식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti

Size: px

Start display at page:

Download "식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecti"

채원 장
5 years ago
Views:

1 식물병연구 Note Open Access Res. Plant Dis. 23(1): (2017) 국내에발생하는조바이러스의종류및발생실태 Occurrence of Viruses Infecting Foxtail Millet (Setaria italica) in South Korea 박충열 1 ㆍ민현근 1 ㆍ이홍규 1 ㆍ염윤아 1 ㆍ오종희 1 ㆍ김봉섭 2 ㆍ배대현 2 ㆍ윤영남 2 ㆍ이수헌 1,3 * 1 경북대학교응용생명과학부, 2 농촌진흥청국립식량과학원남부작물부, 3 경북대학교식물의학연구소 *Corresponding author Tel: Fax: suheon@knu.ac.kr These authors contributed equally to this work as first authors. Chung Youl Park 1, Hyun-Geun Min 1, Hong-Kyu Lee 1, Yoon Ah Yeom 1, Jonghee Oh 1, Bong-Sub Kim 2, Dae-Hyeon Bae 2, Young-Nam Yoon 2, and Su-Heon Lee 1,3 * 1 School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea 2 Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50426, Korea 3 Institute of Plant Medicine, Kyungpook National University, Daegu 41566, Korea Received August 19, 2016 Revised November 18, 2016 Accepted January 29, 2017 In 2015, a nationwide survey was carried out to investigate about occurrence pattern of virus infecting foxtail millet. A total 100 foxtail millet leaf samples showing virus-like and abnormal symptoms were collected in the seven main cultivated regions of Korea. Four viruses were identified using reverse transcription polymerase chain reaction and RNA sequencing. Of the collected 100 foxtail millet samples, 10 were Barley virus G (BVG), 4 were Rice stripe virus (RSV), 1 was Northern cereal mosaic virus (NCMV), and 1 was Sugarcane yellow leaf virus (ScYLV) infection. To our best knowledge, this is the first report of BVG and NCMV infecting foxtail millet in Korea and ScYLV is expected as new Polerovirus species. This research will be useful in breeding for improved disease-resistant foxtail millet cultivars. Keywords: Barley virus G, Foxtail millet, Rice stripe virus, RNA sequencing 조 (foxtail millet) 는화본과의한해살이풀로서 (Ha 와 Lee, 2001), 원산지는중앙아시아와동북아시아로알려져있다 (Li 와 Wu, 1996). 동유럽, 중앙아시아, 동아시아지역에서는 주요곡물로서재배되고있으며, 아프리카, 아메리카, 호 주등에서는조류등의사료용으로일부재배되고있다 (De Wet 등, 1979). 국내에서조는 1960 년대까지주요작물로널 리재배되었으며 (Kim 등, 2009), 주로엿, 떡, 소주등의일부 재료로이용되었다 (Ha 와 Lee, 2001). 이후, 조의재배는벼와 밀등주요작물과비교하여수량과수익성이낮아생산량 Research in Plant Disease pissn , eissn 이지속적으로감소하였다. 통계청보고에따르면, 조의생산량은 2004년 2,644톤에서 2009년 1,360톤으로급격히감소하였다 (Kim, 2012; 통계청 ). 최근건강에대한관심이높아지면서조와같은잡곡은웰빙식품, 기능성식품에대한소비자의선호도가높아지며관심이증대하고있지만 (Lee 등, 2012), 수량과직접적인관련이있는병해충에관한체계적인연구들은부족한실정이다. 조의경우현재까지 2종의바이러스 (Rice black-streaked dwarf virus [RBSDV], Rice stripe virus [RSV]) 만이보고되어있어바이러스무병종자의보급과저항성품종개발등의연구에제한적일수밖에없다. 따라서본연구에서는국내조에서발생하는바이러스조사를수행하였으며, next generation sequencing (NGS) 와 reverse The Korean Society of Plant Pathology cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 69

2 70 transcription-polymerase chain reaction (RT-PCR) 방법을기반으로국내미보고및신종바이러스동정에대하여언급하였다. 시료채집. 2015년 5월부터 9월까지, 조시료확보를위하여국내에서재배면적이가장넓은 5개도 7개시군구 ( 강원도영월군, 횡성군, 경상남도밀양시, 경상북도의성군, 전라남도나주시, 여수시, 제주도제주시 ) 에위치한포장에서조사를수행하여전체 100점의시료를수집하였다 (Fig. 1). 육안진단을통하여조가재배되고있는포장에서관찰된주요병징으로는괴저반점, 모자이크, 기형, 엽맥황화증상이었으며, 이상증상을보이는식물체또한시료수집대상에포함하였다 (Fig. 2). 를설계하여 (Table 1) RT-PCR 진단을수행하였다. RT-PCR 진단결과양성반응을보인시료에대해서는 direct seqeuncing을이용하여염기서열을결정하였고, 미국국립생물정보센터 (National Center for Biotechnology Information, NCBI) 의 BLAST 검색을통하여동정하였다. 전체 16종의바이러스에대하여 RT-PCR 진단을수행한결과 2종 (RSV와 Northern cereal mosaic virus [NCMV]) 의바이러스가검출되었으며, 전체 100점의시료중에서 RSV는 4점, NCMV는 1점이양성반응을보였고, RBSDV를포함한 14종은모두음성반응을보였다. NCBI BLAST 결과검출된 RSV는기보고된 YG-JN 분리주 (GenBank accession no. GQ229098, 97%), NCMV는 Hebei 분리주 (GU985153, 99%) 와가장높은뉴클레오티드상동성을보였다. RT-PCR을이용한바이러스진단. 전체 100점의시료는 Easy-Spin Total RNA extraction Kit (intron Biotechnology, Daejeon, Korea) 를이용하여공급사의매뉴얼에따라전체 RNA를추출하였다. 추출한전체 RNA는국내에보고된 2종의바이러스 (RSV, RBSDV) 와문헌조사를통하여국외조에서발생보고된바이러스 14종에대하여특이적프라이머 RNA sequencing 분석및바이러스감염양상. 수집한조시료에대하여국내미보고또는신종바이러스등추가적인바이러스를검출하기위하여 RNA sequencing 방법을수행하였다. 전체 100점의시료는액체질소를이용하여곱게마쇄한뒤혼합하여 1점의시료로만들었으며, 위에서사용한키트를이용하여전체 RNA를추출하였다. 혼합시료 Gangwon-do (n=25) Yeongwol (n=10) Hoengseong (n=15) Gyeongsangbuk-do (n=26) Uiseong (n=26) Jeollanam-do (n=25) Naju (n=19) Yeosu (n=6) Gyeonsangnam-do (n=8) Miryang (n=8) Jeju-do (n=16) Jeju (n=16) Fig. 1. Map of South Korea showing the location of the five provinces where foxtail millet samples collected in Numbers indicate collected sample number.

71 A B C D Fig. 2. Various virus symptoms of foxtail millet naturally infected in the field. (A, D) Chlorotic stripe. (B, C) Yellowing streaking.

, San Diego, CA, USA) 장비를 이용하여 paired-end RNA sequencing 방법으로 10 Gbp (giga base pair) 생산하였으며, 한 결과 BVG는 10점, NCMV는 1점, ScYLV는 1점, RSV는 4점이 모든 과정은 Theragen Etex Bio Institute (Suwon, Korea)에서 한

4종의 바 ing data는 식물바이러스 유래의 시퀀스만을 검출하기 위 해 구축된 파이프라인(pipeline)을 이용하여 분석하였으며, 검출되었으며, NCMV와 RSV는 종 특이적 프라이머를 이용 이러스에 대하여 염기서열을 결정한 후, NCBI BLAST를 이용 분석은 Seeders (Daejeon, Korea)에서 수행되었다.

RNA-sequencing을 통하여 4종의 바이러 98%), ScYLV는 Hainan 분리주(HQ342888, 77%)와 가장 높은 상동성을 보였다.

3 71 A B C D Fig. 2. Various virus symptoms of foxtail millet naturally infected in the field. (A, D) Chlorotic stripe. (B, C) Yellowing streaking. 에서 추출한 전체 RNA 1점은 ILLUMINA Hiseq 2500 (Illumina 이러스가 모두 양성반응을 보였다(Fig. 3). 개별진단을 수행 Inc., San Diego, CA, USA) 장비를 이용하여 paired-end RNA sequencing 방법으로 10 Gbp (giga base pair) 생산하였으며, 한 결과 BVG는 10점, NCMV는 1점, ScYLV는 1점, RSV는 4점이 모든 과정은 Theragen Etex Bio Institute (Suwon, Korea)에서 한 RT-PCR 진단 결과와 동일하였다. 이 중에서 BVG와 ScYLV, 수행하였다. RNA sequencing을 통하여 확보된 raw sequenc- BVG와 RSV의 복합감염이 각각 1점씩 확인되었으며, 84점의 시료에서는 바이러스가 검출되지 않았다(Table 4). 4종의 바 ing data는 식물바이러스 유래의 시퀀스만을 검출하기 위 해 구축된 파이프라인(pipeline)을 이용하여 분석하였으며, 검출되었으며, NCMV와 RSV는 종 특이적 프라이머를 이용 이러스에 대하여 염기서열을 결정한 후, NCBI BLAST를 이용 분석은 Seeders (Daejeon, Korea)에서 수행되었다. 분석이 완 하여 상동성을 분석한 결과 RSV와 NCMV는 위의 염기서열 료된 모든 콘틱(contig)은 NCBI BLAST 검색을 통하여 최종적 상동성 결과와 동일하였고, BVG는 김제 분리주(KT962089, 으로 확인하였다. RNA-sequencing을 통하여 4종의 바이러 98%), ScYLV는 Hainan 분리주(HQ342888, 77%)와 가장 높은 상동성을 보였다. 최종 동정된 4종의 바이러스 중에서 국 스(Barley virus G [BVG], RSV, NCMV, Sugarcane yellow leaf virus [ScYLV])가 확인되었으며, 각 바이러스별 검출 콘틱 개수는 Table 2에 표시된 바와 같다. RNA sequencing 결과를 확인하 내 미보고 바이러스 2종(BVG [LC159487], NCMV [KU297992]) 기 위하여 획득한 염기서열 정보를 바탕으로 프라이머를 설계하였으며(Table 3), RT-PCR, 클로닝 그리고 염기서열 분 sequencing을 통하여 획득한 2개의 콘틱을 바탕으로 전체 외피단백질(coat protein, 아미노산 상동성: 82%)과 이동단 석 수행하여 최종적으로 바이러스를 동정하였다. RT-PCR을 백질(movement protein, 88%)을 결정하였다. International 수행한 결과 혼합시료에서 추출한 전체 RNA에서 4종의 바 Committee on Taxonomy of Viruses (ICTV)의 Luteoviridae 신종 은 NCBI GenBank에 등록하였다. 추가적으로, ScYLV는 RNA-

4 72 Table 1. Primer pairs used for detection of reported virus from foxtail millet Acronym* Primer Oligonuleotide sequence (5 to 3 ) Amplicon size (bp) Target gene BSMV BSM-F10 AACGATGCACTCACGCAAAG 282 Beta BSM-R10 CGAAAGGCCAGCACACTTTC CMMV CMM-F10 GCGCAATTGGATTCGATGCT CMM-R10 CCGCTCGCGAATTCTCTACT JGMV JGM-F10 CCATGGTGAGCAACAAAGCC 551 CP JGM-R10 TCCAACATTCCCGTCGAGTC MCDV MCD-F30 TGATCCTCCTCCGGGGGAAA 374 S MCD-R30 AACCCGTGGAGAAGTGTGCCTA MCMV MCM-F10 AGAGCTATTCGAGCCAACCC 437 CP MCM-R10 AACACAGTGCGGTTTTGTGG MDMV MDM-F10 TATCGAACACCCGAGCAACC 404 CP MDM-R10 CTTTGCACGTGCTGGAGTTC MRDV MRD-F20 GCGCAATTTGGAAACGTGGT 521 p10 MRD-R20 GCTGTATTTCCCCCTAGCCG MSV MS-F30 TGTCATCGCTTCGTGGTGAA 529 CP MS-R30 TTACATTATGTCGCCGGGGG NCMV NCM-F10 GATCACAATGCCGTGCTGTG NCM-R10 CCCTCGGCCCATGAGAATTT PCV PC-N30 ACACHCAYTGCTATGGTGAAGAGCA 759 p49 PC-C30 TTAAACCYACAACCGTGCTCTWTGG RMV RM-N30 AAGGTTTCGAAGGTGTGGTTGACG 859 MP 3 RM-C10 GGATTCGAACCTCTCACTT RBSDV RBSD-F10 ACTTGGAGCGCAGTAGCGTCA 485 CP RBSD-R10 ACGGGTGCCAAATGAAATGCTTTTT RDV RDR8-F10 TGTTGCGGGGCAGACTGGGA 252 CP RDR8-R10 GCAGTAGCCGTGACGCCAGC RSV RSR3-F10 TGTGAGAGGCACTGGCTTTGTGAGA 703 CP RSR3-R10 CACCAACCCGCTGACTTCAGATGC SrMV SrM-F10 CCGCGAACAATTGCCATCAT 712 CI SrM-R10 CAGCGTGAATTTGTTCGTCCA SCMV SCM-F10 GCACGACAGGCAAAATCACA 437 CP SCM-R10 TGGCATGTACCGCTCTGTAG *The acronym and GenBank accession number used is: BSMV (Barley stripe mosaic virus, NC003481), CMMV (Cocksfoot mild mosaic virus, U13918), JGMV (Johnsongrass mosaic virus, AY387828), MCDV (Maize chlorotic dwarf virus, GU594293), MCMV (Maize chlorotic mottle virus, GU594293), MDMV (Maize dwarf mosaic virus, FM883223), MRDV (Maize rough dwarf virus, LK392325), MSV (Maize streak virus, NC001346), NCMV (Northern cereal mosaic virus, NC001346), PCV (Peanut clump virus, L07269), RMV (Ribgrass mosaic virus, HQ667978), RBSDV (Rice black-streaked dwarf virus, JX994211), RDV (Rice dwarf virus, U36565), RSV (Rice stipe virus, GU230170), SrMV (Sorghum mosaic virus, KJ541740), and SCMV (Sugarcane mosaic virus, DQ842502). Beta, beta B gene; -, no annotation; CP, coat protein gene; S, S-protein gene; p10, p10 protein gene; 3, 3 protein gene; p49, p49 protein gene; MP, movement protein gene; 3, 3 UTR; CI, cylindrical inclusion protein gene.

5 73 Table 2. List of the identified viruses from foxtail millet using RNA sequencing Virus name Acronym Genus No. of contigs Barley virus G BVG Polerovirus 6 Northern cereal mosaic virus NCMV Cytorhabdovirus 3 Rice stripe virus RSV Tenuivirus 123 Sugarcane yellow leaf virus ScYLV Polerovirus 2 Total 134 Table 3. Primer sets used for confirmation of the virus existence in samples Virus name (acronym) Primer name Oligonucleotide sequence (5 3 ) Amplicon size (bp) Barley virus G (BVG) MYDV-CT-F5 GACATCTACTCTTTGAGTTTC 568 MYDV-CT-R5 TCCTTATTCCTCTTCGGAAC Northern cereal mosaic virus (NCMV) NCMV-0F GGACAATCCATCCAGAAGAAA 425 NCMV-1R AGATATCATTAGATTGGCCTTC Rice stripe virus (RSV) RSRV-F30 CATCACAGTGTCACTGGTCT 571 RSR4-R10 AGTTGATAATAAGAATAGGA Sugarcane yellow leaf virus (ScYLV) ScYLV-CT-F5 ATAGGTAGGCGACGCTCC 822 ScYLV-CT-R5 TGGAGGCGTACTCTCCGT (bp) 1,000 M M 바이러스병의종류와발생실태를구명하고자하였다. 연구수행결과, 현재까지기보고된 1종 (RSV) 이외에추가적으로미보고 2종 (BVG와 NCMV) 과신종으로예상되는바이러스 1종 (ScYLV-like) 을동정하였다. 추후본연구에서동정한바이러스에대한전파양식, 특성등에대한연구와위의바이러스에대한피해해석및대응기술이확립되어야할것으로생각된다. 500 요약 Fig. 3. Reverse transcription polymerase chain reaction (RT-PCR) for virus detection in foxtail millet. Lane M, size marker; lane 1, Barley virus G (BVG, 568 bp); lane 2, Northern cereal mosaic virus (NCMV, 425 bp); lane 3, Rice stripe virus (RSV, 571 bp); lane 4, Sugarcane yellow leaf virus (ScYLV, 822 bp). 분류기준 ( 암호화된단백질상동성 10% 이상의차이를보 이는종에대하여신종바이러스로간주하는규정 ) 에따라 Polerovirus 속의신종으로동정하였다. 본연구에서는전국적으로재배되고있는조를수집하여 2015년, 조바이러스발생양상을구명하기위하여전국적인조사를실시하였다. 주요재배단지 7개지역에서이상증상과바이러스병징을보이는식물체 100점을수집하여, RT-PCR 진단과 RNA sequencing 방법을이용하여전체 4종의바이러스를동정하였다. 수집한시료에서는 Barley virus G (BVG) 가 10점, Rice stripe virus (RSV) 는 4점, Northern cereal mosaic virus (NCMV), Sugarcane yellow leaf virus (ScYLV) 가각각 1점씩검출되었다. 이들중에서 BVG와 NCMV는국내조에서첫발생보고이며, ScYLV 는 Polerovirus속의신종으로예상된다. 본연구결과는조식물체의무병종자와저항성품종개발을위한기초연구자료로이용가능할것으로생각된다.

6 74 Table 4. Survey of virus infection in foxtail millet at seven locations of five provinces in 2015 Infection Virus name* Location H Y U M N Y J Total Single infection BVG NCMV RSV ScYLV Double infection BVG+RSV BVG+ScYLV Non detected *BVG, Barley virus G; NCMV, Northern cereal mosaic virus; RSV, Rice stripe virus; ScYLV, Sugarcane yellow leaf virus. H, Hoengseong; Y, Yeongwol; U, Uiseong; M, Miryang; N, Naju; Y, Yeosu; J, Jeju. Conflicts of Interest No potential conflict of interest relevant to this article was reported. Acknowledgement This research was supported by a grant from National Institute of Crop Science, Rural Development Administration, Republic of Korea (Project No. PJ ). References De Wet, J. M. J., Oestry-Stidd, L. L. and Cubero, J. I Origins and evolution of foxtail millets (Setaria italica). J. d Agric. Trad. Bota. Appl. 26: Ha, Y. D. and Lee, S. P Characteristics of proteins in Italian millet, sorghum and common millet. Korean J. Postharvest Sci. Technol. 8: Kim, E. J Genetic variation of foxtail millet [Setaria italica (L.) P. Beauv.] among accessions collected from Korea and other countries by morphological and molecular markers. Master s thesis. Kangwon National University, Chuncheon, Korea. 64 pp. Kim, S. K., Sohn, E. Y. and Lee, I. J Starch properties of native foxtail millet, Setaria italica Beauv. J. Crop Sci. Biotechnol. 12: Lee, J. S., Oh, B. G., Song, S. B., Ko, J. Y., Woo, K. S., Nam, M. H., Park, S. T., Kim, J. I., Seo, M. C., Kwak, D. Y., Jung, T. W., Oh, I. S. and Kim, K. Y A medium maturing, glutinous foxtail millet (Setaria italica Beauv.) variety Kyeongkwan1. Korean J. Breed. Sci. 44: Li, Y. and Wu, S Traditional maintenance and multiplication of foxtail millet (Setaria italica (L.) P. Beauv.) landraces in China. Euphytica 87:

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한