Microsoft Word - 08-안태영
|
|
- 연희 윤
- 6 years ago
- Views:
Transcription
1 Journal of Bacteriology and Virology Vol. 45, No. 1 p Communication Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine Siwon Lee 1, Jin-Young Lee 2, Yong-Gil Shin 2, Su-Heon Lee 3* and Tae-Young Ahn 4 * 1 Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon; 2 Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon; 3 School of Applied Biosciences, Kyungpook National University, Daegu; 4 Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan, Korea Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1, bp), and set 7 ( bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years ( ). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future. Key Words: Tobacco rattle virus, Nested PCR, Quarantine INTRODUCTION 수입개방화에따라다양한종류의식물들이국내로수입되고있으며, 이에따라잠재적또는동정되지않은병원성식물바이러스들이함께유입될가능성이높아지고있다 (1). 이들은유입시막대한경제적피해를입힐가능성을가지고있어, 수출입유통시철저한관리가필요하다 (2). 우리나라에서는위험평가를통하여, 금지, 관리, 규제-비검역, 비검역및잠정규제등으로검역바이러스를지정하고있다 (3). 이중 Tobacco rattle virus (TRV) 는 Group IV positive-sense single-stranded RNA virus에속하는바이러스로, 전체핵산은 RNA 1 ( 약 7 kb) 과 RNA2 ( 약 2~4 kb) 로약 11 kb 길이로구성되며, 폭 22 nm 길이는약 190 nm 또는 50~115 nm의막대형이다. TRV 는식물병원성바이러스로주로즙액과선충에의해전염되며감자, 토마토및담배등 400여종이상의숙주를가지며자연상태에서는가지과식물, 구근류및잡초에발생할수있는관리급검역바이러스이다. 농림축산검역본부예규제107호와식물병해충정보시스템에따르면, TRV 는수입식물에서가장많은검사를수행해야하는바이러스이며, 평균검사건수는연간 4,200 Received: December 12, 2014/ Revised: February 22, 2015/ Accepted: February 27, 2015 * Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu , Korea. Phone: , Fax: , suheon@knu.ac.kr * Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan , Korea. Phone: , Fax: , ahnty@dankook.ac.kr ** The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( 54
2 Development of TRV Nested PCR Assay 55 건이다. TRV 는전세계적으로 potato (4~6), greenhouse and field specimens (7), soil (8, 9) 등다양한시료로부터의감염보고가있으며, TRV를진단하기위한 RT-PCR (4, 6, 10), multiplex PCR (5), real-time RT-PCR (8, 11), real multiplex PCR (12) 그리고 immunocapture real-time RT-PCR (9) 검사법등다양한방법이개발되었다. 그러나여러연구자들에의해개발된 PCR 검사법은적용조건이서로상이하여여러병원체를동시에검사하는검역현장에서의활용이불편하였으며, 검역병원체의양성대조구를확보하기어려워, PCR 검사시의실험오차및증폭여부를정확히판정하기어려운한계점이발견되었다 (2). 따라서본연구에서는, TRV 를신속, 정확하게진단하기위하여, 검역현장요구에부응하는검사법이자검출감도가높고많은연구로안정성이뛰어난 2단계 PCR 방법 (RT- PCR, nested PCR) 을개발하였으며, 실험실오염으로인한거짓-양성반응을판단할수있는유전자변형-양성대조구를개발하였다. 또한본연구에서개발한방법을사용하여최근 6년 ( ) 동안검역현장에서실증된실험결과를보고하고자한다. MATERIALS AND METHODS 시료수집 TRV 종특이적 primer 선발에사용할 TRV 및 10개의 참고바이러스주 [Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Potato virus Y (PVY), Ribgrass mosaic virus (RMV), Tobacco mild green mosaic virus (TMGMV), Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV) 및 Tomato spotted wilt virus (TSWV)] 이병시료, RNA 또는 cdna는금지품수입허가를통하여구매 (Adgen, England; Bione, Korea) 또는농촌진흥청농업과학원등의유관기관에서협조를받아서분석에사용하였다. Primer 설계 TRV 종특이적인진단용 primer 설계하기위하여, TRV RNA1을코딩하는염기서열 (AF314165, AF406990, AF , X06172, D00155, AF 및 AJ586803) 과참고바이러스주 Pepper ringspot virus strain CAM (L23972) 과 Pea early-browing virus strain SP5 (X14006) 의유전자염기서열을 National center for biotechnology information (NCBI) 로부터확보하였다. Primer 제작은이전에기술되었던방법 (3) 과동일하게 DNAMAN software package version 6.0 (Lynnon Biosoft, Canada) 을사용하여종특이적인염기서열을탐색하였다. 핵산추출및 primer 선발시료에서 RNA 추출, one step RT-PCR, nested PCR, 전기 Figure 1. Map of primer design for detection of TRV
3 56 S Lee, et al. Table 1. RT-PCR amplification sets and product size for the detection of TRV Set Forward primer (location) Reverse primer (location) Product size (bp) 1 TRV-N50 (6,233~6,257) TRV-C10 (6,572~6,593) TRV-N40 (4,998~5,021) TRV-C20 (5,246~5,270) TRV-N30 (4,540~4,561) TRV-C20 (5,246~5,270) TRV-N30 (4,540~4,561) TRV-C30 (4,995~5,019) TRV-N20 (2,782~2,805) TRV-C40 (3,857~3,877) 1,096 6 TRV-N10 (1,459~1,481) TRV-C50 (2,459~2,477) 1,019 7 TRV-N10 (1,459~1,481) TRV-C60 (2,314~2,338) 880 A B Figure 2. Results of selection of TRV RT-PCR primer sets. Panel (A), First selection of specific RT-PCR primer sets for the detection of TRV. M, 100 bp step DNA Ladder maker (Genepia, Korea); dot, selected PCR primer set; Lane number, primer set for detection of TRV. Panel (B), Second selection of specific RT-PCR primer sets for the detection of TRV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane AM, Alfalfa mosaic virus; lane Ar, Arabis mosaic virus; lane CM, Cucumber mosaic virus; lane Pe, Pepper mottle virus; lane PY, Potato virus Y; lane RM, Ribgrass mosaic virus; lane TG, Tobacco mild-green mosaic virus; lane TM, Tobacco mosaic virus; lane To, Tomato mosaic virus; lane TS, Tomato spotted wilt virus.
4 Development of TRV Nested PCR Assay 57 Table 2. Final selection of RT-PCR and nested primer sets for the detection of TRV Primer Sequence (5' 3') Product size (bp) Set 5 TRV-N20 CGCGGTCGAAAGGATGAGTGATTA TRV-C40 TCCCGGAAACAAAGCGTCGTA 1,096 Nested primer of set 5 TR-N22 GTAAGTCGACAATGATTGTC TR-C45 GAAGGAAAGTTATGTACTGAG 543 Set 7 TRV-N10 GGCCGTGAAGAACAAGCAAAGTG TRV-C60 TTGTACCGCTTGTTTCCCCTCTT 880 Nested primer of set 7 TR-N11 GATTCTCGAGATTTACAGTTG TR-C62 TGCTCCATGATCTCCTCATC 760 Figure 3. RT-PCR sensitivity test on the selective primer sets for TRV. 영동및특이적 primer 선발방법은이전에수행했던방법과동일한방법을사용하였으며 (3), 검출감도를검정하기위하여 TRV RNA를 10-8 까지 10배단계희석하여분석에사용하였다. 유전자변형-양성대조구제작검역현장에서사용할수있는 PCR 진단시스템을개발을위한 TRV 유전자변형- 양성대조구플라스미드를제작하기위하여, pgem -T easy vector (Promega, USA) 와 sitedirected mutagenesis kit (Enzynomics, Korea) 를사용하였다 (13). 현장검증 본연구에서개발한 RT-PCR, nested PCR 및유전자변형 -양성대조구등의진단시스템을사용하여, TRV 와관련된수입작물 (14) 에서 2009년부터 2014년까지 6년간검사를수행하였다. 검사에대한기록은농림축산검역본부병해충정보시스템을통해확인하였다. Figure 4. Result of selected RT-PCR and nested-pcr products for the detection of TRV. Lane M, 100 bp step DNA Ladder; lane 1, final selected primer set #5 (1,096 bp); lane 2, nested-pcr product from primer set #5 (543 bp); lane 3, final selected primer set #7 (880 bp); lane 4, nested-pcr product from primer set #7 (760 bp).
5 58 S Lee, et al. RESULTS AND DISCUSSION TRV 를특이적으로검출하기위한 primer는총 12개 ( 정방향 7개, 역방향 8개 ) 를제작하였고 (Fig. 1), 제작된 primer 들을조합하여 273~1,096 bp 크기의 PCR 산물로증폭이가능한 7개의조합을구성하였다 (Table 1). TRV 주형 RNA 및참고바이러스주들의총핵산의최초농도는약 20~ 500 ng/μl였다. TRV 를주형으로한종특이적실험결과, 7개조합중반응강도가뛰어나고진단에장해가되는 비특이적반응을보이지않는 6개의조합을선발하였다 (Fig. 2A). 1차로선발된 6개 primer 조합으로 TRV 유연관계바이러스또는기주식물과관련된 10가지바이러스와의특이적반응을보이지않는조합 5 (1,096 bp) 와조합 7 (878 bp) (Fig. 2B) 을최종선발하였으며 (Table 2), 최종선발한두조합의검출감도를실험한결과각각 10-2 와 10-4 으로분석되어 (Fig. 3), TRV 를검출하기에적합한 primer 조합으로확인되었다. 또한, 최종선발된 TRV RT-PCR 조합 5의 nested PCR primer는 540 bp를조합 7의 nested PCR primer는 756 bp 크기의 PCR 산물을각각증 Figure 5. BamH I sequence insertion of the TRV genetically modified-positive control plasmids.
6 Development of TRV Nested PCR Assay 59 Table 3. Results of detection for TRV from plant quarantine sites in Year (number of detection) Item Total Bulb (119 cases) Gladiolus 5 5 Nectaroscordum 1 1 Dahlia 1 1 Leucocoryne Ranunculus 1 1 Garlic 1 1 Druce 1 1 Poison 1 1 Lily Narcissus Snowflake 1 1 Anemone Amaryllis 1 1 Iris 1 1 Alium Alstromeria 1 1 Ornithogalum 1 1 Orange Daylily 1 1 Calochortus 1 1 Crocus Tulip 3 3 Puschkinia 1 1 Ornamental Plants Etc Hemerocalis 1 1 Hyacinth Seed (16 cases) Hot pepper Iceland Poppy Tomato Paprika Etc. (1 case) Shallot 1 1 Total
7 60 S Lee, et al. 폭하였다 (Fig. 4 and Table 2). 본연구에서개발한 TRV 종특이적 primer 조합은 TRV strain ppk20 RNA1 (NCBI accession number AF314165) 을기준으로조합 5 (location 2,782~3,877) 와조합 7 (location 1,459~2,336) 로, 이것을증폭하는산물을얻기가어려워조합 5와 7에대한각각의유전자변형-양성대조구플라스미드를개발하였다. 그결과, 조합 5는염기서열 'GGA' 를, 조합 7은염기서열 'GG' 가삽입된것이분석되어 nested PCR 증폭산물부위에제한효소 site (BamH I; GGATCC) 를삽입이확인되었다 (Fig. 5). 따라서양성대조구로부터오염이있을경우다음의 2가지증상이나타날것이라고예상된다 ; i) 각각의 nested PCR 산물에서제한효소 BamH I가반응하면조합 5는 362와 561 bp 크기의, 조합 7은 364, 396 bp 크기의 PCR 산물이생산되어각각 2개씩의밴드가관찰될것이고, ii) nested PCR 산물의염기서열을 multiple sequence alignment하면조합 5와 7에서는삽입한각각 3개와 2개의염기서열이추가로분석될것이다 (Supplementary Fig. S4). TRV는국내에서는농림축산검역본부예규제 107호에의거하여다음의다양한수입종자및식물로부터검사를수행한다 ; 종자류 [ 감자 (Solanum tuberosum), 고추 (Capsicum annuum)( 파프리카포함 ), 사탕무 (Beta vulgaris var. saccharifera), 양귀비 (Papaver rhoeas), 토마토 (Lycopersicon esculentum), 팬지 (Viola tricolor var. hortensis)], 식물류 [ 감자 (Solanum tuberosum), 강낭콩 (Phaseolus vulgaris), 고추 (Capsicum annuum)( 파프리카포함 ), 글라디올러스속 (Gladiolus spp.), 다알리아속 (Dahlia spp.), 담배 (Nicotiana tabaccum), 라넌큘러스구근 (Ranunculus repens), 류코코리네속 (Leucocoryne spp.), 배추속 (Brassica spp.), 백합속 (Lilium spp.), 사탕무 (Beta vulgaris), 상추 (Lactuca sativa), 수선화속 (Narcissus spp.), 스노우드롭구근 (Galanthus nivalis), 시클라멘속 (Cyclamen spp.), 아네모네속 (Anemone spp.), 아이리스속 (Iris spp.), 아티초크 (Cynara cardunculus), 알리움속 (Allium spp.), 알스트로메리아속 (Alstromeria spp.), 옥잠화속 (Hosta spp.), 이키시아속 (Ixia spp.), 칼라속 (Zantedeschia spp.), 쿠르쿠마속 (Curcuma spp.), 크로커스속 (Crocus spp.), 토마토 (Lycopersicon esculentum), 튤립속 (Tulipa spp.), 팬지 (Viola tricolor), 풀협죽도속 (Phlox spp.), 프리지아속 (Freesia spp.), 호밀 (Secale cereale) 및히야신스구근 (Hyacinthus orientalis). 농림축산검역본부인트라넷인병해충정보시스템에의하면, TRV 는최근 6년 ( ) 동안약 133종류의작물 로부터약 23,000건의검사가수행되었다. 이중검출건수는총 83건으로, 우리나라식물검역바이러스 100종 (14) 중 Cucumber green mottle mosaic virus에이어 2번째로많은검출이분석되고있는것으로확인되었다. 연도별검출경향을살펴보면, TRV 는 2009년 9건, 2010년 19건, 2011년 3건, 2012년 14건, 2013년에 28건및 2014년 63건으로검출이증가하는추세가분석된다. 또한최근 6년간수선구근 (38건), 알리움구근 (18건), 아네모네구근 (15건) 및히야신스구근 (9건) 등구근류 119건으로 TRV 검출이높았으며, 종자 16건및기타 ( 종구용쪽파 1건 ) 으로총 136건이었다 (Table 3). 식물검역에사용하는검사법개발에는첨단검사법을활용한정밀성확보와함께검사의용이성과검사법개발의표준화가매우중요하며, 대량수입검역검사에반드시필요한편의성과검사결과에대한진위여부를검증할수있는시스템이포함하여야한다 (15). 본연구에서개발한 TRV 검역진단시스템은, 앞서보고된방법 (1~3, 16) 들과함께향후식물검역에기여할것이라고기대된다. REFERENCES 1) Lee S, Kang EH, Heo NY, Kim SM, Kim YJ, Shin YG. Detection of Carnation necrotic fleck virus and Carnation ringspot virus using RT-PCR. Res Plant Dis 2013;19: ) Lee S, Kang EH, Chu YM, Shin YG, Ahn TY. Development of PCR diagnosis system for plant quarantine seed-borne Wheat streak mosaic virus. Korean J Microbiol 2013;49: ) Lee S, Shin YG. Development and practical use of RT-PCR for seed-transmitted Prune dwarf virus in quarantine. Plant Pathol J 2014;30: ) Nicolaisen M, Bösze Z, Nielsen SL. Detection of Tobacco rattle virus in potato tubers using a simple RT-PCR procedure. Potato Research 1999;42: ) Wei T, Lu G, Clover GRG. A multiplex RT-PCR for the detection of Potato yellow vein virus, Tobacco rattle virus and Tomato infectious chlorosis virus in potato with a plant internal amplification control. Plant Pathology 2009;58: ) Pérez EE, Weingartner DP, Hiebert E, McSorley R. Tobacco rattle virus detection in potato tubers from northeast Florida by PCR and tissue blotting. Amer J of Potato Res 2012;77: ) Riga E, Larsen R, Eastwell K, Guerra N, Guerra L, Crosslin JM.
8 Development of TRV Nested PCR Assay 61 Rapid detection of Tobacco rattle tobravirus in Viruliferous paratrichodorus allius from greenhouse and field specimens. J Nematol 2009;41: ) Kenyon DM, Handy CL, Thomas JE. Detection of Tobacco rattle virus in soil using real-time PCR. Aspects of Applied Biology 2005;76: ) Yang JG, Wang FL, Chen DX, Shen LL, Qian YM, Liang ZY, et al. Development of a one-step immunocapture real-time RT-PCR assay for detection of Tobacco mosaic virus in soil. Sensors 2012;12: ) Xu H, Nie J. Molecular detection and identification of potato isolates of Tobacco rattle virus. Canadian J Plant Pathol 2006; 28: ) Holeva R, Phillips MS, Neilson R, Brown DJF, Young V, Boutsika K, et al. Real-time PCR detection and quantification of vector trichodorid nematodes and Tobacco rattle virus. Mol Cell Probes 2006;20: ) Mumford RA, Walsh K, Barker I, Boonham N. Detection of Potato mop top virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-transcription polymerase chain reaction assay. Phytopathology 2000;90: ) Shin YG, Rho JY. Development of a PCR diagnostic system for Iris yellow spot tospovirus in quarantine. Plant Pathol J 2014;30: ) Animal, Plant and Fisheries Quarantine and Inspection Agency. List of plant quarantine viruses in Korea newly revised in Res Plant Dis 2013;19: ) Shin YG. An advanced quarantine system for the inspection of seed-borne viruses in Korea ) Lee S, Kang EH, Shin YG, Lee SH. Development of RT-PCR and nested PCR for detecting four quarantine plant viruses belonging to Nepovirus. Res Plant Dis 2013;19:220-5.
66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,
농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More information(Appexdix 신용길).fm
식물병연구 Res. Plant Dis. 19(1) : 67 75 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.067 Appendix Open Access Research in Plant Disease The Korean Society of Plant Pathology 2013 년한국식물검역바이러스목록 농림수산검역검사본부
More information°Ç°�°úÁúº´6-2È£
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More information(이수헌).fm
식물병연구 Res. Plant Dis. 19(3) : 220 225 (2013) http://dx.doi.org/10.5423/rpd.2013.19.3.220 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology RT-PCR 과 nested PCR 을이용한 Nepovirus
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
More informationK O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis
More informationJournal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways
Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More informationDevelopment of culture technic for practical cultivation under structure in Gastrodia elate Blume
Development of culture technic for practical cultivation under structure in Gastrodia elate Blume 1996. : 1. 8 2. 1 1998. 12. : : ( ) : . 1998. 12 : : : : : : : : : : - 1 - .. 1.... 2.. 3.... 1..,,.,,
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information2014_........pdf
1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R
식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More information식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio
식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *
More information16-15(3)-07(최장경).fm
Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,
More information1_수시-최종-면지화보 복사.ps, page Normalize
Discoveryof New Possibilities Researchfor Innovation and Practical Use ExcellenceThrough Hard Work and Creativity Ambitionto Change the World Moving Forward Into the Future 배움이 다시 가르침이 되기까지 우리는 멈추지 않을
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
More information..........5-45..
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals
More information27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
More information국립국어원 20010-00-00 발간등록번호 00-000000-000000-00 국어정책 통계 조사 및 통계 연보 작성 연구책임자 이순영 제 출 문 국립국어원장 귀하 국어정책 통계 조사 및 통계 연보 작성 에 관하여 귀 원과 체결한 연 구 용역 계약에 의하여 연구 보고서를 작성하여 제출합니다. 2010년 12월 2일 연구책임자: 이순영(고려대학교 국어교육과)
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More information09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More informationECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
More information10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
More information<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
More information03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information<31335FB1C7B0E6C7CABFDC2E687770>
에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.
More information°Ç°�°úÁúº´5-44È£ÃÖÁ¾
K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 44 www.cdc.go.kr/phwr 2012 11 2 5 44 ISSN:2005-811X Vector surveillance after elimination of lymphatic filariasis
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information10 이지훈KICS2015-03-068.hwp
논문 15-40-05-10 The Journal of Korean Institute of Communications and Information Sciences '15-05 Vol.40 No.05 http://dx.doi.org/10.7840/kics.2015.40.5.851 가로등 인프라를 활용한 안전한 스마트 방범 시스템 차 정 화, 이 주 용 *, 이
More information<313430333033C6AFC1FD28C3E0B1B8292E687770>
스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information식물병연구 Research Article Open Access Res. Plant Dis. 23(2): (2017) 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Sp
식물병연구 Research Article Open Access Res. Plant Dis. 23(2): 193-201 (2017) https://doi.org/10.5423/rpd.2017.23.2.193 국내의토마토주요바이러스진단을위한역전사중합반응법용프라이머세트 Specific Primer Sets for RT-PCR Detection of Major RNA
More information04 형사판례연구 19-3-1.hwp
2010년도 형법판례 회고 645 2010년도 형법판례 회고 2)오 영 근* Ⅰ. 서설 2010. 1. 1.에서 2010. 12. 31.까지 대법원 법률종합정보 사이트 1) 에 게재된 형법 및 형사소송법 판례는 모두 286건이다. 이 중에는 2건의 전원합의체 판결 및 2건의 전원합의체 결정이 있다. 2건의 전원합의체 결정은 형사소송법에 관한 것이고, 2건의
More information<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
More information54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
More information식물병연구 Note Open Access Res. Plant Dis. 20(4) : (2014) Brugmansia mosaic virus Characterization of B
식물병연구 Note Open Access Res. Plant Dis. 20(4) : 307-313(2014) http://dx.doi.org/10.5423/rpd.2014.20.4.307 Brugmansia mosaic virus Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp.
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: NCS : * A Study on
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.157-176 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.157 NCS : * A Study on the NCS Learning Module Problem Analysis and Effective
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information(specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements) 11 (location selection) 12 (storage bin) 12 (i
SERVICE MANUAL N200M / N300M / N500M ( : R22) e-mail : jhyun00@koreacom homepage : http://wwwicematiccokr (specifications) 3 ~ 10 (introduction) 11 (storage bin) 11 (legs) 11 (important operating requirements)
More information(Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection)
SERVICE MANUAL (Table of Contents) 2 (Specifications) 3 ~ 10 (Introduction) 11 (Storage Bins) 11 (Legs) 11 (Important Operating Requirements) 11 (Location Selection) 12 (Storage Bins) 12 (Ice Machine)
More information,.,..,....,, Abstract The importance of integrated design which tries to i
- - The Brand Touchpoint Analysis through Corporate Identity Typeface of Mobile Telecommunication Companies - Focusing on and - : Lee, Ka Young Dept. Lifestyle Design, Dankook University : Kim, Ji In Dept.
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More information00º½Çмú-¾Õ
547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President
More informationKor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on
More information<28C3D6C1BE29312DC0CCBDC2BEC62E687770>
한국패션디자인학회지 제9권3호 The Korean Society of Fashion Design Vol. 9 No. 3 (2009) pp.1~12 소니아 리키엘 컬렉션에 나타난 니트웨어 색채 특성 The Color Characteristics of Knit Wear Shown in Sonia Rykiel s Collections 이 승 아ㆍ조 주 연ㆍ이 연
More information2019_2nd_guide_kr_0619.indd
CONTENTS 2019 Good Design Award 2 2 2 2 01 02 04 05 06 08 GOOD DESIGN AWARD 2019 Schedule Entry First screening period April 3 Open for Entries May 23 Entry Deadline / Due Date of submission for Application
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information(481-최홍수).fm
식물병연구 Res. Plant Dis. 18(4) : 277 289 (2012) http://dx.doi.org/10.5423/rpd.2012.18.4.277 Research Article Open Access Research in Plant Disease The Korean Society of Plant Pathology 2007 2011 우리나라농업현장임상진단요청작물의바이러스감염특성
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More information<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
More information< D C8ABBFB5C1D828B1E8B9CEB1E2292E687770>
임상검사와정도관리 : 제 3 권제 2 호 2009 J Lab Med Qual Assur 2009; 3:275-9 275 SLAN real-time PCR 장비를이용한 Artus HBV LC PCR kit 의평가 김민기 이동영 장윤환 이진경 홍석일 홍영준 원자력병원진단검사의학과 Evaluation of Artus HBV LC PCR kit using SLAN
More informationKor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: A Study on Organizi
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.441-460 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.441 A Study on Organizing Software Education of Special Education Curriculum
More information(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
More information식물병연구 Research Article Open Access Res. Plant Dis. 22(3): (2016) 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Rev
식물병연구 Research Article Open Access Res. Plant Dis. 22(3): 178-183 (2016) http://dx.doi.org/10.5423/rpd.2016.22.3.178 콩황화모틀모자이크바이러스의신속검출을위한역전사등온증폭법 Reverse Transcription Loop-Mediated Isothermal Amplification
More information16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationDBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
More information폐비닐수거기-김태욱.hwp
, 11, 1, pp. 113-118 (2012. 2) Journal of the Korean Society of Manufacturing Process Engineers, Vol. 11, No. 1, pp. 113-118 (2012. 2) Twist Wheel 방식폐비닐수거기개발에관한연구 (Ⅰ) - 자주형비닐수거기의개발 - 하유신 *, 박규식 *, 김진현
More informationuntitled
대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea
More information14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
More information강의지침서 작성 양식
정보화사회와 법 강의지침서 1. 교과목 정보 교과목명 학점 이론 시간 실습 학점(등급제, P/NP) 비고 (예:팀티칭) 국문 정보화사회와 법 영문 Information Society and Law 3 3 등급제 구분 대학 및 기관 학부(과) 전공 성명 작성 책임교수 법학전문대학원 법학과 최우용 2. 교과목 개요 구분 교과목 개요 국문 - 정보의 디지털화와 PC,
More information