384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S

Similar documents
01-15(3)-12(최장경).fm

인문사회과학기술융합학회

09È«¼®¿µ 5~152s

DBPIA-NURIMEDIA

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

03-서연옥.hwp

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타


Lumbar spine

한국성인에서초기황반변성질환과 연관된위험요인연구

09-감마선(dh)

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

식물병연구 Note Open Access Res. Plant Dis. 24(1): (2018) 3 Detection and Identification of a Mixed Infectio

<30345F D F FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

°Ç°�°úÁúº´6-2È£

04김호걸(39~50)ok

歯kjmh2004v13n1.PDF

04_이근원_21~27.hwp

½Éº´È¿ Ãâ·Â

Kor. J. Aesthet. Cosmetol., 라이프스타일은 개인 생활에 있어 심리적 문화적 사회적 모든 측면의 생활방식과 차이 전체를 말한다. 이러한 라이프스 타일은 사람의 내재된 가치관이나 욕구, 행동 변화를 파악하여 소비행동과 심리를 추측할 수 있고, 개인의

<32382DC3BBB0A2C0E5BED6C0DA2E687770>

03-ÀÌÁ¦Çö



(조인숙)-o.fm


식물병연구 Note Open Access Res. Plant Dis. 23(3) : (2017) Analysis of the Cause of the Twig Blight on Mu

Journal of Educational Innovation Research 2017, Vol. 27, No. 4, pp DOI: * A Study on Teache

09권오설_ok.hwp

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>

DBPIA-NURIMEDIA

Microsoft Word - pv_0602.doc

(5차 편집).hwp

00내지1번2번

139~144 ¿À°ø¾àħ

16-15(3)-07(최장경).fm

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte


1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp

泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여


Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

°Ç°�°úÁúº´5-44È£ÃÖÁ¾

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

07_Àü¼ºÅÂ_0922

<313120B9DABFB5B1B82E687770>

141(26) () ( ( ) () () () ) 2) 1932 ()()3) 2 1) ( ) ( ) () () () 4) ( ) 5) 6) ) ) ( ) () 42 () )

아태연구(송석원) hwp

untitled

:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )

14.531~539(08-037).fm

06_±è¼öö_0323

DBPIA-NURIMEDIA


시안

???? 1

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

¹ýÁ¶ 12¿ù ¼öÁ¤.PDF

Output file

(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>

p 19; pp 32 37; 2013 p ㆍ 新 興 寺 大 光 殿 大 光 殿 壁 畵 考 察 ; : 2006

???? 1

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

,......

민속지_이건욱T 최종

서론 34 2

605.fm

Main Title

06_ÀÌÀçÈÆ¿Ü0926

KD hwp

DBPIA-NURIMEDIA

Journal of Educational Innovation Research 2016, Vol. 26, No. 2, pp DOI: * Experiences of Af

433대지05박창용

°í¼®ÁÖ Ãâ·Â

DBPIA-NURIMEDIA


review hwp

대한한의학원전학회지23권3호(최종)_ hwp

DBPIA-NURIMEDIA

04조남훈

DBPIA-NURIMEDIA

Journal of Educational Innovation Research 2016, Vol. 26, No. 1, pp.1-19 DOI: *,..,,,.,.,,,,.,,,,, ( )

04서종철fig.6(121~131)ok

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

2015

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

歯1.PDF

大学4年生の正社員内定要因に関する実証分析

?

Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc

DBPIA-NURIMEDIA

12이문규

Transcription:

식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding author Tel: +82-63-238-3300 Fax: +82-63-238-3838 E-mail: hschoi@korea.kr These authors contributed equally to this work as co-first authors. Mikyeong Kim 1, Hyo-Jung Kang 2, Hae-Ryun Kwak 1, Jeong-Eun Kim 1, Jaedeok Kim 1, Jang-Kyun Seo 3, and Hong-Soo Choi 1 * 1 Crop Protection Division, National Institute of Agricultural Sciences, Wanju 55365, Korea 2 Chungcheongbuk-do Agricultural Research and Extension Services, Boeun 28902, Korea 3 Graduate School of International Agricultural Technology, Seoul National University, Pyeongchang 25354, Korea Received October 26, 2017 Revised October 31, 2017 Accepted November 1, 2017 In 2016, less than 30% of virus-like symptoms such as chlorosis, necrosis and ringspots were observed in Hoya carnosa from commercial greenhouse in Eumseong, Korea. A total of 6 samples from Hoya carnosa were collected both symptomatic and asymptomatic plants and tested for virus infection by RT-PCR of 3 viruses known to infect Hoya spp. including Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV) and Tomato chlorotic spot virus (TCSV). Three symptomatic samples were positives for INSV. Also, it was not the virus detected in three asymptomatic samples. To further confirm the presence of INSV, complete nucleocapsid (N) gene of the virus were amplified and sequenced from two samples. BLAST analysis of the consensus sequence showed that two isolates (INSV-Hy1 and -Hy2) shared nucleotide sequence identities of 99% with each other and 97-99% with other INSV isolates available in the GenbBank. Phylogenetic analysis showed that these isolates closely related to the INSV isolates from ornamental from China. This is the first report of INSV on Hoya carnosa from Korea. Keywords: Hoya carnosa, Impatiens necrotic spot virus, Orthotospovirus (Hoya carnosa) 100, 3-5 ( ). (Yang, 2009). (Impatiens necrotic spot virus, INSV) Tospoviridae, Orthotospovirus, (Frankliniella occidentalis), (F. intonsa) Research in Plant Disease pissn 1598-2262, eissn 2233-9191 www.online-rpd.org (Simko, 2017; Sakurai, 2004). 1990,,, 36 (Crosslin Hamlin, 2010; Daughtrey, 1997; De Avila, 1992; Kuo, 2014; Law Moyer, 1990). 2005 (Horita Sasaki, 2005), 2010 (Ding, 2011), 2009,,, 150 20 ha, 2014 2010-2012 The Korean Society of Plant Pathology This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; Shin, 2013; Roggero, 1999; Vicchi, 1999). 2016 RT-PCR, (INSV).. 2016 ( 1,000 m 2, 15 ). 40 1%, 60 10%, 90 30%.,., 3 ( ) (Fig. 1). 7.. (Quick DIP) (2% PTA). 6,, 1 750-780 nm. RNA RT-PCR. 3 1 3, 3 1 3, 6, 7 (50-150 mg), (BCS Plant RNA Prep Kit, BioCube System, Gwacheon, Korea) Total RNA. Orthotopsovirus (TSWV), (INSV) (Tomato chlorotic spot virus, TCSV) 3 RT-PCR (Table 1). 3 (INSV). Fig. 1. Disease symptoms induced in Hoya carnosa plants by Impatiens necrotic spot virus (INSV). (A) Chlorotic and necrotic ring spots on leaves in natural field. (B) Brown to dark brown, necrotic spotting in middle leaves of the plant. (C, D) Chlorotic spots and necrosis of leaves.

Research in Plant Disease Vol. 23 No. 4 385 Table 1. Sequences of primers for detection of TSWV, INSV, TCSV, CMV and BBWV2 in this report Viruses a Name Sequence (5-3 ) Product size (bp) TSWV TSWV-6F GAGATTCTCAGAATTCCCAGT TSWV-6R AGAGCAATCGTGTCAATTTTATTC 459 bp INSV INSV-1F ATCAATAGTAGCATTAAACAT INSV-1R GACTCAATCTGATTCCTTAGA 800 bp TCSV TCSV-F TCCCTTGGTTTCATTGACCAAACGC TCSV-R ACATG ACACTTGCAAATGAGACTCC 590 bp CMV CMV DP u1 CGTCGTGGTTCCCGCTCCG CMV DP d2 AGCGCGCATCGCCGAAAGAT 473 bp BBWV2 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG BBWV2 1R GCCATCTCATTGGCATGGA 380 bp a TSWV, Tomato spotted wilt virus; INSV, Impatiens necrotic spot virus; TCSV, Tomato chlorotic spot virus; CMV, Cucumber mosaic virus and BBWV2, Broad bean wilt virus 2. Table 2. Analysis of leaves of Hoya carnosa for five viruses using specific primers by RT-PCR 3 7 (TSWV), (INSV) (TCSV). 7 1 6 (Cucumber mosaic virus, CMV) (Table 2). 3 (Ls), (La), (S), (R) (INSV),,,, (Fig. 2). (INSV) (Vicchi, 1999). Host a No. of positive samples b TSWV INSV TCSV CMV BBWV2 Hoya-S 3 0 3 0 - - Hoya-A 3 0 0 0 - - Pepper-S 7 0 0 0 6 0 a Number of samples collected; S = symptomatic samples and A = asymptomatic samples. b Viruses: TSWV, Tomato spotted wilt virus; INSV, Impatiens necrotic spot virus; TCSV, Tomato chlorotic spot virus; CMV, Cucumber mosaic virus and BBWV2, Broad bean wilt virus 2; -, not tested. Fig. 2. Detection of Impatiens necrotic spot virus (INSV) in Hoya carnosa stocks by RT-PCR. Samples were collected from symptomatic leaf (Ls), asymptomatic leaf (La), stem (S) and root (R) from each of stocks (lanes 1,2 and 3). M, DNA ladder; N, negative; P, positive control.. RT-PCR (INSV) 3 800 bp PCR direct sequencing. (National Center for Biotechnology Information, NCBI, USA) BLAST Genbank INSV 97-99%. (INSV) (INSV-Hy1,-Hy2) (Nucleocapsid gene) forward INSV-N (5 CACAACACAAAGCAAACCAAGC 3), reverse J13 (5 CCCGGATCCAGAGCAAT 3) (Cortez, 2001), PCR Expin TM ComboGP (GeneAll Bio., Seoul, Korea), pgem-t Easy vector (Promega, WI, USA). 3

386 Research in Plant Disease Vol. 23 No. 4 Fig. 3. Phylogenetic analysis by Maximum likelihood method showing the relationship of Impatiens necrotic spot virus (INSV) isolates from various hosts and countries based on an alignment of complete nucleocapsid (N) gene sequences. The percentage of trees in which the associated texa clustered together is shown next to the branches. The Tomato spotted wilt virus (TSWV), Zucchini lethal chlorosis virus (ZLCV) and Tomato chlorotic spot virus (TCSV) were used as an outgroup. (Genotech., Daejeon, Korea). BLAST Genbank INSV 97-99%. INSV-HDL (GU112504,, ), INSV J (AB109100,, ) 99%. MEGA 7, (outgroup) Orthotospovirus (TSWV), (TCSV), (Zucchini lethal chlorosis virus, ZLCV). Clustal W.,,, (INSV), (GQ336989) (GU112504) (Fig. 3). 2016 30%,. 6, (TSWV), (INSV) (TCSV) 3 RT-PCR., 3 (INSV), 3. 2 (INSV) (N),. (INSV) Hy-1 Hy-2 BLAST 99%, Genbank (INSV) 97-99%.. (INSV). Conflicts of Interest No potential conflict of interest relevant to this article was reported. Acknowledgement This study was carried out with the support of Cooperative Research program for Agricultural Science & Technology Development (Project No. PJ01011301) Rural Development Administration, Republic of Korea.

Research in Plant Disease Vol. 23 No. 4 387 References Brisco-McCann, E. I. and Hausbeck, M. K. 2016. Handbook of Florists Crops Diseases, pp. 1-28. Cortez, I., Saaijer, J., Wongjkaew, K. S., Pereira, A. M., Goldbach, R., Preters, D. and Kormelink, R. 2001. Identification and characterization of a novel tospovirus species using a new RT-PCR approach. Arch Virol. 146: 265-278. Crosslin, J. M. and Hamlin, L. L. 2010. First report of Impatiens necrotic spot virus infecting greenhouse-grown potatoes in Washington state. Plant Dis. 94: 1507. Daughtrey, M. L., Jones, R. K., Moyer, J. W., Daub, M. E. and Baker, J. R. 1997. Tospoviruses strike the greenhouse industry: INSV has become a major pathogen on flower crops. Plant Dis. 81: 1220-1230. De Avila, A. C., Haan, P. D., Kitajima, E. W., Kormelink, R., Resende, R. D., Goldbach, R. W. and Peters, D. 1992. Characterization of a distinct isolate of Tomato spotted wilt virus (TSWV) from Impatiens sp. in the Netherlands. J. Phytopathol. 134: 133-151. Ding, M., Yin, Y., Fang, Q., Li, S. and Zhang, Z. 2011. First report of Impatiens necrotic spot virus in Gentiana macrophylla in China. Plant Dis. 95: 357.1. Horita, H. and Sasaki, J. 2005. Necrotic spot of lisianthus caused by Impatiens necrotic spot virus in Hokkaido. Jpn. J. Phytopathol. 71: 83. (Abstract, In Japanese) Kuo, Y. W., Gilbertson, R. L., Turini, T., Brennan, E. B., Smith, R. F. and Koike, S. T. 2014. Characterization and epidemiology of outbreaks of Impatiens necrotic spot virus on lettuce in coastal California. Plant Dis. 98: 1050-1059. Law, M. D. and Moyer, J. W. 1990. A tomato spotted wilt-like virus with a serologically distinct N protein. J. Gen. Virol. 71: 933-938. Shin, Y.-G. 2013. List of plant quarantine viruses in Korea newly revised in 2013. Res. Plant Dis. 19: 67-75. Roggero, P., Ciuffo, M., Dellavalle, G., Gutta, P., Gallo, S. and Peters, D. 1999. Additional ornamental species as hosts of Impatiens necrotic spot tospovirus in Italy. Plant Dis. 83: 967. Sakurai, T., Inoue, T. and Tsuda, S. 2004. Distinct efficiencies of Impatiens necrotic spot virus transmission by five thrips vector species (Thysanoptera: Thripidae) of tospoviruses in Japan. Appl. Entomol. Zool. (Jpn.) 39: 71-78. Simko, I., Richardson, C. and Wintermantel, W. 2017. Variation within Lactuca spp. for resistance to Impatiens necrotic spot virus. Plant Dis. doi: 10.1094/PDIS-06-17-0790-RE. (In press) Vicchi, V., Fini, P. and Cardoni, M. 1999. Presence of Impatiens necrotic spot tospovirus (INSV) in horticultural crops in Emilia-Romagna. Informatore Fitopatologico 4: 53-55. Yang, D. S., Pennisi, S. V., Son, K. C. and Kays, S. J. 2009. Screening indoor plants for volatile organic pollutant removal efficiency. HortScience 44: 1377-1381.