<303120C3D6C0E5BFAD203431B1C72032C8A32E687770>
|
|
- 유미 천
- 6 years ago
- Views:
Transcription
1 Korean Journal of Oral and Maxillofacial Pathology 2017;41(2): ISSN: (Print); (Online) Available online at mir-4708 의 multidrug resistance protein-1 발현조절을통한 paclitaxel 민감성증가 최장열 1), 유지원 2), 안상건 1)* 조선대학교 1) 치과대학구강병리학교실, 2) 치의학전문대학원구강내과학교실 <Abstract> mir-4708 Enhances Paclitaxel Sensitivity through Modulating Expression of Multidrug Resistance Protein-1 Jang-Yeol Choi 1), Ji-won Ryu 2), Sang-Gun Ahn 1)* 1) Department of Pathology, College of Dentistry, 2) Department of Oral Medicine, School of Dentistry, Chosun University, Gwangju 61452, Rep of Korea. Multidrug resistance (MDR) remains one of the most significant obstacles in various cancer treatment, and this process often involves dysregulation of the number of micro-rnas. The aim of this study was to explore the role of mir-4708 on the regulation of MDR-1 expression and the regulation of multidrug resistance (MDR) to chemotherapeutic drugs. Luciferase reporter assays demonstrated that mir-4708 directly binds MDR-1 3 -UTR and down-regulated reporter luciferase activity. The mrna and protein expression levels of MDR1 were significantly decreased following mir-4708 overexpression. Additionally, the accumulation of rhodamine-123 in paclitacel resistant FaDu cells following mir-4708 transfection was significantly increased compared with control, indicating that the efflux capacity was reduced. These results demonstrated that mir-4708 could be involved in the regulation of MDR via targeting MDR-1 and may provide a potential strategy for reversing drug resistance in oral cancer. Key words: mir-4708, FaDu, MDR1, Paclitaxel Ⅰ. INTRODUCTION 항암화학요법을이용한암치료에있어서큰장애가되는요소중의하나는항암제내성이다. 암환자에대한항암화학요법이반복적, 장기적으로사용하게되면서항암부작용과항 * Correspondence: Sang-Gun Ahn, PhD, Department of Pathology, School of Dentistry, Chosun University, 309 Pilmun-Daero, Dong-gu, Gwangju 61452, Rep of Korea. Tel: ; Fax: ahnsg@chosun.ac.kr ORCID : Received: Mar ; Revised: Apr ; Accepted: Apr 암내성이발생한다. 또한서로다른여러항암제에대한광범위한교차내성을보이는다제내성 (multidrug resistance) 으로인해사용가능한항암제의범위가제한됨으로서암치료의중요한문제점으로대두되고있다 1,2). 항암제내성은환자및종양들사이의유전적차이등을포함한다양한인자들에의해유발될수있으나, 현재보고된세포내항암제내성기작의중요한분자생물학적기전을보면, MDR 유전자에의해세포내약물축적을능동적으로유출함으로서세포내약물축적억제유도가주기전으로알려져있다. 다제내성은또한항암제의
2 제한적인흡수, ceramide 와같은막지질들의변화등을통해세포내약제의축적을제한, apoptosis 억제, DNA 손상의복구와약제의비독성화를유도및세포주기를변화시킴으로항암제에대한내성을부가적으로유도할수있다 3). 다제내성에의한항암화학요법의여러문제점을극복하기위해다제내성기전, 내성세포의특성및내성극복과관련된연구가광범위하게진행되고있으며, 그중에서다제내성을유발하는유전자 (ATP-binding cassette(abc) transporter; MDR-1, MRP, 그리고 BCRP) 들에대한연구가내성극복과관련되어빠르게진행되고있다. 지금까지 48개의 human ABC 유전자가확인되었고, 그중에서 multidrug resistance 1 (MDR-1 또는 ABCB1) 에의한내성은다제내성기전중에서많은연구가진행되고있다 4-7). 최근, MDR1 의과발현은종양세포내 paclitaxel 축적을감소시켜다제내성에관여한다는연구결과가있으며 8), A549 lung adenocarcinoma 세포에서 MDR1의 hypermethylation 이 cisplatin 에대한내성억제 9) 및간암세포주인 HepG2 세포에서 MDR1의 antisense RNA를이용한 MDR1의발현억제가항암제내성감소를유도함이보고되었다 10). 또한다양한세포내신호전달기전에관여하는 microrna (mirna) 가약물내성조절에중요하게관여하고있는것이보고되고있으며, 한예로, 위암세포에서 mir-129가 MDR-1을조절하여 cisplatin 내성억제에관여하며 11), mir-186 은난소암세포에서 MDR1과직접적으로결합하여이들발현을억제, paclitaxel 과 cisplatin 에대한내성을저해시켰다 12). 또한 mir-873, mir-27a, mir-145 그리고 mir-302 은각각난소암세포, 간암세포, 장상피세포, 유방암세포에서직, 간접적으로 MDR-1 발현조절을통해다제성약물내성에관여하고있음이보고되고있다 13-16). 그러나최근 MDR-1 을표적으로한다제내성억제연구에서 in vitro에서뚜렷한효과를보였던 verapamil 과 cyclosporin-a 가임상연구에서실패사례를보고됨으로서논란의여지가남아있다 17). 그러나, MDR-1 의발현이여러종양에서항암치료에대한반응과예후에관련이있는다수의연구들을통해 MDR-1을표적으로한내성극복치료를시도하고있거나 MDR-1 의기질에대한저해제를탐색하는연구가지속적으로 수행되고있다. 이연구에서구강암 FaDu 세포에서 mirna 인 hsa-mir p이 MDR-1 유전자의발현에미치는영향을확인하였다. Luciferase 분석을통해 hsa-mir p가 MDR-1 의 3 -UTR 부위에결합함을확인하였고, hsa-mir p의발현유도가 MDR-1 mrna 와단백질의발현을감소시키는것을확인하였다. 또한 hsa-mir p 의과발현에의한 MDR-1 의감소는 paclitaxel 내성 FaDu 세포 (FaDu-PTX) 내 Rhodamine 123의축적을증가시킴을확인하였다. II. MATERIALS and METHODS 1. Cell Culture 사람인후두암세포인 FaDu와 paclitaxel 내성 FaDu (FaDu-PTX) 세포는 10% fetal bovine serum (FBS), 100units/mL penicillin, and 100ug/mL streptomcin 을함유한 Dulbecco's modified Eagle's medium (DMEM, welgen, korea) 을사용하였고, 5% CO2, 37 에서배양하였다. 2. Plasmid construction mirna expression vector 인 psuper plasmid에 hsa-mir p를 cloning 하기위해 hsa-mir-4708 primer을합성하였다 ; Forward: CATAGATCTTTTAGGAGAGAGATGCCGCCTT GCTCCTTGAACAGGAGG 와 Hsa-mir-4708 primer Reverse: CATAAGCTTTTTAGTATCAGAGAGATGCCGCCTTGCTCCTC CTGTTCAAGGA (Macrogen, Korea). PCR 조건은 95 에서 3분간 denaturation, 95 20초, 35~55 20초, 72 20초, 35 cycle, 72 에서 5분간 extension 을통해얻은 PCR 생산물을 BglII와 HindIII로 digestion 하여 psuper basic vector에 ligation 하였다. MDR1 3'-UTR는 pmir luciferase report vector에 cloning 하기위해 MDR1 3'-UTR wild type 과 mutant를특이 primer 를합성하여사용하였다. MDR1 3'-UTR, Forward: CATACTA GTTGAGAGACATCATCAAGTGGAGA, Reverse: CAT AAGC 56
3 TTTCACAGGCAGTTTGGACAAG를이용하여 95, 5min, 9 5, 30sec - 56, 30sec - 72, 1min 30cycle, 72, 5min 조건으로 PCR 하였다. MDR1 3'-UTR mutant type 은 Forward: GGACTGTAACTGACTTAAAAGATTATAGA, Reverse: TCTA TAACTTTTAAGTCAGTTACAGTCC를통해합성하였고, MDR1 3'-UTR wild type과 mutant type을 pmir luciferase vector (Ambion) 에 cloning 하여 plasmid를제작하였다. 3. Luciferase Assay 6 well plate 에 2.5 x 10 5 cells/well로 seeding한 FaDu 세포에 psuper basic vector 또는 psuper/hsa-mir-4708 와 pmir/mdr1 3'-UTR wild type 또는 mutant를각각 co-transfection 하고 48시간후 cell lysis buffer로 lysis하였다. 단백질은 Bradford assay (Bio-rad) 를통하여정량하였고, luciferase assay는 promega (USA) 의 luciferase assay system (E1500) 을사용하였다. Luminometer 에서측정하고값을단백질정량값으로나누어 normalization 하였다. 4. RT-PCR analysis 각 transfection한세포는 RNAiso solution(takara, Japan) 을이용하여제조사의방법에따라 total RNA를얻었다. total RNA는 cdna 합성 kit(promaga) 를이용하여 cdna 를합성하였고, PCR과 qrt-pcr 에사용하였다. 사용한 primer 는 Table 1과같다. mirna 의 qrt-pcr을위한 cdna합성은 Mir-XTM mirna First-Strand Synthesis and SYBRR qrt-pcr kit(clontech) 을사용하였고제조사의방법에따라합성하여사용하였다. 5. Western blot 단백질은 transfection 후 48시간동안배양한세포를 RIPA buffer 를이용하여단백질을분리하여 Bradford assay를통하여단백질정량후 SDS-PAGE 를시행하였고, PVDF membrane 에 transfer 하였다. Western blot은 5% skim milk/tbst에 1시간반응, 1st anti-body (Santa cruz, MDR1: sc-55510, β-actin: sc-47778) 4 overnight, 10분간 3번 TBST로 washing하고 2nd anti-body (goat anti-mouse IgG) 1시간상온반응하였다. 6. Rhodamine accumulation FaDu-PTX 세포에 psuper-4708과 psuper basic을 Transfection 하고 4시간후 paclitaxel (PTX) 을처리하여 48시간동안배양하였다. 2시간동안 12 μm 의 rhodamine 123( Rho123) 을처리하고 PBS로 washing 후 fluorometer에서 fluorescence 를측정하였다. 측정값은세포수로 normalize 하였다. 7. Statistical analysis 데이터는 EXCEL 을이용하여평균과표준편차를구한후 t-test 를이용하여상호작용을검증하였다. 이연구의통계학적유의수준은 *p<0.05, **p<0.01로하였다. Table 1. Specific primers for MDR1 and hsa-mir p. mirna 3' universal antisense, U6 primers: supplied by mirna cdna synthesis kit. 57
4 III. RESULTS 이전연구에서 HOX family 중에하나인 HOXC6 가 MDR-1 과 BCL-2 의조절을통해다제내성기전에중요한역할을하고 있음을보고하였다 18). 따라서 HOXC6 과발현에따른 mirna 의변화를확인하기위해 microrna array를시행한결과 HOXC6 가과발현된구강암 FaDu 세포에서 hsa-mir-4708가 3.16배감소하였다 (Table 2). microrna array 결과를확인하 Table 2. mir p significantly differentially expressed between FaDu-pcDNA4.A and FaDu-HOXC6 cell lines. Pc4: pcdna4.a plasmid fc: fold change Fig. 1. Down-regulation of mir-4708 in HOXC6 overexpressed FaDu cells. The mir-4708 levels were quantified by qrt-pcr analysis in vector or pcdna4-hoxc6 transfected FaDu cells. **P<0.01. b a Fig. 2. mir p binds to MDR1 3'-UTR. (a) Sequence alignment of mir-4708 target site in MDR1 3'-UTR. (b) MDR1 3'-UTR wild-type or mutant was co-transfected with psuper-basic or psuper/mir-4708 into FaDu cells. The luciferase activity was determined by luminometer, and then normailzed. **p<
5 기위해 mir-4708 specific primer 를사용한 qrt-pcr 의결과 HOXC6 가과발현되는 FaDu 세포에서 mir-4708 이 microrna array 결과와유사하게의미있는감소를관찰하였다 (Fig. 1, p<0.01)). Hsa-miR-4708 에의해조절되는타겟유전자를 TargetScan, mirbase 등의 database를통해조사한결과 mir-4708이 MDR1 의 3 UTR 의 위치와결합할수있음을확인하였다. mir p 와 MDR1 의 3 UTR 간에결합을확인하기위 a 해 mir-4708을 psuper basic vector에유전자재조합하였고, MDR-1 의 3 -UTR 부위에 mir-4708 예상결합염기서열을포함한 wild type과예상결합위치의염기서열을결실시킨 mutant type의 DNA를삽입시킨 luciferase report vector를제작하였다 (Fig. 2a). psuper-mir-4708와 MDR-1 의 3 -UTR wild type luciferase vector (pmir-mdr1 wt) 또는 MDR-1의 3 -UTR mutant luciferase vector (pmir-mdr1 mut) 를 FaDu 세포주에 co-transfection 하여 Luciferase assay 를실행한결과 pmirb Fig. 3. Expression of MDR1 down-regulated by mir-4708 expression. (a) FaDu cells were transfected with psuper basic vector or psuper/mir-4708 for 48 h. MDR1 mrna expression levels were quantified by RT-PCR and qrt-pcr analysis. (b) Total proteins were subjected to western blot analysis using antibodies against The graphs show the quantitative evaluation of MDR1 protein expression. *p<0.05, **p<0.01. a b Fig. 4. Effect of mir-4708 on cell viability and Rhodamine123 accumulation. The FaDu-PTX cells were transfected psuper-basic or psuper/hsa-mir-4708 with 400 nm PTX. (a) Representative drug uptake is shown depicting the levels of Rho123 accumulation in FaDu-PTX cells. (b) Cell viability was assessed by the MTT assay, as described in the Materials and Methods. The results of three experiments are summarized. **p<
6 MDR1 wild type과 psuper-mir-4708가 co-transfection한세포에서 luciferase activity가 DNA 농도의존적으로감소하였으며, 3 μg psuper-mir-4708를처리한실험군에서 MDR-1의 3 -UTR luciferase activity 가 40 % 가량감소한것을확인하였다. 반면 MDR-1의 3 -UTR mutant type에서는같은농도의 DNA transfection 조건에서변화하지않았다 (Fig. 2b). MiR-4708 이 MDR-1 mrna 와단백질발현에미치는영향을확인하기위해 FaDu 세포에 psuper-mir-4708과 control vector를 transfection하고 24시간후 MDR1 의 mrna level을 RT-PCR, qrt-pcr analysis 그리고 wester blot analysis 를시행하였다. FaDu 세포에서 mir-4708를 transfection FaDu 세포에서 MDR-1의 mrna level이 control 또는 vector transfection 세포에비해 25% 감소함을 RT-PCR 과 qrt-pcr 을통해확인하였다 (Fig. 3a). 또한 mir-4708이 MDR-1 단백질생성에미치는영향을확인하기위해 FaDu 세포에 psuper-mir-4708를 transfection하고 48시간후 anti-mdr1 antibody와함께 Western blot을수행한결과 qrt-pcr 결과와마찬가지로 control 에비해 33% 정도의 MDR1 단백질의감소를확인하였다 (Fig. 3b). mir-4708 에의한 MDR-1 의발현억제가세포내약물축적을유도하는지알아보기위해 paclitaxel (PTX) 에대한저항성을갖고있는 FaDu-PTX 세포에서 Rhodamine123 의세포내축적을조사하였다. mir-4708을과발현시킨 FaDu-PTX 세포에서 Rhodamine123의세포내축적이 control 세포에비해 54% 증가하였으며 (Fig. 4a), 또한 mir-4708에의한 MDR-1 의발현억제가항암제인 paclitaxel 에대한민감도가증가하는지를세포생존율을통해확인하였다. 400 nm PTX만처리한 control 과 PTX 와 mir vector 를함께처리된세포에서의세포생존률간의의미있는유의성이관찰되지않았으나 mir-4708과 PTX가함께처리된 FaDu-PTX 세포에서세포생존율이유의성있게 42% 감소하는것을확인하였다 (Fig. 4b). IV. DISCUSSION 암치료에있어항암제내성은항암치료에주요문제점이 며, 항암제를이용한항암치료실패의원인되고있다. 현재, 세포막에존재하는 ATP-binding cassette (ABC) membrane transporter 들이항암제내성을조절하는주요기전중하나로여겨지고있으며, 4) ATP-binding cassette (ABC)-membrane transporter 중 ABCG2 (BCRP) 는유방암과두경부암에서항암제내성에관여하고 19,20), 뿐만아니라 ABCC1 (MRP-1), ABCB1 (MDR-1) 등여러 ATP-binding cassette (ABC) family들이구강암에서항암제내성에직간접적으로관여하고있음이알려져있다 21). MDR-1 은다재내성관련가장많이연구된 ABC transporter 중하나로종양억제인자인 p53과 Fos, Jun과복합체를형성다양한세포조절기능을가지는 AP-1 이 MDR-1의발현을조절하는전사인자로보고되고있으며 22), CCAAT/enhancerbinding protein family 인 C/EBPβ, NFIL6 (nuclear factor for interleukin-6) 그리고염증과연관된 NF-κB 또한 MDR-1 promoter 에결합 MDR1/ABCB1 발현을조절하고있음이보고되었다 23,24). 본연구자의이전연구에서 homeodomain 을포함하는전사인자인 HOXC6 가구강암에서 MDR-1 의전사를조절하고있음을입증하였다 18). 최근 ATP-binding cassette (ABC)-membrane transporter 들의발현에 HOXC6 를포함한다른 HOX family 유전자들이관여하고있음이보고되고있다. 특히, human myelogenous leukemia K562/ADM 세포에서 HOXB4 의 knockdown 은 P-gp, MRP1, BCRP의발현을억제하고, HOXA10 의 knockdown 은 P-gp와 MRP1의발현을억제시켜약물내성을감소시킨다는보고가있었으며 25, 26), 또한 pancreatic cancer 세포에서 homeobox gene MSX2는 ABCG2 발현조절과관련성이확인되었다 27). 따라서 HOX family 유전자또한항암제내성조절기전간의매우밀접한연관성이있음을시사하고있다. 본연구에서구강암 FaDu 세포에서항암제내성에직, 간접적으로관련된 HOXC6 과발현에따른 microrna array 를시행한결과 hsa-mir-4708 의발현감소를확인하였으며, qrt-pcr 을통해이들발현이감소함을다시한번확인하였다 (Table 2, Fig. 1). Persson et. al., 은유방암조직에서 mir-4708 을포함하는여러 mirna 가 ERBB2/Her2 유전자의발현과함께유도됨으로써임상표지인자및잠재적종양유전자마커로나타날 60
7 수있음을보여주고있다 28). 따라서 mir-4708 이구강암항암제내성에관여하고있는지를조사하였다. mirnas database (TargetScan, mirbase) 를통해 hsa-mir p의예상 target 유전자를조사한결과 ATP-binding cassette, sub-family B, member 1 (MDR-1/ABCB1, NM_ ) 와 ATP-binding cassette, sub-family C, member 12 (MRP/ABCC12, NM_033226) 의 3'-untranslated region (3'-UTR) 에결합할수있음을확인하였다. mir-4708 와 MDR-1 의직접적인결합을보기위해 MDR-1의 3'-UTR을 luciferase vector 에 subcloning 하여 luciferase assay 한결과 luciferase activity 가 control 과비교하여약 40 % 감소하는것을확인하였다 (Fig. 2). 이는 mir-4708이 MDR-1 3'-UTR에결합하여이들전사를억제함을확인할수있었고, 이와상응해서 mir-4708 과발현된 FaDu 세포에서 mrna 와단백질의발현이각각 ±25%, ±33% 의감소를확인함으로서 mir-4708이 MDR-1 3'-UTR 에결합하여 MDR-1 조절에직접적으로관여함을입증하였다 (Fig. 3). 또한 paclitaxel 저항성을가지는 FaDu-PTX 세포에서 mir-4708의과발현은 Rhodamine123의세포내축적을증가시킬뿐아니라 paclitaxel 에대한세포민감성을증가시켜줌으로서 mir-4708 이 MDR-1 조절은통해항암제내성기전을조절할수있음을입증하였다 (Fig. 4). 결론적으로본연구결과는구강암세포에서화학요법에의한항암제내성의획득에 mirna-4708 조절장애의중요성을나타내는증거를제공하고있으며, 또한구강암세포항암제내성을저해할수있는 mirna 기반치료전략및개발대한기반을제공할수있을것이다. Ⅴ. ACKNOWLEDGMENTS This work was supported by basic science research program through the National Research Foundation of Korea (NRF) funded by ministry of science, ICT and future planning (no ) and funded by the Korean government MSIP (no ). REFERENCES 1. Nooter K, Stoter G: Molecular mechanisms of multidrug resistance in cancer chemotherapy. Pathol Res Pract 1996;192: Partridge AH, Burstein HJ, Winer EP: Side effects of chemotherapy and combined chemohormonal therapy in women with early-stage breast cancer. J Natl Cancer Inst Monogr 2001;30: Gottesman MM, Fojo T, Bates SE: Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002;2: El-Awady R, Saleh E, Hashim A: The Role of Eukaryotic and Prokaryotic ABC Transporter Family in Failure of Chemotherapy. Front Pharmacol 2017;7: Chang FW, Fan HC, Liu JM: Estrogen Enhances the Expression of the Multidrug Transporter Gene ABCG2- Increasing Drug Resistance of Breast Cancer Cells through Estrogen Receptors. Int J Mol Sci 2017;18: Guan GF, Zhang DJ, Zheng Y: Significance of ATP-binding cassette transporter proteins in multidrug resistance of head and neck squamous cell carcinoma. Oncol Lett 2015;10: Lu JF, Pokharel D, Bebawy M: MRP1 and its role in anticancer drug resistance. Drug Metab Rev 2015;47: Szakács G, Paterson JK, Gottesman MM: Targeting multidrug resistance in cancer. Nat Rev Drug Discov 2006;5: Li A, Song J, Lai Q: Hypermethylation of ATP-binding cassette B1 (ABCB1) multidrug resistance 1 (MDR1) is associated with cisplatin resistance in the A549 lung adenocarcinoma cell line. Int J Exp Pathol 2016 [Epub ahead of print]. 10. Chan JY, Chu AC, Fung KP: Inhibition of P-glycoprotein expression and reversal of drug resistance of human hepatoma HepG2 cells by multidrug resistance gene (mdr1) antisense RNA. Life Sci 2000;67: Lu C, Shan Z, Li C, Yang L: MiR-129 regulates cisplatin-resistance in human gastric cancer cells by targeting P-gp. Biomed Pharmacother 2017;86:
8 12. Sun KX, Jiao JW, Chen S, Liu BL, Zhao Y: MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res 2015;8: Wu DD, Li XS, Zong ZH: MicroRNA-873 mediates multidrug resistance in ovarian cancer cells by targeting ABCB1. Tumour Biol 2016;37: Chen Z, Ma T, Huang C: MiR-27a modulates the MDR1/P-glycoprotein expression by inhibiting FZD7/β -catenin pathway in hepatocellular carcinoma cells. Cell Signal 2013;25: Ikemura K, Yamamoto M, Okuda M: MicroRNA-145 post-transcriptionally regulates the expression and function of P-glycoprotein in intestinal epithelial cells. Mol Pharmacol 2013;83: Zhao L, Wang Y, Jiang L: MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res 2016;35: Robert J: Approaches to multidrug resistance reversal. Expert Opin Investig Drugs. 1998;7: Kim KJ, Moon SM, Ahn SG: Transcriptional regulation of MDR-1 by HOXC6 in multidrug-resistant cells. Oncogene 2013;32: Chang FW, Fan HC, Liu JM: Estrogen Enhances the Expression of the Multidrug Transporter Gene ABCG2- Increasing Drug Resistance of Breast Cancer Cells through Estrogen Receptors. Int J Mol Sci 2017;18: Guan GF, Zhang DJ, Zheng Y: Significance of ATP-binding cassette transporter proteins in multidrug resistance of head and neck squamous cell carcinoma. Oncol Lett 2015;10: Lu JF, Pokharel D, Bebawy M: MRP1 and its role in anticancer drug resistance. Drug Metab Rev 2015;47: Chen Q, Bian Y, Zeng S: Involvement of AP-1 and NF-κB in the up-regulation of P-gp in vinblastine resistant Caco-2 cells. Drug Metab Pharmacokinet 2014;29: Chen GK, Sale S, Sikic BI: CCAAT/enhancer-binding protein beta (nuclear factor for interleukin 6) transactivates the human MDR1 gene by interaction with an inverted CCAAT box in human cancer cells. Mol Pharmacol 2004;65: Huang J, Zhao M, Li X: The Cytotoxic Effect of the Benzene Metabolite Hydroquinone is Mediated by the Modulation of MDR1 Expression via the NF-κB Signaling Pathway. Cell Physiol Biochem 2015;37: Wang H, Jia XH, Chen JR: HOXB4 knockdown reverses multidrug resistance of human myelogenous leukemia K562/ADM cells by downregulating P-gp, MRP1 and BCRP expression via PI3K/Akt signaling pathway. Int J Oncol 2016;49: Yi YJ, Jia XH, Xie SY: Knockdown of HOXA10 reverses the multidrug resistance of human chronic mylogenous leukemia K562/ADM cells by downregulating P-gp and MRP-1. Int J Mol Med 2016;37: Hamada S, Satoh K, Hirota M: The homeobox gene MSX2 determines chemosensitivity of pancreatic cancer cells via the regulation of transporter gene ABCG2. Cell Physiol 2012;227: Persson H, Kvist A, Rego N: Identification of new micrornas in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Cancer Res 2011;71:
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
Chapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The
Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and
PowerPoint 프레젠테이션
Apr. 30. 2016. GBCC in JeJu Island Sensitization of breast cancer cells to chemotherapeutic drugs by metabolic regulation InChul Park, Ph. D. Korea Institute of Radiological & Medical Sciences (KIRAMS)
항체 포털 서비스 Preparation Peptide 총 4주 소요 / 473,000 ~ 511,000 Free of charge 2~3 days 243,000 ~ 281,000 의뢰서 작성 Peptide epitope prediction 유전자 정보
Preparation Service AbFrontier Custom service 장점 실험 담당자와의 원활한 1:1 커뮤니케이션 (신속한 feedback을 통한 맞춤형 제작 서비스) 고객연구센터 - 개별 서비스의 진행 상황 및 결과 즉시 확인 http://center.abfrontier.com (e-mail & SMS 전송) 회원제 -연구자의 프로젝트 보안
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
550호(01-09)
T H E K O R E A N D O C T O R S W E E K L Y www.docdocdoc.co.kr I N S I D E 38 3 5 6 8 11 13 24 25 27 29 31 38 41 42 2 Advertisement Government & Medicine 3 Government & Medicine 4 Government & Medicine
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze
달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
???? 1
The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of
Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social
한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th
Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster
지원연구분야 ( 코드 ) LC0202 과제번호 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 소속위암연구과직위책임연구원
지원연구분야 ( 코드 ) LC0202 과제번호 1110550 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 1 2 3 소속위암연구과직위책임연구원 성명류근원전공외과 세부과제명 세부과제책임자 성명 소속 ( 직위 ) 전공 총연구기간 2011
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
노화조직은행소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 노화조직은행 전화 :051) 팩스 :051) Homepa
소식지 주소 : 부산광역시금정구부산대학로 63번길 2( 장전동 ) 부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.atb.knrrc.or.kr http://aging.pharm.pusan.ac.kr/ Content
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
<C7D1B1B9B1A4B0EDC8ABBAB8C7D0BAB85F31302D31C8A35F32C2F75F303132392E687770>
버스 외부 광고의 효과에 관한 탐색적 연구 : 매체 접촉률과 인지적 반응을 중심으로 1) 고한준 국민대학교 언론정보학부 조교수 노봉조 벅스컴애드 대표 이사 최근 몇 년 사이 옥외 광고나 인터넷 광고 등 BTL(Below the Line) 매체가 광고 시장에서 차지하 는 비중이 점점 높아지고 있다. 버스 외부 광고는 2004년 7월 서울시 교통체계개편 이후 이용자
WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disabi
WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성 ( 황수경 ) ꌙ 127 노동정책연구 2004. 제 4 권제 2 호 pp.127~148 c 한국노동연구원 WHO 의새로운국제장애분류 (ICF) 에대한이해와기능적장애개념의필요성황수경 *, (disability)..,,. (WHO) 2001 ICF. ICF,.,.,,. (disability)
Microsoft PowerPoint - 김미영
암세포의위험한여행 한국과학기술원 김미영 강의개요 전이란무엇인가? 전이는어떤과정을통해진행될까? 전이예측방법은어떤것들이있을까? Cancer ( 악성종양 ) US South Korea 질병사망률질병사망률 1. 심장병 26% 1. Cancer 26.7% 2. Cancer 23% 2. 뇌출혈 12.7% 3. 뇌출혈 5.6% 3. 심장병 7.9% >20,000 환자가악성종양에의해매일사망함
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부
大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah
<35BFCFBCBA2E687770>
주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율
7월웹진
최근연구소식 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. 새로운항암치료타겟인 c-met 저해제의연구현황 Livio Trusolino, Andrea Bertotti and Paolo M. Comoglio (2010) MET signalling: principles and function in development, organ regeneration
<C1A63534C8B820BCBCB9CCB3AA2DC6EDC1FD2E687770>
C-II. 안전하고 완전한 대장내시경을 위하여 Room C 김 지 원 서울대학교 의과대학 내과학교실, 서울특별시 보라매병원 내과 Difficult Colonoscopy: How to Overcome? Ji Won Kim Department of Internal Medicine, Seoul National University oramae Hospital, Seoul
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교
충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net
Kbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : ~ 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종
[ 화학 ] 과학고 R&E 결과보고서 나노입자의표면증강을이용한 태양전지의효율증가 연구기간 : 2013. 3 ~ 2013. 12 연구책임자 : 김주래 ( 서울과학고물리화학과 ) 지도교사 : 참여학생 : 원승환 ( 서울과학고 2학년 ) 이윤재 ( 서울과학고 2학년 ) 임종찬 ( 서울과학고 2학년 ) 소재원 ( 서울과학고 2학년 ) 1,.,.,.... surface
내시경 conference
부울경소화기내시경학회 6월집담회 고신대학교복음병원소화기내과전임의서광일 F/63 CASE C.C) epigastric pain for 2 wks P. I) 2014.04.16 EGD at LMC adm via OPD for further evaluation. P. Hx) CASE HTN/DM/Hepatitis/Tbc (+/+/-/-) S. Hx) N-S ROS)
레이아웃 1
대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)
연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con
Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency
A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
- 사용 시약과 기기 - 세포주 - 985
KISEP Head and Neck Korean J Otolaryngol 2002;45:984-9 하인두 편평상피암 세포주(PNUH-12)에서 Cisplatin 및 5-Fluorouracil 처리 후 p53의 Molecular Event 변화에 대한 연구 2 전경명 1 이병주 1 이일우 1 문영일 1 노환중 1 왕수건 1 고의경 1 김소린 1 이은엽 The
Study on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
,......
The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of
자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
01 sirna AccuTarget TM sirnas 35 Custom sirna 36 Genome-wide sirna 38 AccuTarget Genome-wide Predesigned sirna Library 39 AccuTarget Premade sirna Set
Custom sirna Genome-wide sirna sirna Oligonucleotide FAQs AccuTarget mirna mimics & inhibitors AccuTarget mirna Controls sirna & mirna Phone: 1588-9788 (ext.4->1) Email: sirna@bioneer.co.kr Email: sirna-support@bioneer.co.kr
<30352DB1E2C8B9C6AFC1FD2028C8ABB1E2C7F6292036302D36362E687770>
3D 나노-마이크로 프린팅 기술의 현황 홍 기 현 한국기계연구원 부설 재료연구소 표면기술 연구본부 3D Nano-micro Printing Technology Kihyon Hong Korea Institute of Materials Science, Gyeongnam 642-831, Korea Abstract: 최근 3D 프린팅 기술을 이용하여 마이크로, 나노
jaeryomading review.pdf
4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,
Æ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache
Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp.149-171 DOI: http://dx.doi.org/10.21024/pnuedi.27.4.201712.149 * A Study on Teachers and Parents Perceptions on the Introduction of Innovational
Aging Tissue Bank κ κ κ κ (9 월호에계속...) 2
소식지 주소 : 부산광역시금정구장전동산30번지부산대학교약학대학 / 전화 :051)510-2814 팩스 :051)518-2821 E-mail:agingbank@pusan.ac.kr hyjung@pusan.ac.kr Homepage : www.agingbank.or.kr http://aging.pharm.pusan.ac.kr/ Content 6 월호 알기쉬운노화의기초지식
Kjhps016( ).hwp
Surgical Extent and Types in Pancreatic Cancer Song Cheol Kim, M.D. Department of Surgery, Ulsan University College of Medicine & Asan Medical Center, Seoul, Korea Pancreatic cancer continues to pose a
2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285
13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914
3월 온라인 교육
2013 년 2 분기대리점집체교육 - Protein - Takara Korea Biomedical Protein Workflow Chapter 1: 샘플준비 Chapter 2: Electrophoresis -Precast gel (Lonza/NuSep) -ProSieve EX running buffer -Protein marker Chapter 3: Staining
Journal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked