66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,
|
|
- 새롬 이
- 6 years ago
- Views:
Transcription
1 농업생명과학연구 49(4) pp Journal of Agriculture & Life Science 49(4) pp Print ISSN Online ISSN Tomato ringspot virus 검역진단시스템개발 이시원 1 노재영 2 김재헌 2* 1 국립환경과학원환경기반연구부, 2 단국대학교미생물학과 접수일 (2015 년 5 월 14 일 ), 수정일 (2015 년 8 월 10 일 ), 게재확정일 (2015 년 8 월 4 일 ) Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine Siwon Lee 1 Jae-Young Rho 2 Jae-heon Kim * 1 Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon 22689, Korea 2 Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 31116, Korea Received: MAY , Revised: AUG , Accepted: AUG 초록 Tomato ringspot virus (ToRSV) 는 Group IV(+) sense ssrna viruses, Nepovirus 속으로분류되며식물병원성을가진국내미보고관리급검역바이러스이다. 본연구에서는우리나라검역현장에서 ToRSV 를검사하기위한 reverse transctiption(rt)-polymerase chain reaction(pcr) 과 nested PCR 진단시스템을개발하였다. ToRSV 특이적으로진단할수있는 RT-PCR 은프라이머조합 9 (F120/R20, 549 bp) 와조합 31(F60/R80, 741 bp)] 이며, 각각의 nested PCR 결과 439 와 363 bp 를증폭할수있다. 한편, 본연구에서개발한유전자변형 - 양성대조구는실험실오염으로인한거짓양성반응을확인할수있다. 본연구에서개발한 ToRSV 검역진단시스템은향후식물검역에기여할것으로기대된다. 검색어 - 검역, Nested PCR, RT-PCR, Tomato ringspot virus, ToRSV ABSTRACT Tomato ringspot virus(torsv) is a regulated plant quarantine pathogen, belongs to genus Nepovirus, group IV(+) sense ssrna viruses. In this study, reverse transctiption(rt)-polymerase chain reaction(pcr) and nested PCR for diagnostic system of detecting ToRSV is development in quarantine. Two RT-PCR primer pairs[pair 9(F120/R20, 549 bp) and pair 31(F60/R80, 741bp) are selection for detecting ToRSV, and nested PCR products are amplification 439 and 363 bp from RT-PCR primer pair 9 and 31, respectively. In addition, modified-positive control plasmid is development. It is possible to proving laboratory contamination and false positive reactions for detecting ToRSV. The diagnostic system is expected to contributing to detecting ToRSV in plant quarantine. Key words - Nested PCR, Quarantine, RT-PCR, Tomato ringspot virus, ToRSV * Corresponding author: Jae-heon Kim Tel: Fax: jaehkim1@dankook.ac.kr These authors are equally contributed to this work.
2 66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미, 유럽, 아시아, 호주및남아프리카등에서보고되고있다 (Stace-smith, 1994). 유럽지중해식물보호단체 (EPPO) 에따르면 ToRSV는매우넓은기주범위 ( 토마토, 담배, 오이, 동부, 딸기, 나무딸기, 산딸기, 구즈베리, 포도, 복숭아, 체리, 살구속, 건포도, 제라늄, 수국, 글라디올러스및미국물푸레나무등 ) 를가지고있어위험한식물병으로분류하고있다 (OEPP/EPPO, 2005). ToRSV는현재국내미보고바이러스로국내유입시재배농가에직접적및경제적피해가예상되어국내에서도관리급검역바이러스로지정되었다 (Animal, Plant and Fisheries Quarantine and Inspection Agency, 2013). 국내검역현장에서는 ToRSV를진단하기위해 enzyme-linked immunosorbent assay(elisa) 를사용하였으나거짓양성반응및낮은검출감도 (Caruso et al., 2003; Shin, 2009) 로인하여, 많은연구가수행된안정적인 polymerase chain reaction(pcr) 기반의검사방법이검토되었다 (Shin, 2009). 또한많은연구자들에의해개발된다원화된 PCR 조건을하나로맞춘검사방법및유전자를삽입한유전자변형 -양성대조구플라스미드가개발 (Lee et al., 2013 a ; Lee & Shin, 2014; Lee et al., 2014) 되어현장에적용되고있으나 ToRSV 검역진단시스템은국내에서는아직까지보고되지않은실정이다. 따라서본연구에서는검역현장에서 ToRSV를검사하기위한 reverse transctiption (RT)-PCR, nested PCR 및유전자변형 -양성대조구플라스미드를개발하였다. Ⅱ. 재료및방법 2.1 시료수집및프라이머제작 ToRSV 와유연관계가있는바이러스 6종 [Arabis mosaic virus(armv), Cherry leaf roll virus(clrv), Grapevine fanleaf virus(gflv), Raspberry ringspot virus(rprsv), Tomato black ring virus(tbrv) 및 Tobacco ringspot virus(trsv)] 과동일한숙주에감염될가능성이있는참고바이러스 6종 [Broad bean wilt virus 2(BBWV2), Bean common mosaic virus(bcmv), Tomato black ring virus(tbrv), Tobacco ringspot virus(trsv), Tomato mosaic virus Fig. 1. Primers map for specific detection of ToRSV
3 Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine 67 (ToMV) 및 Tomato spotted wilt virus(tswv)] 의 RNA 및 cdna를식물바이러스은행과농촌진흥청농업과학원등유관기관을통해수집하였으며, 또는바이러스가 spiking 되어있는이병시료를 Bi-One Co.(Korea) 를통해 Adgen Co.(UK) 에서구매하였다. 한편프라이머제작을위하여, 미국국립생물정보센터로부터 ToRSV NC_003839(7,271bp) 를포함한 ToRSV strain 11종및 Comoviridae에속하는참고바이러스 3종의염기서열을수집하였다 (data not shown). 수집한염기서열을 DNAMAN DNA analysis software package(dnaman version 6.0; Lynnon Biosoft, Canada) 를사용하여, primer annealing 및 PCR 반응조건 55 로하는국내검역바이러스검사법 (Lee et al., 2015) 과동일한방법으로 ToRSV 특이프라이머를제작하였다 (Fig. 1) 핵산추출및프라이머선발이병시료의총 RNA 추출, cdna 합성, RT-PCR 및 nested PCR의 Kit 사용, 조성및조건은모두이전에보고된식물검역바이러스 PCR 진단시스템과동일하게수행하였다 (Lee et al., 2013 b ). 또한프라이머선발은, 우선설계한 RT-PCR 프라이머를조합하여 PCR 증폭이가능한조합들을구성한후다음의선발방식을사용하였다. ⅰ) ToRSV 특이적분석을위하여, RT-PCR 프라이머조합들을대상으로 ToRSV의 RNA에특이적반응을확인하였고, ⅱ) 선발한 RT-PCR 프라이머조합을대상으로참고바이러스주 ( 유연관계및동일한숙주에감염될수있는바이러스 ) 에비특이적인반응을보이는프라이머조합을제외하였으며, ⅲ) 특이및비특이적으로선발한 RT-PCR 프라이머조합을대상으로, ToRSV RNA를 10-7 까지단계희석하여검출한계실험을수행하였다. ⅳ) 최종적으로 2개의 RT-PCR 조합을선발하였으며, 각각의 nested PCR을설계및선발하였다 (Shin & Rho, 2014; Lee et al., 2015). Fig. 2. Diagram of making for inserted positive control plasmid 2.3 유전자변형 - 양성대조구플라스미드 ToRSV 검정에양성대조구로활용될유전자변형 - 양성대조구플라스미드를제작하였다 (Fig. 2). 최종 적으로선발된 2 개의 RT-PCR 증폭영역을모두포 함하는 PCR 산물을증폭시킨후, 그것을삽입 DNA 로사용하여 pgem -T Easy Vector(Promega, USA) 에결합한뒤대장균에 transformation 하였다 (Lee & Rho, 2015). 이후선발한 2 개의 RT-PCR 프라이머조합들중검출감도가높은하나를선정하 여, 해당 nested PCR 조합의증폭영역의안쪽에 제한효소 BamHⅠ 이반응할수있는 6 개의염기서 열 (GGATCC) 삽입하였다 (Nelson & McClelland, 1992). 유전자십입은염기서열분석및 BamHⅠ 처리를 통해확인하였다. Ⅲ. 결과및고찰 3.1 RT-PCR 프라이머선발및검출감도 ToRSV 의특이적으로진단할수있는프라이머 정방향 13 개와역방향 12 개가제작되었으며 (Fig. 1), 175bp~1,197bp 의크기로 RT-PCR 증폭이가능한 55 개의조합이설계되었다 (data not shown). 총 55 개의조합을대상으로 ToRSV 의특이적분석을수
4 68 Journal of Agriculture & Life Science 49(4) Fig. 3. Specific detection of Tomato ringspot virus(torsv) by using RT-PCR Lane M, 100bp step DNA Ladder maker(genepia, Korea); lane 1-55, ToRSV specific RT-PCR primer pair number. 행한결과모든조합에서특이적밴드를형성하여 이중증폭된크기와위치를고려하여 10 개의조합 을선발하였다 (Fig. 3). 선발된 10개조합을대상으로 ToRSV의유연관계가있는바이러스 6종에비특이적선발을수행한결과조합 13, 19 및 39에서비특이적밴드가형성된반면나머지 7개의 RT-PCR 프라이머조합은비특이적밴드를형성하지않았다 (Fig. 4A). 또한선발된 7개 RT-PCR 프라이머조합을대상으로동일한숙주에감염될가능성이있는참고바이러스 6종에비특이적선발을수행한결과조합 23에서비특이적밴드가형성되어선발에서제외하였다 (Fig. 4B). 최종적으로선발된 6개의프라이머조합들중크기 ( bp) 와증폭되는부위를고려하여최종적으로 3개의프라이머조합 [ 조합 9(F120/R20, 549bp), 조합31(F60/R80, 741bp) 및조합48(F90/R48, 709bp) 을선발하였다. ToRSV 검정을위해선발된 3개의 RT-PCR 프라이머조합을대상으로검출감도를분석한결과조합 9, 31 및 48은각각 10 2, 10 4 및 10 1 의검출감도가분석되어상대적으로조합9와 31을최종 RT- (A) Fig. 4. Non-specific detection of related reference viruses (A) and host related viruses (B) by using RT-PCR Lane M, 100bp step DNA Ladder maker; lane +, positive control(torsv); lane A, Arabis mosaic virus; lane C, Cherry leaf roll virus; lane G, Grapevine fanleaf virus; lane R, Raspberry ringspot virus; lane TB, Tomato black ring virus; lane TR, Tobacco ringspot virus; BB, Broad bean wilt virus; lane BC, Bean common mosaic virus; lane TM, Tomato mosaic virus; lane TS, Tomato spotted wilt virus; dot, selective primer pair. (B)
5 Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine 69 Fig. 5. Sensitivity test of three selective RT-PCR primer pairs Lane M, 100bp step DNA Ladder maker; lane number, diluted value; lane 0, no dilution; dot, selective primer pair. PCR 프라이머조합으로선발하였다 (Fig. 5). 3.2 Nested PCR 프라이머선발 ToRSV의 nested PCR 프라이머를선발하기위하여 RT-PCR 조합9와 31로부터증폭할수있는조합 9-1(ToRSV F130/R30, 439bp), 조합9-2(ToRSV F130/R40, 389bp) 와조합31-1(ToRSV F90/R70, 363bp) 및조합31-2(ToRSV F100/R70, 312bp) 를설계하였으며, 분석결과모두특이적밴드가형성되었고강도도유사하여 (Fig. 6), 최종적으로염기서열분석시유리한크기가큰 ToRSV F130/R30 (439bp) 와 ToRSV F90/R70(363bp) 을최종 nested PCR 프라이머조합으로선발하였다. 따라서검역현장에서 ToRSV 를특이적으로진단할수있는 RT-PCR은프라이머조합9(F120/R20, 549bp) 와조합31(F60/R80, 741bp) 이며, nested PCR 결과각각 439와 363bp를증폭할수있다 (Table 1). 3.3 유전자변형 -양성대조구플라스미드검역현장에서 ToRSV를진단할때양성대조군으로활용할유전자변형 -양성대조구를제작하였다. RT-PCR 조합9와 31이포함된 F10/R20(2,474 bp) 를증폭후, 클로닝하였다 (data not shown). ToRSV 검정을위한 RT-PCR 조합9의 nested PCR 증폭부 Fig. 6. Result of nested PCR for detecting ToRSV Lane M, 100bp step DNA Ladder maker; lane 1, ToRSV-F130/R30(439bp); lane 2, ToRSV-F130/R40(389bp); lane 3, ToRSV-F90/R70(363bp); lane 4, ToRSV-F100/R70(312bp); circle, final selective nested PCR primer pair.
6 70 Journal of Agriculture & Life Science 49(4) Table 1. Information of finally selective RT-PCR and nested PCR primer pairs for detecting Tomato ringspot virus Pair No. PCR Primer Sequence Length (bp) 9 RT Nested ToRSV_F120 ToRSV_R20 ToRSV_F130 ToRSV_R30 TACCACGCCCCCTTGTA AAAATTTARCATCGGGCACATC AATTTCTATTAAGCCGGACACCA AGACCACGGCTTCCACTGAGAA RT Nested ToRSV_F80 ToRSV_R60 ToRSV_F90 ToRSV_R70 ATGGCAGCGATTTTGGTT TGGTACGGTGATGCGATAAACA TCCTTTGCTTATTGGTATGGATGT CCACGCACGATAGWATGTTC 위 (439bp) 를선정하여 BamHⅠ 이반응할수있는 6 개의염기서열을삽입하였다. 그결과 GGATCC 가 포함된총 445bp 의염기서열이분석되었으며 (Fig. 7), 또한 BamHⅠ 제한효소를처리한결과 272 와 173bp 로두개의밴드가형성 (data not shown) 되 어염기서열삽입을확인할수있었다. Fig. 7. Sequence information of modified-positive control plasmids for detecting ToRSV in quarantine
7 Lee et al: Development of Diagnostic System for Detecting Tomato ringspot virus in Quarantine ToRSV 검역본연구에서는검역현장에서 ToRSV 를신속, 정확하게진단할수있는검역진단시스템을개발하였다. 국내로 ToRSV 검사작물이유입되면식물체에서총 RNA를추출한뒤, 본연구에서개발한 RT-PCR, nested PCR 및유전자변형 -양성대조구를사용하여검사를수행한다. 만약검정에사용한유전자변형 - 양성대조구로부터실험실오염이일어나시료에서양성반응이나타난다면 RT-PCR 조합9의 nested PCR 증폭산물의염기서열분석결과인위적으로삽입한 6개의염기서열 (GGATCC) 이분석되거나 nested PCR 산물을 BamHⅠ 처리를하면두개의밴드로분리되어거짓양성반응을확인할수있다. 한편, Animal, Plant and Fisheries Quarantine and Inspection Agency(2013) 에따르면, 화물과휴대등으로국내유입되는다음의작물들에대해서 ToRSV 검사를수행한다. 나무딸기 (Rubus idaeus, Rubus occidentalis), 글라디올러스속 (Gladiolus spp.), 까치밥나무속 (Ribes spp.), 나무딸기속 (Rubus spp.), 난과 (Orchidaceae), 담배 (Nicotiana tabaccum), 딱총나무속 (Sambucus spp.), 딸기 (Fragaria ananassa), 벌노랑이 (Lotus corniculatus), 벚나무속 (Prunus spp.), 블루베리속 (Vaccinium spp.), 비취란속 (Vanda spp.), 사과나무속 (Malus spp.), 양벚 (Prunus avium, Prunus serotina), 제라늄속 (Pelargonium spp.), 토마토 (Lycopersicon esculentum) 및포도나무속 (Vitis spp.). 따라서본연구에서개발한 ToRSV 검역진단시스템은관련작물로부터신속한검정으로향후식물검역에기여할것이라고기대된다. Ⅴ. 감사의글 We are grateful to the editor for extensive comments and to two anonymous reviewers who helped to improve the manuscript. The present research was conducted with the support of Animal and Plant Quarantine Agency in 2011.» 참고문헌 Animal, Plant and Fisheries Quarantine and Inspection Agency List of plant quarantine viruses in Korea in newly revised in Res. Plant Dis. 19: Caruso P, Bertolini E, Cambra M and López MM A new and sensitive co-operational polymerase chain reaction for rapid detection of Ralstonia solanacearum in water. J. Microbiol. Methods 55: Lee S, Cha MJ, Kim SM, Heo NY, Shin YG and Lee SH Development of nucleotide primers for dignostic RT-PCR and nested PCR detection of three seed-transmitted viruses(crlv, SpLV and WClMV) in quarantine. J. Agric. & Life Sci. 48: Lee S, Kang EH, Heo NY, Kim SM, Kim YJ and Shin YG Detection of Carnation necrotic fleck vrus and Carnation ringspot virus using RT-PCR. Res. Plant Dis. 19: a. Lee S, Kang EH, Shin YG and Lee SH Development of RT-PCR and nested PCR for detecting four quarantine plant viruses belonging to Nepovirus. Res. Plant Dis. 19: b. Lee S, Lee JY, Shin YG, Lee SH and Ahn TY Development and verification of nested PCR assay for detection of Tobacco rattle virus in plant quarantine. J. Bacteriol. Virol. 45: Lee S. and Rho JY. In press. Development of a PCR diagnostic system for detecting Andean potato mottle virus associated with potato quarantine in Korea. American J. Potato Res. Lee S and Shin YG Development and practical use of RT-PCR for seed-transmitted Prune
8 72 Journal of Agriculture & Life Science 49(4) dwarf virus in Quarantine. Plant Pathol. J. 30: Nelson M and McClelland M Use of DNA methyltransferase/endonuclease enzyme combinations for megabase mapping of chromosomes. Methods Enzymol. 216: OEPP/EPPO Tomato ringspot nepovirus. Bulletin OEPP/EPPO Bulletin 35: Shin YG An advanced quarantine system for the inspection of seed-borne viruses in Korea., Ph.D. Thesis, Kyungpook National University, Daegu, Gyeongsangbuk-do, Korea. Shin YG and Rho JY Development of a PCR Diagnostic System for Iris yellow spot tospovirus in Quarantine. Plant Pathol. J. 30: Stace-smith R Tomato ringspot virus, no (no. 18 revised) in: Description of plant viruses. Commonw. Mycol. Inst. Assoc./Appl. Biol., Kew, England.
Microsoft Word - 08-안태영
Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54 Communication Development and Verification of Nested PCR Assay for Detection of Tobacco rattle
(이수헌).fm
식물병연구 Res. Plant Dis. 19(3) : 220 225 (2013) http://dx.doi.org/10.5423/rpd.2013.19.3.220 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 과 nested PCR 을이용한 Nepovirus
01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
(조인숙)-o.fm
식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
DBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 273~299 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 11 2016. 06. 24 2016. 06. 26 ABSTRACT e-
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
DBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 293~316 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2015. 12. 04 2015. 12. 24 2016. 02. 25 ABSTRACT
디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
03 장태헌.hwp
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2013 Aug.; 24(8), 772 780. http://dx.doi.org/10.5515/kjkiees.2013.24.8.772 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) HEMP
(Appexdix 신용길).fm
식물병연구 Res. Plant Dis. 19(1) : 67 75 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.067 Appendix Open Access Research in Plant Disease The Korean Society of Plant Pathology 2013 년한국식물검역바이러스목록 농림수산검역검사본부
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
example code are examined in this stage The low pressure pressurizer reactor trip module of the Plant Protection System was programmed as subject for
2003 Development of the Software Generation Method using Model Driven Software Engineering Tool,,,,, Hoon-Seon Chang, Jae-Cheon Jung, Jae-Hack Kim Hee-Hwan Han, Do-Yeon Kim, Young-Woo Chang Wang Sik, Moon
2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
DBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 1, February, 28, 2016:pp. 3~30 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 01. 08 2016. 01. 09 2016. 02. 25 ABSTRACT
(460 신용길).fm
식물병연구 Res. Plant Dis. 19(1) : 36 44 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.036 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 에의한카네이션괴저바이러스와카네이션둥근반점바이러스정밀진단
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
Cloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
미생물유래물질을이용한식물병방제용작물보호제의산업화
미생물유래물질을이용한식물병방제용작물보호제의산업화 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: A Study on Organizi
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.441-460 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.441 A Study on Organizing Software Education of Special Education Curriculum
005송영일
Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation
., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양
실험 Set Up Guide 실험주제 Real Time PCR 실험원리 Quantitative Real-Time PCR (qrt-pcr) 은 1992년에도입되어생명공학에응용되기시작하였이기술은잘알려져있는 PCR기법을개량한것이다. PCR은핵산의효소증폭을이용하며, 극히적은양의시료를대량으로증폭할수있다는장점과그과정이간단하여 Cloning, Sequencing 등의기본기술로응용되었다.
DBPIA-NURIMEDIA
e- 비즈니스연구 (The e-business Studies) Volume 17, Number 3, June, 30, 2016:pp. 93~116 ISSN 1229-9936 (Print), ISSN 2466-1716 (Online) 원고접수일심사 ( 수정 ) 게재확정일 2016. 06. 12 2016. 06. 20 2016. 06. 26 ABSTRACT e-
A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
<352E20BAAFBCF6BCB1C5C320B1E2B9FDC0BB20C0CCBFEBC7D120C7D1B1B920C7C1B7CEBEDFB1B8C0C720B5E6C1A1B0FA20BDC7C1A120BCB3B8ED28313531323231292D2DB1E8C7F5C1D62E687770>
통계연구(2015), 제20권 제3호, 71-92 변수선택 기법을 이용한 한국 프로야구의 득점과 실점 설명 1) 김혁주 2) 김예형 3) 요약 한국 프로야구에서 팀들의 득점과 실점에 영향을 미치는 요인들을 규명하기 위한 연구를 하였 다. 2007년부터 2014년까지의 정규리그 전 경기 자료를 대상으로 분석하였다. 전방선택법, 후방 소거법, 단계별 회귀법, 선택법,
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
DNA/RNA Amplification Overview AccuPower PreMix series 는세계적으로기술력을인정받은특허기술로보다경제적인가격과편리한방법으로실험할수있는제품입니다. Conventional PCR, Real-Time PCR 수행을위한 DNA ampli
DNA Amplification RNA Amplification Real-Time PCR Customized PCR DNA/RNA Amplification Phone: 1588-9788 (ext.4->2) Email: accupower-support @bioneer.co.kr DNA/RNA Amplification Overview AccuPower PreMix
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
EZ-Cloning kit
EZ TM 5 /3 RACE PCR Kit Instruction Manual Korean Ver. Kit for 10 reactions Cat.# EZ025 EZ TM 5 /3 RACE PCR Kit Table of Contents I. 제품설명... 3 II. 원리... 4 III. 제품구성... 7 IV. 염기서열정보... 8 V. 주의사항... 8 VI.
09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
DBPIA-NURIMEDIA
Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
Microsoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
식물병연구 Research Article Open Access Res. Plant Dis. 23(2): (2017) 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Sp
식물병연구 Research Article Open Access Res. Plant Dis. 23(2): 193-201 (2017) https://doi.org/10.5423/rpd.2017.23.2.193 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Specific Primer Sets for RT-PCR Detection of Major RNA
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): 178-183 (2016) http://dx.doi.org/10.5423/rpd.2016.22.3.178 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
ISO17025.PDF
ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (
2015
2015 34863 85 Tel 042 530 3548 Fax 042 530 3559 Web www djdi re kr/gfcenter/main do 2015 information Graphic Infographics Gender Sensitive 1995 2014 2013 2014 1 2013 2014 SNS SNS 1. 1 1 daejeon DEVELOPMENT
http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
DBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio
식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
<C3D6C1BE2DBDC4C7B0C0AFC5EBC7D0C8B8C1F62833322D32C8A3292E687770>
유자차 신제품에 대한 소비자 지불의사액 추정 강혜정 최지현 이기웅 유자차 신제품에 대한 소비자 지불의사액 추정 An Analysis on Estimation of Willingness to Pay for the New Products of Citrus Tea Assessed by Korean Consumers 강혜정* 최지현** 이기웅*** 1) Kang,
00.앞부분2
http://ipsi.chungbuk.ac.kr 2014 New START for CHANGE 2014 2 3 2014 2 4 5 6 Contents 3 4 5 7 65 68 71 76 80 83 09 10 13 16 19 22 25 28 31 34 37 38 42 45 48 51 55 56 59 62 87 88 91 94 97 98 101 104 108
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
, ( ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I ( ) *. ** ***
, 40 3 4 (2006 12 ) * 1) *** *** (KCGS) 2003, 2004 (CGI),. (+),.,,,.,. (endogeneity) (reverse causality),.,,,. I. 1998. 2005 12 ( ) *. ** *** 2, 40 3 4 37.2%, 20 60%. 80%..,..,.,,, (SCB),,,.,..,, /,..
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
10 이지훈KICS2015-03-068.hwp
논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
I
I II III (C B ) (C L ) (HL) Min c ij x ij f i y i i H j H i H s.t. y i 1, k K, i W k C B C L p (HL) x ij y i, i H, k K i, j W k x ij y i {0,1}, i, j H. K W k k H K i i f i i d ij i j r ij i j c ij r ij
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 26(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Dec.; 26(12), 1100 1107. http://dx.doi.org/10.5515/kjkiees.2015.26.12.1100 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]