식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev
|
|
- 교진 진
- 5 years ago
- Views:
Transcription
1 식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Soybean yellow mottle mosaic virus 배대현 1,2 ㆍ박충열 1 ㆍ김봉섭 1,2 ㆍ이영훈 2 ㆍ윤영남 2 ㆍ강항원 2 ㆍ오종희 1 ㆍ이수헌 1 * 1 경북대학교응용생명과학부, 2 농촌진흥청국립식량과학원남부작물부생산기술개발과 *Corresponding author Tel: Fax: suheon@knu.ac.kr These authors contributed equally to this work. Dae Hyeon Bae 1,2, Chung Youl Park 1, Bong-Sub Kim 1,2, Yeong-Hoon Lee 2, Young-Nam Yoon 2, Hang Won Kang 2, Jonghee Oh 1, and Su-Heon Lee 1 * 1 School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea 2 Crop Production Technology Research Division, Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50424, Korea Soybean yellow mottle mosaic virus (SYMMV) is a new emerging plant virus detected in soybean (Glycine max) in Korea. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of SYMMV has been developed. In this study, we have designed primers (SYMM-F3/ B3/FIP/BIP) specific to sequences from the coat protein gene of SYMMV genome. Sensitivity analysis showed that RT-LAMP was 10 to 100 times more sensitive than reverse transcription polymerase chain reaction (RT-PCR). The optimal reaction condition of RT-LAMP was determined at 65 o C for 50 minutes. The result indicates that RT-LAMP assay does not require special equipment and long time for SYMMV detection. Therefore, it can be an alternative detection method of RT-PCR in laboratory. Received June 1, 2016 Revised July 24, 2016 Accepted August 11, 2016 Keywords: Soybean, Soybean yellow mottle mosaic virus, Reverse transcription loop-mediated isothermal amplification 서론 콩 (Glycine max) 은식물성단백질공급원으로경제적으로 중요한작물중하나이다. 전세계적으로 46 종의바이러스 가콩에감염되는것으로보고되었으며 (Tolin 과 Lacy, 2004), 국내에서는 Soybean mosaic virus (SMV) 를포함하여현재까지 11 종이보고되어있다 (Lee 등, 2013, 2015; Lim 등, 2014; Shin 등, 2014). 이중에서, Kim (2006) 에의해서최초보고된콩황 화모틀모자이크바이러스 (Soybean yellow mottle mosaic virus, SYMMV) 는 Carmovirus 속, Tombusviridae 과에속하는바이러 Research in Plant Disease pissn , eissn 스이다. SYMMV의게놈은양성-극성외가닥 RNA (positive sense single stranded RNA) 바이러스로여섯개의열린해독틀 (open reading frame) 과비번역영역 (untranslated region) 으로구성되어있다 (Nam 등, 2009). SYMMV는콩, 돌콩 (Glycine soja), 새팥 (Vigna angularis var. nipponensis), 토끼풀 (Trifolium repens), 비수리 (Lespedeza cuneate) 등콩과식물에국한된자연기주범위를가지며, 돌콩에서종자전염을통한안정된생활사를취하는것으로알려져있다 (Lee와 Kim, 2013). 최근콩재배지의바이러스병발생조사결과에따르면 SYMMV는 SMV, Soybean yellow common mosaic virus (SYCMV) 와함께국내콩에서빈번하게발생하는주요바이러스병이며 (Cho 등, 2013; Lee 등, 2013), 2013년국내전국콩단위조사결과발병률이가장높은바이러스로확인되었다 (Seo 등, 2014). The Korean Society of Plant Pathology cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 178
2 Research in Plant Disease Vol. 22 No 염기서열을기반으로하는진단법이발달하게되면서등온증폭법 (loop-mediated isothermal amplification, LAMP) 이고안되었다 (Notomi 등, 2000). LAMP 방법은등온조건에서 6개의염기서열영역을인식하는 4개의프라이머와 strand displacement activity가높은 Bst 중합효소를사용하여간단하고빠르게목적염기서열을증폭시킨다. LAMP 방법을기반으로한역전사등온증폭법 (reverse transcription loopmediated isothermal amplification, RT-LAMP) 은 Japanese yam mosaic virus, Tomato chlorosis virus, Tomato yellow leaf curl virus, Wheat yellow mosaic virus 등으로야기된병의진단및바이러스의신속검출에도적용되고있다 (Fukuta 등, 2003a, 2003b; Zhang 등, 2011; Zhao 등, 2015). 본연구에서는신속하고정확하며비용효율이높은검출방법인 RT-LAMP 방법을이용하여콩에문제시되고있는 SYMMV의신속검출방법을제안하고자하였다. 재료및방법 SYMMV 감염주의수집및 RT-PCR 진단. 2014년, 대구광역시하빈면에위치한농촌진흥청국립식량과학원남부작물부대구시험지유전자원포에서모자이크, 얼룩, 황화, 퇴록등의전형적인바이러스증상을보이는콩잎을수집하였다. 수집한시료는 easy-spin RNA extraction kit (intron Biotechnology, Seongnam, Korea) 를이용하여제조사의실험방법에따라전체 RNA를추출하였으며, 이를국내콩에발생보고된바이러스 6종 (SMV, SYMMV, SYCMV, Peanut stunt virus [PSV], Bean common mosaic virus [BCMV], Peanut mottle virus [PeMoV]) 에대하여특이적프라이머를이용하여 reverse transcription polymerase chain reaction (RT-PCR) 진단을수행하였다 (Lee 등, 2013). RT-PCR 진단결과를토대로 SYMMV에단독으로감염된시료에한하여본연구의공시시료로사용하였다. RT-LAMP primer 제작. 종특이적프라이머선발을위해 National Center for Biotechnology Information GenBank 에등록되어있는 SYMMV의염기서열정보를수집하였다. 수집된염기서열정보는 DNAMAN software version 7.0 (Lynnon Corporation, Vandreuil, QB, Canada) 을이용하여비교분석한후외피단백질의염기서열정보를이용하여 LAMP 프라이머를설계하였다. 프라이머는 PrimerExplorer ( primerexplorer.jp/elamp4.0.0/index.html) 를사용하여제작하였다 (Table 1). RT-LAMP 재료및조성. RT-LAMP는 Loopamp RNA Amplification Kit (Eiken Chemical Co., Ltd., Tokyo, Japan) 를사용하여반응을수행하였다. Total RNA 2 μl와 50 pmol inner primer (FIP, BIP), 5 pmol outer primer (F3, B3), 1 μl Enzyme mix. (Bst DNA polymerase, AMV reverse transcriptase), 12.5 μl Reaction mix. (40 mμ Tris-HCl, 20 mμ KCl, 16 mμ MgSO 4, 20 mμ (NH 4 ) 2 SO 4, 0.2% Tween 20, 1.6 Μ betaine, 2.8 mm deoxynucleoside triphosphate), 5.5 μl distilled water를혼합하여최종 25 μl의반응액을조성하였다. 최적조건확립. 반응온도및반응시간의최적조건을확인하기위하여온도조건은 45 o C 69.5 o C, 시간조건은 분으로설정하여반응을진행하였다. 반응후에는 80 o C에서 5분간효소를비활성화시킨후반응을종료하였다. 반응산물의확인. 각반응이끝나고반응산물은 2% agarose gel상에서전기영동을실시한후, ethidium bromide (EtBr) 로염색하여확인하였다. 또한 SYBR Green I (Lonza, Rockland, ME, USA) 을적용하여튜브속색의변화또는발광유무통해반응여부를육안으로확인하였다. 색의변화는일반광, UV transilluminator (Sage Creation Science Co., Ltd., Beijing, China) 에서반응여부를확인하였다. Table 1. The sequences of primers used for RT-LAMP assay for Soybean yellow mottle mosaic virus (SYMMV) in this study Primer name Length (nucleotides) Genome position* Sequence (5-3 ) SYMM-F TGGTTGCAGCATATGGACAG SYMM-B ATTGCTGGATGTGGTGGC SYMM-FIP , GAGCAGCTGGAGCGTGTATGAA-AAGCTTCAACAACCCCCTT SYMM-BIP , AACTATGGTGCAACGACTCGGG-GTACGCAAGGTTGCGTAAG RT-LAMP, reverse transcription loop-mediated isothermal amplification. *Genome position according to the coat protein sequence of SYMMV (GeneBank accession No. FJ494882).
3 180 Research in Plant Disease Vol. 22 No. 3 Primer의특이성확인. 설계된프라이머의종특이성을확인하기위해서주요콩바이러스들에대한반응여부를확인하였다. 6종 (SYMMV, SMV, SYCMV, PSV, BCMV, PeMoV) 바이러스의양성대조구를이용하여특이성을검증하였으며, 실험에사용된네개의프라이머들 (FIP, BIP, F3, B3) 에대한반응특이성을확인하기위해서네개의프라이머에서하나혹은두개를제외하고반응을한후에기존의증폭산물과비교하였다. 민감도비교. RT-LAMP와 RT-PCR의민감도를비교하기위하여 RT-LAMP와 RT-PCR을동일한전체 RNA를주형으로 260 ng/μl에서 ng/μl까지단계적으로 10배씩희석하여반응을수행하였다. 기기에따른재현성확인. RT-LAMP가등온이유지되는모든기기에서반응할수있는지알아보기위해등온을유지할수있는기기인유전자증폭기 (BIOER, Hangzhou, China), 항온수조 (Daihan LabTech Co., Ltd., Namyangju, Korea), 발열블록 (FINEPCR Co., Ltd., Gunpo, Korea) 을이용하여재현성을확인하였다. 결과및고찰 RT-LAMP의최적반응온도조건을확인한결과 62.8 o C 이상에서반응이시작되는것을확인할수있었고, 69.5 o C에서는오히려반응이저해된것을확인하였다 (Fig. 1) o C 69.5 o C 사이의온도조건만유지된다면기계적조건에관계없이 SYMMV에대한증폭이가능하였다. 최적온도조건을설정한후모든반응은 65 o C에서실시하였다. 최적반응시간조건을확인한결과, 반응이 30분이상되었을때처음으로반응이확인되었으며, 50분이상부터최적의반응을보였다 (Fig. 2). LAMP 방법은기존의 PCR 방법과유사하지만등온조건에서변성과정없이접합, 신장이가능하다 (Blomström 등, 2008; Nagamine 등, 2002). RNA 바이러스의실험을위해서는 RNA를 DNA로역전사하는과정을거쳐야하는데 RT-LAMP는일반적인 LAMP 방법과동일하게등온에서역전사과정과 LAMP 반응이동시에진행되기때문에 RT- PCR과비교했을때큰시간차이를보이는장점이있어 RNA 의증폭및검출에적용되고있다 (Fukuta 등, 2003a; Parida 등, 2004). 최적시간조건을설정한후모든반응은 50분으로실시하였다. Primer의특이성을확인한결과, SYMMV에서만양성반응이확인되었다 (Fig. 3). 또한네개의프라이머들에대한작동특이성을확인한결과모든프라이머가함께있어야만프라이머가작동하여반응이일어나는것이확인되었다 (Fig. 4). LAMP primer는 4개의프라이머가총 6부분의염기서열영역과반응하는데이는 PCR과비교하여도높은특이성을나타낼수있을것이라생각된다. RT-LAMP와 RT-PCR의민감도를비교한결과 RT-LAMP는 ng/μl까지 RT-PCR은 ng/μl까지밴드가형성되는것이확인되었다. RT-PCR 이주형이 ng/μl일때매우희미한밴드를형성한것으로보아 RT-LAMP가 RT-PCR M M Fig. 1. Optimal reaction temperature of reverse transcriptionloop mediated isothermal amplification (RT-LAMP). RT-LAMP was performed under range of 45 o C to 69.5 o C. Lane M, 100 bp DNA ladder (Solgent, Daejeon, Korea); lanes 1 9 (45 o C, 48.5 o C, 49.8 o C, 51.9 o C, 54.8 o C, 58.5 o C, 62.8 o C, 66.6 o C, and 69.5 o C, respectively). Fig. 2. Optimal reaction time of reverse transcription-loop mediated isothermal amplification (RT-LAMP). RT-LAMP was performed under range of 10 to 60 minutes. Lane M, 100 bp DNA ladder; lanes 1 6 (10, 20, 30, 40, 50, and 60 minutes, respectively).
4 Research in Plant Disease Vol. 22 No 보다 배의민감도를가지고있는것으로확인되었다 (Fig. 5). RT-LAMP와 RT-PCR의민감도를비교했을때 RT-LAMP 를적용한바이러스검출법중대다수의바이러스병에대하여 RT-PCR 방법보다민감도가높았다 (Fukuta 등, 2003a; Zhang 등, 2011; Zhao 등, 2015). RT-LAMP는 RT-PCR과달리등온에서증폭이가능하고시간을단축할수있는장점을가지고있으며, 이와같은장점을이용하여농업현장에 RT-LAMP 방법을적용하기위해서는항온수조나발열블럭등의장비와같이이동성과휴대성 이간편한장비가필수적으로요구된다. RT-LAMP 방법의중 요한요소중의하나인등온조건을유지할수있는다양한 기기 ( 유전자증폭기, 항온수조, 발열블록 ) 를이용하여재현 성을확인한결과, 모든기기에서동일한 RT-LAMP 결과를확 인할수있었다 (Fig. 6). 또한, 반응후전기영동이아닌 SYBR A M M B Fig. 3. Specific reaction of primers for target virus. Lane M, 100 bp DNA ladder; lane 1, Soybean yellow mottle mosaic virus; lane 2, Soybean mosaic virus; lane 3, Soybean yellow common mosaic virus; lane 4, Peanut stunt virus; lane 5, Bean common mosaic virus; lane 6, Peanut mottle virus. Fig. 5. Sensitivity comparison of reverse transcription-loop mediated isothermal amplification (RT-LAMP) and RT-PCR for detecting Soybean yellow mottle mosaic virus (SYMMV). (A) Sensitivity analysis of RT-LAMP for the detection of SYMMV by agarose gel electrophoresis. (B) Sensitivity analysis of RT-PCR for the detection of SYMMV by agarose gel electrophoresis. Lane M, 100 bp DNA ladder; lanes 1 9, 10-fold dilution of total RNA ( to , respectively). Fig. 4. Reverse transcription-loop mediated isothermal amplification (RT-LAMP) primer set requirements for Soybean yellow mottle mosaic virus detection. Lane M, 100 bp DNA ladder; lane 1, negative control; lane 2, B+C+D; lane 3, A+C+D; lane 4, C+D; lane 5, A+B; lane 6, A+B+C+D. A, FIP; B, BIP; C, F3; D, B3. Fig. 6. PCR test of reverse transcription-loop mediated isothermal amplification (RT-LAMP) on various thermostatic equipments. Lane M, 100 bp DNA ladder; lanes 1 and 2, positive and negative control in thermocycler machine; lanes 3 and 4, positive and negative control in heating block; lanes 5 and 6, positive and negative control in water bath.
5 182 Research in Plant Disease Vol. 22 No. 3 A B C Fig. 7. Visual detection for reverse transcription-loop mediated isothermal amplification (RT-LAMP) product with fluorescent dye. (A) Positive (luminescence, left) and negative (matte, right) fluorescent detection under UV transilluminator. (B) Positive (luminescence, left) and negative (matte, right) fluorescent detection under ultraviolet light. (C) Positive (yellow, left) and negative (orange, right) naked-eye detection under daylight. green I을이용하여육안확인이가능한지알아보기위해서튜브속변색또는발광유무통하여반응여부를육안으로확인한결과일반광, 자외선모두에서양성및음성대조군의구분이가능하였다 (Fig. 7). 위의특징을이용한다면현장에서전기영동없이증폭산물의반응유무를육안으로간편하게확인가능할것으로생각된다. 식물바이러스진단을위하여개발된다양한방법중에서국내에서는효소결합면역흡착검사 (enzyme-linked immunosorbent assay, ELISA) 법과 RT-PCR 방법이주로이용되고있다. ELISA 방법의경우대량의시료를비교적저렴한비용으로신속하게진단이가능하지만검출민감도가낮고검사결과를판독하는과정에서오류발생에대한한계가있다 (Lee 등, 2010). RT-PCR 방법은검사대상의양적증가에따른진단비용과소요시간또한증가하고, 기술숙련자와고가의장비가필요하다는단점이있다 (Li와 Mock, 2005). 위와같은기존진단법들의단점을극복하기위해개발된 LAMP 방법은이미많은저널의논문을통하여보고되었으며, 신속성및정확성그리고비용적인부분에서효율이높은방법으로평가되고있다 (Mori와 Notomi, 2009; Parida 등, 2004). 본실험결과를바탕으로 RT-LAMP는 SYMMV에대한신속, 정확한진단에적용될수있을것이라생각된다. 요약 SYMMV는콩에서빈번하게발생하는바이러스이며, 이바이러스의발생률은계속해서증가하고있다. 본연구에서는콩에발생하는 SYMMV를신속하게검출하기위해서 RT- LAMP를적용하였다. RT-LAMP 방법은등온에서단시간에유전자증폭이가능하고, 전기영동없이도형광물질을이용해바이러스를검출할수있는이점이있다. 프라이머는 SYMMV coat protein gene 의염기서열을기반으로 4 개의프 라이머를설계하였다. 실험결과 SYMMV RT-LAMP 는 65 o C 에 서 50 분간증폭시켰을때최적의효율을보였다. 또한, RT- LAMP 와 RT-PCR 과의민감도를비교한결과 RT-LAMP 방법이 배정도더우수한민감도를가지는것으로밝혀졌 다. 본실험결과를토대로기존의진단법과비교하여높은 민감도와짧은소요시간에이점이있는 RT-LAMP 는 SYMMV 의현장및연구실에서의진단에적용될수있을것이라생 각된다. Conflicts of Interest No potential conflict of interest relevant to this article was reported. Acknowledgement This research was carried out with the support Research & Development Program (Project No. PJ ) of National Institute of Crop Science, RDA, Republic of Korea. References Blomström, A. L., Hakhverdyan, M., Reid, S. M., Dukes, J. P., King, D. P., Belák, S. and Berg, M A one-step reverse transcriptase loop-mediated isothermal amplification assay for simple and rapid detection of swine vesicular disease virus. J. Virol. Methods 147: Cho, S. H., Kim, J. K., Li, M., Seo, E. Y., Lim, S. M., Hong, S. M., Moon, J. S., Hammond, J. and Lim, H. S Occurrence of three major soybean viruses, Soybean mosaic virus, Soybean yellow mottle mosaic virus and Soybean yellow common mosaic virus revealed
6 Research in Plant Disease Vol. 22 No by a nationwide survey of subsistence farming soybean fields. Res. Plant Dis. 19: (In Korean) Fukuta, S., Iida, T., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y. 2003a. Detection of Japanese yam mosaic virus by RT-LAMP. Arch. Virol. 148: Fukuta, S., Kato, S., Yoshida, K., Mizukami, Y., Ishida, A., Ueda, J., Kanbe, M. and Ishimoto, Y. 2003b. Detection of Tomato yellow leaf curl virus by loop-mediated isothermal amplification reaction. J. Virol. Methods 112: Kim, S. M Identification of legume-infecting viruses in Korea and characterization of Soybean yellow mottle mosaic virus. Ph.D. thesis. Kyungpook National University, Daegu, Korea. Lee, H. I., Kim, J. H. and Yea, M. C Immunocapture RT-PCR for detection of seed-borne viruses on cucurbitaceae crops. Res. Plant Dis. 16: (In Korean) Lee, S. H. and Kim, C. S Natural hosts and disease cycle of Soybean yellow mottle mosaic virus. Res. Plant Dis. 19: (In Korean) Lee, Y. H., Lim, S. T., Yoon, Y. N., Jeon, M. G., Yun, H. T., Ko, J. M., Lee, S. H., Lee, K. W. and Baek, I. Y Incidence of soybean viral diseases in Korea. Korea Soybean Digest. 29: (In Korean) Lee, Y. H., Yoon, Y. N., Yun, H. T., Baek, I. Y., Lim, S., Moon, J. S. and Lee, S. H First report of Bean common mosaic virus infecting soybean in South Korea. Plant Dis. 99: Li, R. and Mock, R An imporved reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of two cherry flexiviruses in Prunus spp. J. Virol. Methods 129: Lim, S., Lee, Y. H., Igori, D., Zhao, F., Yoo, R. H., Lee, S. H., Baek, I. Y. and Moon, J. S First report of Peanut mottle virus infecting soybean in South Korea. Plant Dis. 98: Mori, Y. and Notomi, T Loop-mediated isothermal amplification (LAMP): a rapid, accurate, and cost-effective diagnostic method for infectious disease. J. Infect. Chemother. 15: Nagamine, K., Hase, T. and Notomi, T Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 16: Nam, M., Kim, S. M., Domier, L. L., Koh, S., Moon, J. K., Choi, H. S., Kim, H. G., Moon, J. S. and Lee, S. H Nucleotide sequence and genomic organization of a newly identified member of the genus Carmovirus, Soybean yellow mottle mosaic virus, from soybean. Arch. Virol. 154: Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: e63. Parida, M., Posadas, G., Inoue, S., Hasebe, F. and Morita, K Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42: Seo, J. K., Park, J. Y., Kwak, H. R., Kim, M. K., Nam, M., Lee, S. H., Kim, J. S. and Choi, H. S Severe outbreak of the emerging soybean viruses in Korea: an increasing threat. Plant Health Prog. 15: Shin, J. C., Kim, M. K., Kwak, H. R., Choi, H. S., Kim, J. S., Park, C. Y., Lee, S. H. and Cha, B. J First report of Clover yellow vein virus on Glycine max in Korea. Plant Dis. 98: Tolin, S. A. and Lacy, G. H Viral, bacterial, and phytoplasmal diseases of soybean. In: Soybean: Improvement, Production, and Uses. 3rd ed, eds. by H. R. Boerma and J. E. Specht, pp American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, Madison, WI, USA. Zhang, Z. Y., Liu, X. J., Li, D. W., Yu, J. L. and Han, C. G Rapid detection of Wheat yellow mosaic virus by reverse transcription loop-mediated isothermal amplification. Virol. J. 8: 550. Zhao, L. M., Li, G., Gao, Y., Zhu, Y. R., Liu, J. and Zhu, X. P Reverse transcription loop-mediated isothermal amplification assay for detecting Tomato chlorosis virus. J. Virol. Methods 213:
316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More information01_HM hwp
The Korean Journal of Microbiology (2011) Vol. 47, No. 2, pp. 103-109 Copyright c 2011, The Microbiological Society of Korea Loop-Mediated Isothermal Amplification (LAMP) 법을이용한 Pectobacterium carotovorum
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More informationDBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More informationDBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More informationDBPIA-NURIMEDIA
Mass-production of Four Specific Proteins Originated from Deformed Wing Virus, Honeybee-viral Pathogen Joo-seong Lee, Giang Thi Huong Luong and Byoung-Su Yoon* Department of Life Science, College of Natural
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More information<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti
식물병연구 Note Open Access Res. Plant Dis. 23(1): 69-74 (2017) https://doi.org/10.5423/rpd.2017.23.1.69 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecting Foxtail Millet (Setaria italica) in South Korea
More information1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationexample code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
More informationjaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
More informationAnalysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More information04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
More information66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,
농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More informationDBPIA-NURIMEDIA
박건수 *, 서태영 **, 김종욱 *** ". 요약 Abstract The induction melting furnace using electric generator has been introduced since 1920s, and it began to be widely applied to industrial applications due to increasing
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More information미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
More informationcdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
More informationCloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(1) : 41~50 (2016) Rapid Detection of Black Queen Cell Virus from Honeybee using Reverse Transcription Real-Time Recombinase Polymerase Amplification (RT/RT RPA)
More information원고스타일 정의
논문접수일 : 2015.01.05 심사일 : 2015.01.13 게재확정일 : 2015.01.26 유니컨셉 디자인을 활용한 보행환경 개선방안 연구 A Study on Improvement of Pedestrian Environment on to Uniconcept Design 주저자 : 김동호 디지털서울문화예술대학교 인테리어실용미술학과 교수 Kim dong-ho
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
More informationePapyrus PDF Document
육아지원연구 2008. 제 3권 1 호, 147-170 어린이집에서의 낮잠에 대한 교사와 부모의 인식 및 실제 이 슬 기(동작구 보육정보센터)* 1) 요 약 본 연구의 목적은 어린이집에서의 일과 중 낮잠 시간에 대한 교사와 부모의 인식 및 실제를 알아봄 으로써, 교사와 부모의 협력을 통해 바람직한 낮잠 시간을 모색해 보는 데 있었다. 연구 대상은 서울, 경기지역
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More information00내지1번2번
www.keit.re.kr 2011. 11 Technology Level Evaluation ABSTRACT The Technology Level Evaluation assesses the current level of industrial technological development in Korea and identifies areas that are underdeveloped
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information고품격 cdna 합성을위한 RT Kit M-MLV RTase 의 RNase H domain 에 mutation 시키므로 RNase H activity 를낮추고, mrna 의 degradation 을방지하여 cdna 합성효율을높임 d... qpcr RT Kit 의 cdn
TOYOBO 여름행사 21 행사기간ㅣ 2014 년 6 월 16 일 ~ 8 월 22 일까지 고품격 cdna 합성을위한 RT Kit 완벽한 qpcr 을위한최상의 Solution qpcr Master Mix ㅣ ReverTra Ace -a- kit ㅣ qpcr RT kit ㅣ qpcr RT Master Mix ㅣ qpcr RT Master Mix with gdna
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information07_Àü¼ºÅÂ_0922
176 177 1) 178 2) 3) 179 4) 180 5) 6) 7) 8) 9) 10) 181 11) 12) 182 13) 14) 15) 183 16) 184 185 186 17) 18) 19) 20) 21) 187 22) 23) 24) 25) 188 26) 27) 189 28) 29) 30)31) 32) 190 33) 34) 35) 36) 191 37)
More information386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information1508 고려 카달록
트레이용난연케이블의특징 0./1kV XLPE Insulated and Tray FlameRetardant PVC ed Cable (TFRCV) 0./1kV XLPE Insulated and Tray FlameRetardant PVC ed Aluminium Power Cable (TFRCV/AL) 0./1kV XLPE Insulated HalogenFree Flame
More information3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
More informationDBPIA-NURIMEDIA
논문 10-35-03-03 한국통신학회논문지 '10-03 Vol. 35 No. 3 원활한 채널 변경을 지원하는 효율적인 IPTV 채널 관리 알고리즘 준회원 주 현 철*, 정회원 송 황 준* Effective IPTV Channel Control Algorithm Supporting Smooth Channel Zapping HyunChul Joo* Associate
More informationÀ±½Â¿í Ãâ·Â
Representation, Encoding and Intermediate View Interpolation Methods for Multi-view Video Using Layered Depth Images The multi-view video is a collection of multiple videos, capturing the same scene at
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information03-16-김용일.indd
Journal of the Korean Society of Surveying, Geodesy, Photogrammetry and Cartography Vol. 33, No. 2, 95-101, 2015 http://dx.doi.org/10.7848/ksgpc.2015.33.2.95 ISSN 1598-4850(Print) ISSN 2288-260X(Online)
More information목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationDBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
More information10송동수.hwp
종량제봉투의 불법유통 방지를 위한 폐기물관리법과 조례의 개선방안* 1) 송 동 수** 차 례 Ⅰ. 머리말 Ⅱ. 종량제봉투의 개요 Ⅲ. 종량제봉투의 불법유통사례 및 방지대책 Ⅳ. 폐기물관리법의 개선방안 Ⅴ. 지방자치단체 조례의 개선방안 Ⅵ. 결론 국문초록 1995년부터 쓰레기 종량제가 시행되면서 각 지방자치단체별로 쓰레기 종량제 봉투가 제작, 판매되기 시작하였는데,
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More information00표지
09 2007 09 Vol.377 www.corrections.go.kr 004 006 004 010 032 011 022 032 036 038 041 042 044 046 050 COVER STORY 034 163 063 072 075 080 130 140 141 144 146 150 183 184 180 Monthly Correctional Review
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More information