues with Adolescent Problem
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More information