pissn 2384-0269 eissn 2508-3635 J. Milk Sci. Biotechnol. 2018;36(4):208-219 https://doi.org/10.22424/jmsb.2018.36.4.208 ARTICLE Salmonella Enteritidis 와 Salmonella Gallinarum 의세균막스트레스를인식하는 spy-gfp 오페론융합체 강보경 방일수 * 조선대학교치과대학구강미생물학교실 The spy-gfp Operon Fusion in Salmonella Enteritidis and Salmonella Gallinarum Senses the Envelope Stress Bo Gyeong Kang and Iel Soo Bang * Dept. of Microbiology and Immunology, Chosun University School of Dentistry, Gwangju, Korea Received: December 15, 2018 Revised: December 24, 2018 Accepted: December 25, 2018 *Corresponding author : Iel Soo Bang Dept. of Microbiology and Immunology, Chosun University School of Dentistry, Gwangju, Korea Tel : +82-62-230-6872 Fax : +82-62-232-6896 E-mail : isbang@chosun.ac.kr Copyright 2018 Korean Society of Milk Science and Biotechnology. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/ licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. ORCID Bo Gyeong Kang 0000-0003-3883-8418 Iel Soo Bang 0000-0001-5284-9709 Abstract Emergence of drug resistant strains of Salmonella enterica threatens milk processing and related dairy industries, thereby increasing the need for development of new anti-bacterials. Developments of antibacterial drugs are largely aimed to target the bacterial envelope, but screening their efficacy on bacterial envelope is laborious. This study presents a potential biosensor for envelope-specific stress in which a gfp reporter gene fused to spy gene encoding a periplasmic chaperone protein Spy (spheroplast protein y) that can sense envelope stress signals transduced by two major two-component signal transduction systems BaeSR and CpxAR in Salmonella enterica serovars Enteritidis and S. Gallinarum. Using spy-gfp operon fusions in S. Enterititis and S. Gallinarum, we found that spy transcription in both serovars was greatly induced when Salmonella cells were forming the spheroplast and were treated with ethanol or a membrane-disrupting antibiotic polymyxin B. These envelope stress-specific inductions of spy transcription were abrogated in mutant Salmonella lacking either BaeR or CpxR. Results illustrate that induction of Spy expression can be efficiently triggered by two-component signal transduction systems sensing envelope stress conditions, and thereby suggest that monitoring the spy transcription by spy-gfp operon fusions would be helpful to determine if developing antimicrobials can damage envelopes of S. Enteritidis and S. Gallinarum. Keywords Salmonella Enteritidis, Salmonella Gallinarum, envelope stress, spy-gfp operon fusion 서론 장내세균과의일종인살모넬라균은통성혐기성그람음성간균으로사람이나동물숙주에침투하여단순한장염부터생명을위협하는장티푸스 (Typhoid) 성질환까지다양한살모넬라증 (salmonellosis) 을일으킨다 (Grassl and Finlay, 2008). 낙농제품과유제품및유가공제품의생산과유통에있어서살모넬라균감염에의한피해는매우빈번하며, 오염된제품에의한대대적인식중독발병의경우또한세계적으로빈번하다 (Ryan et al., 1987; Kousta et al., 2010). 특히, 유가공제품의생산에쓰이는시설과기구들에서발생하는생균막 (biofilm) 이큰위험인자인데, 생균막내에도많은살모넬라균의존재가확인되고, 이들에의해발생하는감염사례또한살모넬라균제어의필요성을보여준다 (Chmielewski and Frank, 2003; Oliver et al., 2005). 살모넬라균은감염숙주동물이다양한약 2,500 종류의혈청형을가진 Salmonella enterica 종에서비롯되며, 인간숙주에한정적으로장티푸스를일으키는 Typhi 와 Paratyphi 를제외한모든혈청형이유가공산업에직 간접적으로위협이될수있다 (Staff, 2002). 208 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 살모넬라균의항미생물제제에대한내성은세계적으로증가하는추세이며, 이에따른새로운항미생물제제의개발은살모넬라균감염조절에필수적이다 (Wales et al., 2010; Hur et al., 2012). 많은항미생물제제들은세균의막과막외부주변공간의훼손을목표로하는데, 그것은세균막의직접적인훼손뿐아니라, 세균생존에필수적인세균의외부환경신호전달체계를훼손함으로써효과적으로세균의증식을제어할수있기때문이다. 하지만개발되는항미생물제제가세균막및막외부주변공간에효과적으로작용하는지를검색하는것은여전히많은노력과비용을수반한다 (Wolf and Mascher, 2016). 본연구에서는인간과동물모두에게중요한인수공통감염성혈청형인 Enteritidis 와가금류의주요병원성혈청형인 Gallinarum 의세균막훼손을인지할수있는바이오센서 (biosensor) 로서 spy유전자전사의활용가능성을조사하였으며, 두혈청형모두에서효용성을확인하였다. Spheroplast protein Y(Spy) 는 138개의아미노산을가진작은주변세포질 (periplasm) chaperone 단백질로서, Spy 단백질은 E. coli가여러자극에의해 spheroplast 가형성될때세포질내에는존재하지않고반드시주변세포질공간내에서만위치하는단백질로처음확인되었다 (Hagenmaier et al., 1997; Quan et al., 2011). Spy는 4개의 α-helix 의긴 hairpin 과같은구조로독특한접힘구조를형성함으로써, 유연성을지니고있기때문에많은종류의단백질의구조안정화에기여할수있을것으로예상되고있다 (Quan et al., 2011). 다른주변세포질 chaperone 단백질들과달리, Spy발현은 E. coli와 S. Typhimurium 에서 spheroplast 를형성하거나원형질막외부스트레스에의해그발현이유도되는것으로알려졌으며, 그유도는세균막스트레스의신호전달역할을하여세균막의안전한형태유지에필요한많은유전자발현에관여하는이인자신호전달체계 (two component signal transduction system) 조절자들인 BaeR 과 CpxR 을필요로한다 (Srivastava et al., 2014; Jeong et al., 2017). 본연구에서는살모넬라의 spy 유전자프로모터부위와전체유전자에 gfp(green fluorescence protein) 리포터유전자가각각융합된플라스미드를이용하여, S. Enteritidis 와 S. Gallinarum 내 spy 유전자전사의세균막스트레스인식가능성과, BaeR과 CpxR의조절관계가이두혈청형에서도보존되는지확인하고자하였다. 재료및방법 1. 사용균주및균주배양조건본연구에서는인수공통감염을일으키는 Salmonella enterica serovar Enteritidis(S. Enteritidis) 와 Salmonella enterica serovar Gallinarum(S. Gallinarum) 을사용하였고, 이실험에사용된돌연변이균주는 Table 1에정리하였다. 균주배양을위한배지로는 Luria-Bertani(LB) 영양배지를사용하였다. 사용한모든균주는모두진탕배양기 (HST, Korea) 에서 37, 220 rpm 조건으로배양하여사용하였으며, 항생제는 ampicillin(200 μg/ml, AP), chloramphenicol(20 μg/ml, CM) 을배지에넣어사용하였다. 본연구에사용한화학제들은따로표기하는경우를제외하곤모두 Sigma-Aldrich 사 (Sigma-aldrich, Korea) 로부터구입하여사용하였다. 2. spy 프로모터 -gfp 오페론융합플라스미드제작 spy-gfp 오페론융합플라스미드를만들기위해먼저 PCR 증폭을통해원하는유전자산물을얻었다. PCR 증폭에사용된주형은 S. Typhimurium 14028s 염색체이고, 전체살모넬라게놈에서 spy 프로모터부분에해당하는유전자를증폭시키기위해제한효소자리염기를붙인 spy linker SacI Forward-2 프라이머와 spy linker BamHI Reverse-2 프라이머를사용하였다 (Table 1). i-pfu DNA 중합효소 (intron Biotechnology Inc, Korea) 를이용해 PCR 증폭을시켰다. 이 PCR 산물은 spy 유전자개시코돈의앞쪽 326 bp와뒤쪽 34 bp를포함한다. 증폭된 PCR 산물은 PCR 정제키트 (GeneAll Biotechnology Co. Ltd, Korea) 를사용하여정제하였고, 프라이머부분에붙인 Sac I과 BamH I(NEB Inc, USA) 부위를제한효소를이용하여잘라냈다. Sac I 과 BamH I 제한효소처리를한 pfpv25 벡터와함께정제키트 (GeneAll) J Milk Sci Biotechnol Vol. 36, No. 4 209
Kang and Bang Table 1. Bacteria strains, plasmids and DNA oligomers used in this study Strains Genotype Source or references FB248 Salmonella enterica serovar Gallinarum(S. Gallinarum) WT Cho et al., 2015 FB254 Salmonella enterica serovar Enteritidis(S. Enteritidis) WT Sun and Hahn, 2012 IB2126 S. Gallinarum / p spy-gfp1 This study IB2129 S. Enteritidis / p spy-gfp1 This study IB2203 S. Gallinarum ΔcpxR :: CM / p spy-gfp1 This study IB2204 S. Enteritidis ΔcpxR :: CM / p spy-gfp1 This study IB2205 S. Gallinarum ΔbaeR :: CM / p spy-gfp1 This study IB2206 S. Enteritidis ΔbaeR :: CM / p spy-gfp1 This study Plasmids Characteristics Source or References pfpv25 gfp fusion vector Gift from Raphael Valdivia (Valdivia and Falkow, 1996) Pspy-gfp 1 gfp fusion containing the entire spy gene Jeong et al.,2017 Pspy-gfp 2 gfp fusion containing the spy promoter This study DNA oligomers Sequences (5 3 ) spy linker SacI Fw-1 TATGAGCTCTGCTATATCATGCTGTTGTA spy linker BamHI Rev-1 TATGGATCCAGGACGGCTATAGAATTCTCTG spy linker SacI Fw-2 TATGAGCTCTGCTATATCATGCTGTTGTA spy linker BamHI Rev-2 TATGGATCCTACCTTTATGCTG CATCATT 로정제후 T4 DNA ligase(neb) 를이용하여결합시켜 E. coli DH5α 에형질전환시켰다. 형질전환된콜로 니들의플라스미드를분리하고, 삽입유전자의염기서열을확인한후살모넬라균주들에형질전환하였다. 3. 세균성장측정 LB 영양배지에서하룻밤배양한 spy-gfp 오페론융합플라스미드를보유하는 S. Enteritidis 와 S. Gallinarum 균주를 PBS(phosphate buffer saline, ph 7.0) 에 O.D 600nm =1.0 이되도록희석시켰다. 이들균주현탁액을 8 μg/ml, 6 μg/ml, 4 μg/ml, 2 μg/ml 농도의 polymyxin B가포함되거나포함되지않은 LB 영양배지에 O.D 600nm =0.02 가되도록동일한양으로 Microplate 에접종하였다. 접종된 Microplate 는 Bioscreen C Microplate Reader(Oy Growth Curves Ab Ltd., Helsinki, Finland) 에서 37 의온도에서 24시간동안교반하여배양하였고, 30분간격으로 O.D 600nm 값을측정하였다. 4. Sheroplast 형성살모넬라균의 spheroplast 형성은기존에알려진방법을변형하여사용하였다 (Birdsell and Cota- Robles, 1967). spy-gfp 융합플라스미드를보유하는 S. Enteritidis 와 S. Gallinarum 을 LB 영양배지에서밤새배양한다음, 새로운 LB 영양배지에 4:1로접종하여 37, 220 rpm의진탕배양기에서 O.D 600nm =0.8이될때까지배양한후 25, 5,000 rpm으로 20분간원심분리하여상층액을버리고 1 M Tris-HCl(pH 8.0) 을 0.01M 으로희석시킨용액으로같은양을첨가하여한번세척시켰다. 다시한번원심분리하여상층액을제거후 0.5 M sucrose(bioshop, Canada) 가포함된 Tris-buffer 로같은양으로첨가하여실온에서 10분간반응시킨후 lysozyme(200 μg/ml) 을첨가하고 10분반응시킨후 Tris-HCl (10 mm, ph8.0) buffer 을 1:1 비율로첨가한후에 20 mm의 EDTA 를처리하여 37 에서 4시간동안반응시켰다. Spherolast 가형성되는각과정은일부세균을덜어내 1% agarose 로코팅한후 Axioscope A1(Carl zeiss, Germany) 현미경으로관찰하고현미경에연결된 CCD 카메라로촬영하였다. 5. spy-gfp 의전사량측정 spy-gfp 융합플라스미드를보유하는 S. Enteritidis 와 S. Gallinarum 을 LB 영양배지에서밤새배양 210 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 한다음, 새로운 LB 영양배지에서 1:1,000 으로희석해접종하여 37, 220 rpm의진탕배양기에서대수기인 O.D 600nm =0.4이될때까지배양한후, 세포를 4% 에탄올 (ethanol) 과각균주에서가장높은 spy-gfp 유도를보여주는농도로 polymyxin B를처리후 1시간추가로더배양하였다. 4% 에탄올이나 polymyxin B를처리하기전배양액과처리한후의배양액을원심분리하여 PBS(phosphate buffer saline, ph 7.0) 로 2번세척후 Black 96-well plate(spl, Korea) 에서각세균액 (OD 600nm =1.0) 의형광강도를 DTX 880 microplate reader(485 nm excitation 과 535 nm emission; Beckmna Coulter, USA) 로측정하였다. 결과 1. spy-gfp 오페론융합플라스미드의특성살모넬라내에서 spy 유전자전사를조사하기위한 spy-gfp 오페론융합플라스미드를제작하였다. 기존에제작된 spy-gfp fusion 1은 spy 유전자의 promoter 부위와구조유전자전체를포함한반면 (Jeong et al., 2017), 본연구에서제작된 spy-gfp fusion 2는재료및방법에서서술한것처럼 spy 유전자의 promoter 부위만을포함하였다. 먼저 S. Typhimurium 14028s 에 spy-gfp fusion 1, 2를각각형질전환시켜이들의대수기와정지기에서 spy-gfp 전사의발현량을통한차이를확인할수있었다. spy-gfp 1에비해 spy-gfp 2는균주의대수기와정지기모두발현량이큰것으로확인되었다 (Fig. 1). 이결과는 S. Enteritidis 와 S. Gallinarum 에서도마찬가지인것으로나타났으며, 이것은이살모넬라형청형들사이에유사한 spy 유전자전사체계를가지고있음을보여준다. spy-gfp fusion 2가포함된균주는대수기와정지기에서모두큰발현량을나타내기때문에, 이후세포막스트레스에대한 spy 유전자전사의유도를관찰하기가어려웠으며, spy-gfp fusion 1을사용하여이후연구에사용하였다. 2. Polymyxin B는 S. Enteritidis 와 S. Gallinarum 내의 spy 전사를유도한다. 세균막을훼손하는항생제인 polymyxin B에대한 S. Enteritidis 와 S. Gallinarum spy 유전자의전사유도를측정하기위해 spy-gfp 오페론융합플라스미드를가진 S. Enteritidis 와 S. Gallinarum 균주들의 polymyxin B에대한감수성을먼저측정하였다. LB 영양배지에서 polymyxin B 를농도별로처리하 Fig. 1. The spy transcription monitored by GFP fluorescence expressed in S. Typhimurium harboring spy-gfp operon fusions. Salmonella cells cultured to log-phase (O.D. 600nm =0.4) and stationaryphase (24hr) were washed with PBS before measuring the fluorescence intensity. The fluorescence of same amount of cells (O.D. 600nm =1.0) were measured by a microplate reader as described in the materials and methods section. Data shown are the means with standard deviation from three independent experiments. J Milk Sci Biotechnol Vol. 36, No. 4 211
Kang and Bang 여성장곡선을관찰하였고, 그결과균주별로성장이지연되는농도가달랐다. S. Enteritidis 는 2 μg/ml 에서 (Fig. 2A), S. Gallinarum 에서는 6 μg/ml 의농도로처리하였을때 (Fig. 2B), 균주의성장률이크게감소하는것을확인하였고, 더높은농도에서는모든세균의성장이관찰되지않았다. 세균성장이지연되는농도를 spy 유전자전사량측정에사용하였다. spy-gfp 오페론융합플라스미드를가진 S. Enteritidis/ p spy-gfp 와 S. Gallinarum/ p spy-gfp 에서형광도를측정한결과, 각 LB 영양배지에서대수기 (OD 600nm =0.4) 까지배양한균주에서는발현하지않는것을확인하였고, 아무것도처리하지않은균주에비해 polymyxin B 를처리한균주들에서 spy-gfp 의발현이크게증가하는것을하였다 (Fig. 3). S. Enteritidis 의경우 1 μg/ml 및 2 μg/ml 농도의 polymyxin B에의해각각 3.9배, 13.8배, S. Gallinarum 의경우 3 μg/ml 및 6 μg/ml 농도의 polymyxin B에의해 1.6배, 2배증가하는것을확인하였다. 3. S. Enteritidis 와 S. Gallinarum 의 spheroplast 형성시 spy 전사가크게유도된다. S. Enteritidis 와 S. Gallinarum 균주들이 spheroplast 를형성할때 Spy 의발현이유도되는지확인하기 Fig. 2. The effect of polymyxin B on the growth rates of S. Enteritidis (A) and S. Gallinarum (B) harouring spy-gfp fusion. The growth of Salmonella cells were monitored in the absence (UT) and presence of various concentrations of polymyxin B. Data are representatives of three independent experiments. 212 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 Fig. 3. Induction of the spy-gfp transcription in S. Enteritidis (A) and S. Gallinarum (B) by the polymyxin B treatment. Salmonella cells cultured to log-phase (O.D. 600nm =0.4) were treated with various concentrations of polymyxin B for one hour. Polymyxin B treated and untreated (UT) cells were washed with PBS and same amount of cells (O.D. 600nm =1.0) were subjected to measurement of their fluorescence intensities. 위해 spy-gfp 오페론융합플라스미드를보유하는 S. Enteritidis 와 S. Gallinarum 을이용하여 spheroplast 형성시 GFP의발현을확인하였다. Spheroplast 형성과정중, sucrose 와 lysozyme 처리까지하였을때는 spheroplast 가뚜렷하게형성되지않았고, sucrose, lysozyme, EDTA 를모두처리한경우 spheroplast 가형성되었으며, 이때에 GFP 발현이크게증가하는것을확인할수있었다 (Fig. 4A와 Fig. 5A). 하지만, sucrose 와 lysozyme 및 EDTA 를각각처리했을때는 GFP의발현을볼수없었다 (data not shown). 이결과는 sucrose 에의한삼투압에대한노출, lysozyme 에의한펩티도글리칸의용해, 그리고 EDTA 에의한세포막의약화를통한순차적 spheroplast 형성이완성될때만 S. Enteritidis 와 S. Gallinarum 에서 spy 전사가유도될수있음을보여준다. 4. S. Enteritidis 와 S. Gallinarum 의세균막스트레스에의한 spy 전사유도는 CpxR과 BaeR에의존적이다. E. coli 와 S. Typhimurium 의 spy 유전자전사유도는이인자신호전달체계인 CpxRA 와 BaeSR 에의해서조절이되는것으로알려졌다 (Bury-Mone et al., 2009; Jeong et al., 2017), S. Enteritidis 와 S. Gallinarum 에서도이들체계가관련되는지확인하였다. 두혈청형모두 cpxr 과 baer 이결손된돌연변이균주에 polymyxin B를처리했을때대조군 (WT) 에비해서 spy-gfp 발현이거의되지않는것을확인하였다 (Fig. 6). 이실험에서는세균막에스트레스를주는두번째요인으로 4% 에탄올을처리하여 S. Enteritidis 와 S. Gallinarum 에서 spy 전사가증가하는것을확인하였고, 이전사유도는 cpxr 과 baer J Milk Sci Biotechnol Vol. 36, No. 4 213
Kang and Bang Fig. 4. Induction of the spy-gfp transcription in the spheroplasts of S. Enteritidis. (A) To visualize WT S. Enteritidis harboring the spy-gfp fusion during spheroplast formation, cell aliquots were collected at each step during cumulative treatments with sucrose, lysozyme, and EDTA, respectively. To normalize the incubation time for all samples, cell aliquots collected before EDTA treatment were further incubated to reach the same time as taken for the complete spheroplasting prior to microscopy. (B) Bacterial images from the spheroplast of baer and cpxr mutant S. Enteritidis harboring spy-gfp fusions. All images are representatives of at least three independent experiments. Fig. 5. Induction of the spy-gfp transcription in the spheroplasts of S. Gallinarum. All experiments and data presentation were performed essentially as described in the legend for Fig. 4. 214 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 Fig. 6. BaeR and CpxR dependent spy transcription in S. Enteritidis (A) and S. Gallinarum (B) under membrane disrupting conditions. Salmonella cells cultured to log-phase (O.D. 600nm =0.4) were treated with ethanol (4%) and polymyxin B [2 μg/ml for S. Enteritidis (A) and 6 μg/ml for S. Gallinarum (B)] for one hour, respectively. Measurement of their fluorescence intensities were performed essentially as described in the legend for Fig. 1. 이결손된돌연변이균주들에서일어나지않았다. 또한, cpxr 과 baer 이결손된돌연변이균주들의 spheroplast 형성과정에서도 spy 유전자전사유도는관찰되지않았다 (Fig. 4B 와 Fig. 5B). 이결과들은 polymyxin B와에탄올등의세균막훼손요인과 spheroplast 형성과정동안생기는막스트레스들에인해 S. Enteritidis 와 S. Gallinarum 의 spy 유전자발현이크게증가하고, 이유도과정에 CpxR과 BaeR의역할이필수적임을보여준다. 고찰 본연구에서는낙농업및유가공제품생산과유통에서주요한살모넬라감염원으로작용하는혈청형들중 S. Enteritidis 과 S. Gallinarum 의 Spy 발현과정중 spy 유전자전사의유도에있어, 막스트레스의필요성및유전자전사유도에참여하는조절단백질의필요성을처음으로확인하였다. spy 유전자전사의유도를확인하기위해제조한 spy-gfp 융합체들중 promoter 부위만을포함한것은 promoter 뿐아니라, spy 구조유전자전체를포함한것에비해서대수기와정지기에서모두발현량이크게나타나는것으로나타났다 (Fig 1). 이결과는 spy 유전자전사유도과정에있어서 E. coli 에서알려진 Cpx와 Bae시스템이외에다른조절인자의존재가능성을시사하지만, 후속연구를통해밝혀야할것으로생각된다. 본연구에서는 GFP 발현량을모니터함으로써보다손쉽게 S. Enteritidis 과 S. Gallinarum 의막스트레스 -특 J Milk Sci Biotechnol Vol. 36, No. 4 215
Kang and Bang 이적신호를인식할수있는바이오센서의목적으로써 spy-gfp 융합플라스미드를활용하고자하였다. 때문에 spy 유전자전체를포함하는 gfp 융합체의막스트레스반응능력의발견은의미가크다고볼수있다. E. coli 에서처음발견된주변세포질내로의 Spy 단백질의발현현상은이단백질의 chaperone 기능의발견으로더욱주목받고있다 (Hagenmaier et al., 1997; Quan et al., 2011). 대부분세균들은단백질의활성을복구할수있는 chaperone 단백질들을생산하는데, 보통이단백질들은세균이스트레스에노출되었을때세포질내에서발현이크게증가하여세포질내변성된단백질의복구에기여하고, 세균병원성발현에도중요한역할을한다 (Henderson et al., 2006). 주변세포질공간내에서발현하는 chaperone 단백질들또한숙주세포내의다양한환경에서세균의세포외부및숙주세포내로병원성효과단백질 (effector protein) 을분비하는과정을돕고병원성발현을증진시킨다 (Burkinshaw and Strynadka, 2014). 하지만, 이경우는주변세포질내특정분비체계의확립을위한단백질들에한정되어서기능을한다. 이들외에 LolA, SurA, Skp, DegP 등의 chaperone 단백질이주변세포질내단백질들의구조안정화에기여하는것으로알려졌는데, 수선이나복구할수있는대상단백질들의종류가비교적제한적이어서, 이들은세균병원성발현에서그역할이미미한것으로알려졌다 (Rowley et al., 2006). 하지만단백질구조연구를통해확인한 Spy는광범위한기질단백질들의구조안정화에기여할가능성이클것으로예상된다. 실제로, E. coli 의필수외막단백질인 LptD는 Skp와 FkpA chaperone 단백질들에의해서특이적으로그구조가안정되는것으로알려졌는데, skp와 fkpa가결손된균주에서도 Spy가 LptD의기능적인구조를복원하는데충분하게작용하는것으로보고되었다 (Goemans et al., 2014). 현재까지병원성세균의병독성발현에 Spy의역할이보고되지않고있으나, 보통 E. coli가생산하는단백질중약 20% 정도가주변세포질에위치하고, 넓은범위의기질단백질들을수선할것으로예상되는 Spy의발현이세균막스트레스에특이적으로유도된다는점을상기하면, 세균병독성에서 Spy의역할이작지않을것으로예상할수있다. 이러한이유로본연구에서살모넬라의막스트레스인식을위해선택하고확인한살모넬라균의 spy 전사유도현상의발견은그중요성이작지않다고할수있다. 실제로 spy-gfp 발현은살모넬라균에처리된 polymyxin B의양에비례하여증가하였으며 (Fig. 3), spheroplast 형성시에도모든스트레스가귀결되는마지막과정에서발현이크게유도되는것을볼수있다 (Fig. 4와 Fig. 5). 따라서이결과들은 S. Enteritidis 와 S. Gallinarum 의막스트레스정도를분석하는데있어서, 본연구에서사용한 spy-gfp 오페론융합플라스미드가유용하게사용될수있음을시사한다. E. coli 와 S. Typhimurium 에서 Spy의발현은 Cpx과 Bae 두가지스트레스반응시스템에의해전사적으로유도되는것으로알려졌는데 (Srivastava et al., 2014; Jeong et al., 2017), S. Enteritidis 와 S. Gallinarum 에서도이두시스템이 spy 전사유도에필요한것으로확인되었다 (Fig. 4 Fig. 6). 다만 S. Gallinarum 의경우 cpxr 과 baer 의결손돌연변이균주에서도 polymyxin B에대한 spy 의유전자전사가일정부분남아있었다 (Fig. 6). 이는아마도 S. Gallinarum 의 polymyxin B 반응성의차이로판단되며, 더정교한조절시스템의존재가능성또한배제할수없다. 병원성세균의막스트레스에대한적응이나내성에참여하는유전자들은많이존재하고, 이들의발현은전사단계에서유도된다. 이들의전사유도는 Cpx와 Bae 및세포막외부기능 (extracytoplasmic function) 의시그마인자인 RpoE 의세가지전사조절체계들이주도하는것으로알려졌다 (Rowley et al., 2006). E. coli 의 Cpx와 Bae 시스템은막스트레스를감지하는히스티딘인산화효소로작용하는내막단백질인 BaeS와 CpxA 가막스트레스에의해활성화되어인산화되고, 그들의인산기를반응조절인자 BaeR 및 CpxR 로각각전달하여고유의표적유전자들의전사를활성화시킨다. CpxAR 은세균의막스트레스를받을때, BaeSR 은구리 (Cu), 아연 (Zn) 등과같은금속이온스트레스에의한막스트레스로활성화된다. RpoE 는세포질막에위치하는 RseA 단백질에붙잡혀있는상태로존재하다가, 세포질막외부의변성된단백질들의증가에의해 DegS와 RseP 두세포질막단백분해효소에의해 RseA 가분해됨으로써 216 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 세포질내로이동하여표적유전자들의전사를활성화시킨다. 본연구에서는 cpxr 과 baer 결손돌연변이는성공적으로제조하였으나, rpoe 돌연변이를제조하지못하였다. 하지만, S. Typhimurium 을이용한이전연구에서 rpoe 돌연변이가 spy 전사를오히려증가시켰는데, 이는 rpoe 돌연변이에의해더욱증가된막스트레스에의한것으로판단되었고, Cpx와 Bae 체계와는달리 spy 전사유도과정에직접적인영향을주지않는것으로확인되었다 (Jeong et al., 2017). 병원성세균의막스트레스적응반응을크게조절하는 Cpx와 Bae 체계모두 S. Enteritidis 와 S. Gallinarum 의 spy 전사유도에필요하다는발견은두혈청형의막스트레스적응반응또한두체계에크게의존함을보여준다. 또한, 이결과는 Spy의발현과역할이두체계가모두활성화될정도의세균막훼손이필요함을시사하며, 이때 spy-gfp 오페론융합플라스미드는그정도를파악하는데크게유용할것으로사료된다. 요약 낙농업및유가공제품의생산과유통에서살모넬라감염에의한살모넬라증의발생은빈번하며, 이세균의항미생물제제에대한내성증가현상또한지속되고있어새로운항미생물제제의수요는감소하지않는다. 세균막의훼손은세균생존을쉽게위협할수있기때문에개발되는항미생물제제들은주로세균의막을표적으로삼지만, 개발되는제제들이실제로세균막의훼손을초래하는지구별하는것은많은노력과비용을수반한다. 본연구에서는 E. coli 세포막스트레스에의해발현이유도되고, 세균막외부공간에서만위치하며, 그구조상많은단백질의구조안정화에기여할것으로예상되는 chaperone 단백질 Spy(spheroplast protein Y) 의유전자에상응하는살모넬라 spy 유전자에 gfp(green fluorescence protein) 오페론융합체를제조하여, 이융합체가 Salmonella enterica 의두혈청형 Enteritidis 와 Gallinarum 의세포막스트레스를인지하여 GFP 발현량이크게증가하는것을확인하였다. 또한세균막스트레스신호를특이적으로인지하는이인자신호전달체계 (two component signal transduction system) 인 Bae와 Cpx들이두살모넬라혈청형의 spy 유전자전사유도에필수적임을확인하였다. 따라서본연구에서사용한 spy-gfp 오페론융합체는 S. Enteritidis 와 S. Gallinarum 의세포막훼손을특이적이고신속하게인식하는 biosensor 로서활용될수있을것으로판단된다. 감사의글 본연구에사용한 pfpv25 를제공한 Dr. Raphael H. Valdivia 께감사드립니다. 본논문은 2016 학년도 조선대학교학술연구비의지원을받아연구되었습니다. References Birdsell, D. C. and Cota-Robles, E. H. 1967. Production and ultrastructure of lysozyme and ethylenediaminetetraacetate-lysozyme spheroplasts of Escherichia coli. J. Bacteriol. 93: 427-437. Burkinshaw, B. J. and Strynadka, N. C. 2014. Assembly and structure of the T3SS. Biochim. Biophys. Acta. 1843:1649-1463. Bury-Mone, S., Nomane, Y., Reymond, N., Barbet, R., Jacquet, E., Imbeaud, S., Jacq, A. and Bouloc, P. 2009. Global analysis of extracytoplasmic stress signaling in Escherichia coli. PLoS. Genet. 5:e1000651. J Milk Sci Biotechnol Vol. 36, No. 4 217
Kang and Bang Chmielewski, R. A. N. and Frank, J. F. 2003. Biofilm formation and control in food processing facilities. Comprehensive Reviews in Food Science and Food Safety 2:22-32. Cho, Y., Park, Y. M., Barate, A. K., Park, S. Y., Park, H. J., Lee, M. R., Truong, Q. L., Yoon, J. W., Bang, I. S. and Hahn, T. W. 2015. The role of rpos, hmp, and ssrab in Salmonella enterica Gallinarum and evaluation of a triple-deletion mutant as a live vaccine candidate in Lohmann layer chickens. J. Vet. Sci. 16:187-194. Goemans, C., Denoncin, K. and Collet, J. F. 2014. Folding mechanisms of periplasmic proteins. Biochim. Biophys. Acta. 1843:1517-1528. Grassl, G. A. and Finlay, B. B. 2008. Pathogenesis of enteric Salmonella infections. Curr. Opin. Gastroenterol. 24:22-26. Hagenmaier, S., Stierhof, Y. D. and Henning, U. 1997. A new periplasmic protein of Escherichia coli which is synthesized in spheroplasts but not in intact cells. J. Bacteriol. 179:2073-2076. Henderson, B., Allan, E. and Coates, A. R. 2006. Stress wars: The direct role of host and bacterial molecular chaperones in bacterial infection. Infect. Immun. 74:3693-3706. Hur, J., Jawale, C. and Lee, J. H. 2012. Antimicrobial resistance of Salmonella isolated from food animals: A review. Food Research International 45:819-830. Jeong, S. M., Lee, H. J., Park, Y. M., Kim, J. S., Lee, S. D. and Bang, I. S. 2017. Inducible spy transcription acts as a sensor for envelope stress of Salmonella typhimurium. Korean J. Food Sci. Anim. Resour. 37:134-138. Kousta, M., Mataragas, M., Skandamis, P. and Drosinos, E. H. 2010. Prevalence and sources of cheese contamination with pathogens at farm and processing levels. Food Control 21:805-815. Oliver, S. P., Jayarao, B. M. and Almeida, R. A. 2005. Foodborne pathogens in milk and the dairy farm environment: Food safety and public health implications. Foodborne Pathogens and Disease 2:115-129. Quan, S., Koldewey, P., Tapley, T., Kirsch, N., Ruane, K. M., Pfizenmaier, J., Shi, R., Hofmann, S., Foit, L., Ren, G., Jakob, U., Xu, Z., Cygler, M. and Bardwell, J. C. 2011. Genetic selection designed to stabilize proteins uncovers a chaperone called Spy. Nat. Struct. Mol. Biol. 18:262-269. Rowley, G., Spector, M., Kormanec, J. and Roberts, M. 2006. Pushing the envelope: Extracytoplasmic stress responses in bacterial pathogens. Nat. Rev. Microbiol. 4:383-394. Ryan, C. A., Nickels, M. K., Hargrett-Bean, N. T., Potter, M. E., Endo, T., Mayer, L., Langkop, C. W., Gibson, C., McDonald, R. C., Kenney, R. T., Puhr, N. D., McDonnell, P. J., Martin, R. J., Cohen, M. L. and Blake, P. A. 1987. Massive outbreak of antimicrobial-resistant salmonellosis traced to pasteurized milk. JAMA. 258:3269-3274. Srivastava, S. K., Lambadi, P. R., Ghosh, T., Pathania, R. and Navani, N. K. 2014. Genetic regulation of spy gene expression in Escherichia coli in the presence of protein unfolding agent ethanol. Gene 548:142-148. International Commission on Microbiological Specificifications for Foods Staff. 2002. Salmonella in dried milk. Microbiological Testing in Food Safety Management. Boston, MA: Springer US, pp. 273-284. 218 J Milk Sci Biotechnol Vol. 36, No. 4
세균막 - 스트레스인식 spy-gfp 오페론융합체 Sun, J. S. and Hahn, T. W. 2012. Comparative proteomic analysis of Salmonella enterica serovars Enteritidis, Typhimurium and Gallinarum. J. Vet. Med. Sci. 74:285-291. Valdivia, R. H. and Falkow, S. 1996. Bacterial genetics by flow cytometry: Rapid isolation of Salmonella typhimurium acid-inducible promoters by differential fluorescence induction. Mol. Microbiol. 22:367-378. Wales, A. D., Allen, V. M. and Davies, R. H. 2010. Chemical treatment of animal feed and water for the control of Salmonella. Foodborne Pathog. Dis. 7:3-15. Wolf, D. and Mascher, T. 2016. The applied side of antimicrobial peptide-inducible promoters from Firmicutes bacteria: Expression systems and whole-cell biosensors. Appl. Microbiol. Biotechnol. 100:4817-4829. J Milk Sci Biotechnol Vol. 36, No. 4 219