식물병연구 Note Open Access Res. Plant Dis. 20(4) : (2014) Brugmansia mosaic virus Characterization of B

Size: px
Start display at page:

Download "식물병연구 Note Open Access Res. Plant Dis. 20(4) : (2014) Brugmansia mosaic virus Characterization of B"

Transcription

1 식물병연구 Note Open Access Res. Plant Dis. 20(4) : (2014) Brugmansia mosaic virus Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp. in Korea ,6 5,6 1,2 * 1, 2, 3, 4, 5 (UST), 6 Chung Youl Park 1, Bong-Sub Kim 1, Moon Nam 1, Min-A Lee 1, Da-Som Baek 1, Yang Su Bae 1, Eun-Hye Park 1, Jeong-Sun Kim 3, Jong-Yoon Choi 4, Seungmo Lim 5,6, Jae Sun Moon 5,6 and Su-Heon Lee 1,2 * *Corresponding author Tel : Fax: suheon@knu.ac.kr 1 School of Applied Biosciences, Kyungpook National University, Daegu , Korea 2 Institute of Plant Medicine, Kyungpook National University, Daegu , Korea 3 Agricultural Microbiology Division, National Academy of Agricultural Science, Rural Development Administration, Wanju , Korea 4 Apple Research Station, National Institute of Horticultural & Herbal Science, Gunwi , Korea 5 Biosystems and Bioengineering Program, University of Science and Technology (UST), Daejeon , Korea 6 Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon , Korea Received October 28, 2014 Revised November 25, 2014 Accepted December 3, 2014 In May 2013, an angel s trumpet leaves showing mosaic and malformation symptoms were collected from Suwon city, Gyeonggi-do. An analysis of the collected sample by transmission electron microscopy observation showed filamentous rod particles of nm in length. On the basis of the these observations, we performed PCR against three reported Potyviruses (Brugmansia mosaic virus, Colombian datura virus and Brugmansia suaveolens mottle virus), and the sample was positive for BruMV. Pathogenicity and host range test of BruMV was determined by mechanical inoculation. Solanaceae (tobacco, tomato and eggplant) and Amaranthaceae (ground cherry) appeared typical virus symptoms. To determine coat protein of this virus, we designed specific primer pairs, and performed PCR amplification, cloning, and sequencing. Phylogenetic analysis showed that BruMV-SW was most closely related to BruMV isolate SK. Comparison of the BruMV-SW coat protein nucleotide sequences showed 92% to 99% identities to the other BruMV isolates. Keywords : Angel s trumpet, Bioassay, Brugmansia, Potyvirus Research in Plant Disease The Korean Society of Plant Pathology pissn , eissn This is an open access article distributed under the terms of the Creative Commons Attribution License ( which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 308 (Brugmansia spp.) (Angel s trumpet), (Chellemi, 2011; Lucinda, 2010).,,,, 7 (Brugmansia arborea, Brugmansia aurea, Brugmansia insignis, Brugmansia sanguinea, Brugmansia suaveolens, Brugmansia versicolor, Brugmansia vulcanicola) (Bailey Bailey, 1976; Chellemi, 2011).,, 200 (Vernon, 2013)., (atropine), (scopolamine), (alkaloid),, (Bristol, 1969; Evans Lampard, 1972)., (Parkinson s disease), (Caridac problems) (Lorenzi Souza, 2001). (species) 5, Brugmansia mild mottle virus(brmmv, Tobamovirus) (Ilmberger, 2007), Colombian datura virus(cdv, Potyvirus) (Salamon Palkovics, 2005), Brugmansia suaveolens mottle virus(bsmov, Potyvirus)(Lucinda, 2008), Brugmansia mosaic virus(brumv, Potyvirus)(Damsteegt, 2013), Tomato spotted wilt virus(tswv, Tospovirus)(Nikolić, 2013), BruMV(Fumei, 2013) TSWV(Choi, 2014) 2. BruMV, (Fumei, 2013). BruMV 2013,., BruMV (Fig. 1), BruMV, BruMV-SW,. 전자현미경검경. (direct negative staining) (Horne Wildy, 1963). (potassium phosphate buffer, ph 7.0). (Formvar film) grid(200 mesh) 1 30, 2.5% phosphotungstic acid(pta, ph 7.2) 1 l 2 Fig. 1. Symptoms caused by Brugmansia mosaic virus isolate SW (BruMV-SW) in the greenhouse. A: Brugmansia sp. plant showed mosaic, malformation (turtle-shape), B: Enlarge of A, C: Enlarge of B.

3 309 제거하고 투과전자현미경(CARL ZEISS LE0912AB, Germany)으 로 관찰하였다. 기주범위 및 병원성 분석. 병원성 검정과 기주범위 결정을 위하여 감염된 브루그만시아 잎 조직에 100배(W/V)의 0.01 M 인 산칼륨완충액을 첨가하여 마쇄한 뒤 silicon carbide(400 mesh; Sigma-Aldrich, USA)를 사용하여 즙액접종하였다. 지표식물은 7과 33종을 사용하여 3반복 수행한 후, 8주간 접종엽과 상엽, 줄 기에서의 병징을 관찰하였다. 또한, 감염은 되었으나 병징 발현 이 되지 않는 식물체를 고려하여 생물검정에 이용한 모든 지표 식물에 대하여 RT-PCR 검정을 실시하였다. cdna 합성 및 PCR 진단. 채집된 시료의 종 동정을 위하여 병 징이 강하게 나타난 브루그만시아 잎으로부터 전체 RNA(Total RNA)를 추출하였다. 전체 RNA는 TRI Reagent(Molecular Research Center, USA)를 이용하여 공급사의 매뉴얼에 따라 50 μl를 추출하였다. 추출한 전체 RNA는 RN25(5 -NNN NNN NNN NNN NNN NNN NNN NNN N-3 ) 프라이머와 TOPscript Reverse Transcriptase(Enzynomics, Korea)를 사용하여 cdna를 합성한 뒤 PCR 증폭의 주형(Template)으로 사용하였다. PCR 증폭은 BsMoV, BruMV, CDV 3종에 대한 특이적 프라이머(Table 1) 를 이용하여 Lim 등(2014)의 방법을 이용하였다. 외피단백질 유전자 염기서열 분석. 외피단백질 영역을 증 폭하기 위하여 NCBI Genbank에 등록되어 있는 BruMV 2개의 분리주(Genbank accession no. NC020105, JX874139)의 공통 된 염기서열로부터 특이적 프라이머를(BruM-CP-F: 5 -CTG AGC TTG CAC TGA AGA-3 & BruMV-CP-R: 5 -GAT TTG GCA TCA GAA GGG-3 ) 설계하였다. 염기서열 결정은 설계된 프라이머를 이용하여 증폭된 PCR 산물 1,182 bp를 정제 후 이 등(2010)의 방법으로 클로닝을 수행한 뒤 솔젠트(SolGent, Korea)에 염기서 열 결정을 의뢰하였다. 결정된 염기서열은 DNAMAN 7.0(Lynnon Biosoft, Canada) 프로그램을 이용하여 유연관계 분석을 실시하 였다. 채집한 시료 1주를 전자현미경으로 검경한 결과, nm 길이의 사상형 입자가 관찰되었다(Fig. 2). 이를 토대로 본 시료 에 감염된 바이러스는 Potyvirus 속의 종으로 사료되어 진단용 프라이머를 이용하여 3종의 기보고 바이러스에 대하여 PCR을 수행한 결과, BruMV로 진단되었다. BruMV에 감염된 브루그만시아 잎 조직을 마쇄하여 추출한 즙액을 접종원으로 사용하여 7과 33종 지표식물에 기계적 접 종하여 병원성과 기주범위를 확인하였다. 생물검정 결과 Petunia hybrida를 포함한 9종의 담배에서 국부감염 되었으며, 천일홍 (Gomphrena globosa)을 포함한 17종의 지표식물에서 전신감 염을 확인하였다. 비름과(Amaranthaceae) 속의 천일홍의 경우 무병징(symptomless)을 나타냈고, RT-PCR을 이용하여 진단한 결과 최종 감염을 확인하였다. 농업적으로 중요한 작물 중 하나 인 토마토(Lycopersicon esculentum)와 가지(Solanum melongena) Table 1. Primer names, oligonucleotide sequences and expected sizes of primer sets used in PCR reactions Primer name Primer sequences (5 3 ) BruMV-F GAGGTAATGGCAGAATTGC BruMV-R AATGCCATGTCATGGATGCTT CDV-F GGGAGAGCTCCTTACCTAGC CDV-R CCATGTATGTTTGGTGATGTACC BsMoV-F TGGAGTATGGACAATGATGGA BsMoV-R ATATCGTCAGGAGCGGTCTT Expected size (bp) Reference 1,679 Fumai et al Chellemi et al Lucinda et al Fig. 2. Particles of Brugmansia mosaic virus (BruMV) isolate SW in Brugmansia sp. naturally infected. A, B, C; filamentous rod shape virions are present in direct negatively strained with phosphotungstic acid (PTA) from symptomatic leaf tissue and analyzed by an electron microscopy (EM). Scale bar represents 200 nm.

4 310 Fig. 3. Symptoms produced on test plants infected with Brugmansia mosaic virus isolate SW (BruMV-SW). A: Petunia hybrida - mosaic and necrotic spots, B: Nicotiana glutinosa - mosaic, C: N. rustica - severe mosaic; D: N. tabacum cv. Samsun - mosaic and necrotic ring spots; E: N. tabacum cv. Xanthi NC - mosaic and necrotic spots; F: N. tabacum cv. Xanthi - mosaic and necrotic spots; G: N. tabacum cv. Bright yellow - chlorosis spots, H: N. benthamiana - chlorosis and yellowing; I: N. occidentalis - necrosis; J: Lycopersicon esculentum - mosaic; K: Solanum melongena - necrotic spots, L: Physalis floridana - mosaic. (mosaic) (necrotic spot). Nicotiana benthamiana 14 (chlorosis), (yellowing). N. clevelandii N. occidentalis 7 (necrosis), N. glutinosa N. rustica (Fig. 3). (Solanaceae) (Capsicum annuum) (Datura stramonium)., (Chenopodiaceae) (Chenopodium amaranticolor) (C. quinoa), (Aizoaceae) (Tetragonia tetragonoides). (Cucurbitaceae) (Cucumis melo var. makuwa), (Citrullus vulgaris), (Cucumis sativus), (Lagenaria leucantha), (Cucurbita pepo), (Cucumis melo), (Brassicaceae) (Brassica juncea), (Leguminosae) (Phaseolus vulgaris), (Pisum sativum), (Vigna unguiculata), (Phaseolus angularis) 14. RT-PCR (Table 2). PCR,, 1,182 (nucleotide, nt). NCBI BLAST, NCBI (GenBank accession no. AB851482). NCBI GenBank Potyvirus 19, BruMV SK (Fig. 4). DNA- MAN Observed Divergency SK 99%

5 311 Table 2. Host range and symptoms of Brugmansia mosaic virus isolate SW Family Species Symptoms a RT-PCR detection b Solanaceae Capsicum annuum -/- - Datura stramonium -/- - Solanum melongena -/NS o Physalis floridana -/M o Lycopersicon esculentum -/M o Lycopersicon esculentum Mill -/M o Petunia hybrida LLc/M,NS o Nicotiana benthamiana -/Chl, Y o N. clevelandii -/M,N o N. debneyii LLn/M,NS o N. glutinosa LLn/M o N. occidentalis LLn/N o N. rustica -/M o N. tabacum cv. KY57 LLn/CS o N. tabacum cv. Bright yellow LLn/CS o N. tabacum cv. Samsun LLn/M,RSn o N. tabacum cv. Xanthi nc LLn/M,NS o N. tabacum var.turkish LLn/M o Amaranthaceae Gomphrena globosa -/S o Chenopodiaceae Chenopodium amaranticolor -/- - Chenopodium quinoa -/- - Cucurbitaceae Cucumis melon -/- - Citrullus vulgaris -/- - Lagenaria leucantha -/- - Cucumis sativus -/- - Cucurbita pepo -/- - Cucumis melo -/- - Aizoaceae Tetragonia tetragonoides -/- - Brassicaceae Brassica juncea -/- - Leguminosae Phaseolus vulgaris -/- - Vigna unguiculata -/- - Pisum sativum -/- - Phaseolus angularis -/- - a Inoculation leaf/upper leaf. Chl, Chlorosis; CS, Chlorotic spot; LLc, Chlorotic local lesion; LLn, Necrotic local lesion; M, Mosaic; N, Necrosis; NS, Necrotic spot; Necrotic ring spot, Rsn; S, Symptomless; Y, Yellowing. b ( ): Positive reaction, (-): negative reaction., D %. BruMV SW SK. BruMV 7 RT-PCR ( )., BruMV,,.,

6 312 Fig. 4. Phylogenetic tree calculated from the nucleotide (A) and amino acid (B) sequences of the coat protein of BruMV-SW and published species of the 19 Potyviruses. The abbreviations of virus names and GenBank accession number used in the phylogenetic tree analysis: Pepper mottle virus (PepMoV; EU586128), Brugmansia suaveolens mottle virus (BsMoV; NC ), Peru tomato virus (PTV; AJ516010), Potato virus V (PVV; NC004010), Wild potato mosaic virus (WPMV; NC004426), Pepper yellow mosaic virus (PepYMV; NC014327), Bidens mottle virus (BiMoV; EU250210), Verbena virus Y (VVY; NC010735), Pepper severe mosaic virus (PeSMV; NC008393), Potato virus Y (PVY; EF026075), Sunflower chlorotic mottle virus (SuCMoV; NC014038), Narcissus yellow stripe virus (NYSV; NC011541), Turnip mosaic virus (TuMV; NC002509), Lettuce mosaic virus (LMV; NC003605), Celery mosaic virus (CeMV; NC015393), Panax virus Y (PanVY; GQ916624), Leek yellow stripe virus (LYSV; NC004011), Brugmansia mosaic virus (BruMV; JX (SK isolate), AB (D-437 isolate))., , nm. 3 (Brugmansia mosaic virus, Colombian datura virus, Brugmansia suaveolens mottle virus) RT-PCR, BruMV. BruMV. (,, ) ( ). BruMV, PCR,,., BruMV-SW BruMV SK. BruMV 92% 99%. Acknowledgements This research was supported by a grant from the Next-Generation Biogreen 21 Program (PJ009033), Rural Development Administration, Republic of Korea and by a grant from the Animal and Plant Quarantine Agency (QIA), Ministry of Agriculture, Republic of Korea (Project Code No. Z ). References Bailey, L. H. and Bailey, E. Z Hortus Third. A concise dictionary of plants cultivated in the United States and Canada. Pub, Co., Inc., New York, 1290 pp. Bristol, M. L Tree Datura drugs of the Colombian Sibunoy. Botanical Museum Leaflets, Harvard University. 22: Chellemi, D. O., Webster, C. G., Baker, C. A., Annamalai, M., Achor, D. and Adkins, S Widespread occurrence and low genetic diversity of Colombian datura virus in Brugmansia suggest an anthropogenic role in virus selection and spread. Plant Dis. 95: Choi, S.-K., Cho, I.-S., Choi, G.-S. and Yoon, J.-Y First report of Tomato spotted wilt virus in Brugmansia suaveolens in Korea. Plant Dis. 98: Evans, W. C. and Lampard, J. F Alkaloids of Datura suaveolens. Phytochemistry 11: Horne, R. W. and Wildy, P Virus structure revealed by negative staining. Advan. Virus Res. 10: Ilmberger, N., Willingmann, P., Adam, G. and Heinze, C A Subgroup 1 Tobamovirus Isolated from Brugmansia sp. and its Detection by RT-PCR. J. Phytopathology 155: Lee, J. H., Park, S. J., Nam, M., Kim, M. J., Lee, J. B., Sohn, H., Choi, H. S.,

7 313 Kim, J.-S., Lee, J.-S., Moon, J.-S. and Lee, S.-H Identification of a New Potyvirus, Keunjorong mosaic virus in Cynanchum wilfordii and C. auricilatum. Res. Plant Dis. 16: (In Korean) Lim, S., Zhao, F., Yoo, R. H., Igori, D., Lee, S. H., Lim, H. -S. and Moon, J. S Characteristics of a Lettuce mosaic virus isolate infecting lettuce in Korea. Plant Pathology J. 30: Lorenzi, H. and Souza, H. M Plantas ornamentais do Brasil, 3rd ed. Nova Odessa, SP, Instituto Plantrum de Estudos da Flora Ltda pp. Lucinda, N., Inoue, N.-A. K., Kitajima, E. W. and Nagata, T Complete genome sequence of Brugmansia suaveolens mottle virus, a Potyvirus from an ornamental shrub. Arch Virol. 155: Lucinda, N., Nagata, T., Inoue, -N. A. K., Salaroli, R. B. and Kitajima, E. W Brugmansia suaveolens mottle virus, a novel potyvirus causing leaf mottling of Brugmansia suaveolens in Brazil. Arch Virol. 153: Nikolić, D., Stanković, I., Vučurović, A., Ristić, D., Milojević, K., Bulajić, A. and Krstić, B First Report of Tomato spotted wilt virus on Brugmansia sp. in Serbia. Plant Dis. 97: Salamon, P. and Palkovics, L Occurrence of Colombian datura virus in Brugmansia hybrids, Physalis peruviana L. and Solanum muricatum Ait. in Hungary. Acta Virol. 49: Zhao, F., Lim, S., Yoo, R. H., Lim, H.-S., Kwon, S.-Y., Lee, S.-H. and Moon, J. S Complete genome sequence of a South Korean isolate of Brugmansia mosaic virus. Arch Virol. 158:

식물병연구 Note Open Access Res. Plant Dis. 22(1): (2016) 서향에서분리한신종포티바이러스 (Daphne Mottle Virus) 의동정 Identi

식물병연구 Note Open Access Res. Plant Dis. 22(1): (2016)   서향에서분리한신종포티바이러스 (Daphne Mottle Virus) 의동정 Identi 식물병연구 Note Open Access Res. Plant Dis. 22(1): 59-63 (2016) http://dx.doi.org/10.5423/rpd.2016.22.1.59 서향에서분리한신종포티바이러스 (Daphne Mottle Virus) 의동정 Identification of Daphne Mottle Virus Isolated from Daphne

More information

16-15(3)-07(최장경).fm

16-15(3)-07(최장경).fm Res. Plant Dis. 15(3) : 254-258 (2009) Research in Plant Disease The Korean Society of Plant Pathology t (Lagenaria leucantha var. gourda) w IB m Cucumber mosaic virus Áy 1 Á»x 1 Á t 2 Á * w w, 1 w y w,

More information

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S 식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding

More information

01-15(3)-12(최장경).fm

01-15(3)-12(최장경).fm Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein

More information

식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio

식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018)   3 Detection and Identification of a Mixed Infectio 식물병연구 Note Open Access Res. Plant Dis. 24(1): 81-85 (2018) https://doi.org/10.5423/rpd.2018.24.1.81 3 Detection and Identification of a Mixed Infection of Three Viruses in Chinese Artichoke in Korea *

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 식물병연구 Res. Plant Dis. 17(2) : 211 215 (2011) http://dx.doi.org/10.5423/rpd.2011.17.2.211 단보 Open Access Research in Plant Disease The Korean Society of Plant Pathology 열무에서분리한오이모자이크바이러스분리주의특성 이선주 홍진성 1

More information

Research in Plant Disease Vol. 23 No 요배추과등작물들을비롯한잡초들을포함한 300여종이상의식물들을감염시킬수있으며약 90여종의진딧물을통한비영속적전반으로포장에서퍼져나가는것으로알려져있다 (Choi와 Choi, 1992; Raybould

Research in Plant Disease Vol. 23 No 요배추과등작물들을비롯한잡초들을포함한 300여종이상의식물들을감염시킬수있으며약 90여종의진딧물을통한비영속적전반으로포장에서퍼져나가는것으로알려져있다 (Choi와 Choi, 1992; Raybould 식물병연구 Note Open Access Res. Plant Dis. 23(1): 60-64 (2017) https://doi.org/10.5423/rpd.2017.23.1.60 순무모자이크바이러스에대한무육종계통저항성평가 Resistance Evaluation of Radish (Raphanus sativus L.) Inbred Lines against Turnip

More information

(조인숙)-o.fm

(조인숙)-o.fm 식물병연구 Res. Plant Dis. 19(4) : 326 330 (2013) http://dx.doi.org/10.5423/rpd.2013.19.4.326 Note Open Access Research in Plant Disease The Korean Society of Plant Pathology 국내양앵두나무에서발생한 Cherry green ring

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

Microsoft Word - 08-안태영

Microsoft Word - 08-안태영 Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54 Communication Development and Verification of Nested PCR Assay for Detection of Tobacco rattle

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 식물병연구 Res. Plant Dis. 17(2) : 196 204 (2011) http://dx.doi.org/10.5423/rpd.2011.17.2.196 보문 Open Access Research in Plant Disease The Korean Society of Plant Pathology 2006 년과 2007 년상주와구례에서발생한오이바이러스병의병징특성

More information

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미,

66 Journal of Agriculture & Life Science 49(4) Ⅰ. 서론 Tomato ringspot virus(torsv) 는 Group IV (+) sense ssrna viruses, Nepovirus속으로분류되는식물병원성바이러스로, 북미, 농업생명과학연구 49(4) pp.65-72 Journal of Agriculture & Life Science 49(4) pp.65-72 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.65 Tomato ringspot virus 검역진단시스템개발 이시원

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Microsoft Word - pv_0602.doc

Microsoft Word - pv_0602.doc 1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.

More information

(Appexdix 신용길).fm

(Appexdix 신용길).fm 식물병연구 Res. Plant Dis. 19(1) : 67 75 (2013) http://dx.doi.org/10.5423/rpd.2013.19.1.067 Appendix Open Access Research in Plant Disease The Korean Society of Plant Pathology 2013 년한국식물검역바이러스목록 농림수산검역검사본부

More information

식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti

식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017)   국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti 식물병연구 Note Open Access Res. Plant Dis. 23(1): 69-74 (2017) https://doi.org/10.5423/rpd.2017.23.1.69 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecting Foxtail Millet (Setaria italica) in South Korea

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - - 5 - [ 그림 1] 산수유 [ 그림 2] 더덕 - 6 - - 7 - sample [ 그림 3] 균분리를위한접종 - 8 - PCA PCA with inoculum Slide glass [ 그림 4] Slide culture 모식도 - 9 - - 10 - Nutrient Medium Paperdisk with Antibiotics

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R

316 Research in Plant Disease Vol. 21 No. 4, (Seo, 2009). Enzyme-Linked Immuno Sorbent Assay(ELISA) Reverse Transcription- Polymerase Chain Reaction(R 식물병연구 Research Article Open Access Res. Plant Dis. 21(4) : 315-320(2015) http://dx.doi.org/10.5423/rpd.2015.21.4.315 Reverse transcription Loop-mediated isothermal amplification Soybean mosaic virus Detection

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

Research in Plant Disease Vol. 23 No (Han, 2009; Kim, 1998, 2016; Lee, 2011, 2013; Tran Kim, 2012)., Fusarium, Verticillium (Hwang, 2009). R. s

Research in Plant Disease Vol. 23 No (Han, 2009; Kim, 1998, 2016; Lee, 2011, 2013; Tran Kim, 2012)., Fusarium, Verticillium (Hwang, 2009). R. s 식물병연구 Research Article Open Access Res. Plant Dis. 23(3): 228-233 (2017) https://doi.org/10.5423/rpd.2017.23.3.228 Resistance to Bacterial Wilt of Rootstock Varieties of Tomato and Graft Compatibility

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).

212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014). 식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)

More information

Æ÷Àå½Ã¼³94š

Æ÷Àå½Ã¼³94š Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding

More information

°Ç°�°úÁúº´6-2È£

°Ç°�°úÁúº´6-2È£ K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 6 No. 2 www.cdc.go.kr 2013 1 11 6 2 ISSN:2005-811X Flavivirus surveillance in mosquitoes collected from the quarantine

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: / ,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,

More information

02Á¶ÇýÁø

02Á¶ÇýÁø Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF

More information

<31325FB1E8B0E6BCBA2E687770>

<31325FB1E8B0E6BCBA2E687770> 88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,

More information

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료

135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료 MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

..........5-45..

..........5-45.. K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 45 www.cdc.go.kr 2012 11 9 5 45 ISSN:2005-811X Monitoring of antimicrobial resistance on non-tertiary hospitals

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI:   A study on Characte Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.381-404 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.381 A study on Characteristics of Action Learning by Analyzing Learners Experiences

More information

K O R E A C E N T E R S F O R D I S E A S E C O N T R O L & P R E V E N T I O N PHWR Vol. 5 No. 41 www.cdc.go.kr/phwr 2012 10 12 5 41 ISSN:2005-811X Comparison of drug-susceptibility test to the anti-tuberculosis

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

13장문현(541~556)ok

13장문현(541~556)ok A Study on the Spatial Distribution of Local Foods and Regional Products in the Seomjin River Area* Jeong-ok Kim**Mal-shick Shin***Jeong-rock Lee****Mun-hyun Jang*****,,,,,,,,,. 36, 15, 14, 5, 19. 32,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Original Article Journal of Apiculture 31(2) : 121~131 (2016) The Most Rapid Detection Method against Korean Sacbrood Virus using Ultra-Rapid Reverse-Transcription Real-Time PCR (URRTRT-PCR) Sang-Hyun

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr

자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016)   ISSN 228 (JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method

More information

03-16-김용일.indd

03-16-김용일.indd Journal of the Korean Society of Surveying, Geodesy, Photogrammetry and Cartography Vol. 33, No. 2, 95-101, 2015 http://dx.doi.org/10.7848/ksgpc.2015.33.2.95 ISSN 1598-4850(Print) ISSN 2288-260X(Online)

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu

식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017)   Analysis of the Cause of the Twig Blight on Mu 식물병연구 Note Open Access Res. Plant Dis. 23(3) : 283-287 (2017) https://doi.org/10.5423/rpd.2017.23.3.283 Analysis of the Cause of the Twig Blight on Mulberry Based on the Weather Conditions * *Corresponding

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Asia-pacific Journal of Multimedia Services Convergent with Art, Humanities, and Sociology Vol.5, No.4, August (2015), pp.631-648 http://dx.doi.org/10.14257/ajmahs.2015.08.77 보육의 위기적 현상과 재난안전관리의 문제점 조망

More information

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>

<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770> 수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )

Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI:   *,..,,,.,.,,,,.,,,,, ( ) Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: http://dx.doi.org/10.21024/pnuedi.26.1.201604.1 *,..,,,.,.,,,,.,,,,, ( ).,,,. * 2014. 2015. ** 1, : (E-mail: cajoo@pusan.ac.kr)

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

½Éº´È¿ Ãâ·Â

½Éº´È¿ Ãâ·Â Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started

More information

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의

목원 한국화- 북경전을 준비하며 지난해부터 시작 된 한국의 목원대학교 한국화 전공의 해외미술체험은 제자와 스승의 동행 속에서 미술가로 성장하는 학생들의 지식에 샘을 채워주는 장학사업으로 진행되고 있으며, 한국의 우수한 창작인력 양성을 위해, 배움을 서로 나누는 스승들의 K o r e a n P a i n t i n g F i n e A r t s D e p t. A r t C o l l e g e M o k w o n U n i v e r s i t y 목원대학교 미술대학 한국화전공 우수창작인력양성 특성화장학생-제2차 해외미술체험 陌生的眼神看 展ː 望 목 원 한 국 화 -Beijing을 걷다- Korean Painting

More information

16(2)-7(p ).fm

16(2)-7(p ).fm w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The obje

Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The obje Research subject change trend analysis of Journal of Educational Information and Media Studies : Network text analysis of the last 20 years * The objectives of this study are analyzing research trends

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

28 Research in Plant Disease Vol. 21 No 년 4월에 전라북도농업기술원의 노지 시험연구포장에 정식한 콜라비(품종 아삭콜)에서 처음으로 시들음병이 발생 하였다. 이병주에서 병원균을 순수분리하여 균주를 확보하 였다. 균학적 특성 및

28 Research in Plant Disease Vol. 21 No 년 4월에 전라북도농업기술원의 노지 시험연구포장에 정식한 콜라비(품종 아삭콜)에서 처음으로 시들음병이 발생 하였다. 이병주에서 병원균을 순수분리하여 균주를 확보하 였다. 균학적 특성 및 식물병연구 Note Open Access Res. Plant Dis. 21(1) : 27-31(2015) http://dx.doi.org/10.5423/rpd.2015.21.1.027 Fusarium oxysporum First Report of Fusarium Wilt Caused by Fusarium oxysporum on Kohlrabi in Korea

More information

도비라

도비라 광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신

More information

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

<32382DC3BBB0A2C0E5BED6C0DA2E687770> 논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

03-15(3)-04(고숙주).fm

03-15(3)-04(고숙주).fm Res. Plant Dis. 15(3) : 175-182 (2009) Research in Plant Disease The Korean Societ of Plant Patholog ZYMV»ƒ e w š *Á½ Á Á½ šá 1 Á 1 û» e, 1 w Effect of the Infection Times b Zucchini ellow mosaic virus

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A528B1E8C1BEB9E8292E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 18, No. 11 : 2593~2599 Nov. 2014 오픈소스 모바일 UI컴포넌트 선정 절차 프레임워크 손효정 1 이민규 2 성백민

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

00º½Çмú-¾Õ

00º½Çмú-¾Õ 547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design

More information

06_À̼º»ó_0929

06_À̼º»ó_0929 150 151 alternative investment 1) 2) 152 NPE platform invention capital 3) 153 sale and license back 4) 154 5) 6) 7) 155 social welfare 8) 156 GDP 9) 10) 157 Patent Box Griffith EUROSTAT 11) OTC M&A 12)

More information

Analysis of teacher s perception and organization on physical education elective courses Chang-Wan Yu* Korea Institute of curriculum and evaluation [Purpose] [Methods] [Results] [Conclusions] Key words:

More information

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 한국 중년 여성의 라이프스타일이 메이크업 추구이미지와 화장품 구매행동에 미치는 영향 주영주 1 *, 이순희 2 1 서경대학교대학원미용예술학과, 2 신성대학교 미용예술계열 The Effects of The Life Style for Korean Middle Aged Women on

More information

Æ÷Àå82š

Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information