KOREAN J. FOOD COOKERY SCI. Vol. 26, No. 4, pp. 469~474 (2010) CKDHC 0801 과 CKDHC 0802 균주를이용한홍삼발효 신용서종근당건강 연구소 Fermentation of Red Ginseng using CKDHC 0801 and CKDHC 0802 Yong-Seo Shin Chong Kun Dang Healthcare Corp. Research Center Abstract In this study, we isolated two species of bacteria for the powerful biotrasnformation of ginsenosides from Kimchi and human feces. Using biochemical tests and 16s rrna sequencing, the selected strains were identified as Latobacillusplantarum (CKDHC0801) and Lactobacillussakei (CKDHC0802). Changes in cell growth and ph were examined in red ginseng. CKDHC 0801 and CKDHC 0802 reached their maximum growth phase after 24 hr and 48 hr, respectively, whereas the combined culture of CKDHC 0801 and CKDHC 0802 showed higher cell growth than bacterial strain alone. During fermentation of CKDHC 0801 and the combined culture, the ph values decreased from 5.2 to 4.2 after 24 hr, but CKDHC 0802 reached ph of 4.2 after 3day. The identities of ginsenosides were biotransferred from high molecular (Rg1 and Rb2) to low molecular (Rg3, Rg5, Rk1, PPD) by fermentation of both bacteria. Therefore, the results of this study demonstrate that CKDHC 0801 and CKDHC 0802 could be used to enhance to effects of red ginseng. Key words: fermentation, red ginseng, biotransforming, Lac. plantarum, Lac. sakei I. 서론 인삼은동양에서수천년동안식품과의약적가치로널리사용되어왔다. 사포닌계열인 ginsenoside 는항암, 항염, 항스트레스그리고항산화등인삼의다양한효과를나타내는주요성분으로알려져있다 (Park EK 등 2005, Cho WC 등 2006, Lee SH 등 2006). 최근연구결과를보면, ginsenoside 의약리효과가치매와항당뇨에좋은효과를보였으며 (Heo JH 등 2008, Vuksan V 등 2008), 소화기관손상억제효과 (Xia ZY 등 2005) 와관절염예방효과 (Kim KR 등 2010) 를나타내는것으로보고되었다. 구강으로섭취된대부분의천연약물들은대장에존재하는미생물에의하여생물학적변환을거치고체내에흡수되어그효능을나타낸다 (Akao T 등 1998). 따라서인체의장내미생물들에의한천연물의대사산물에대한연구는천연물의효능규명에있어서매우중요하다 (Kim DH 등 1998). 연구보고에의하면인삼사포닌인 ginsenoside 가소화기관내의효소, 산그리고장내미생물에의해전환이일어남을알수있으며, 이러한전환을통하여 ginsenoside 배당체가분해되어체내에흡수되는것으로밝혀졌다 (Hasegawa H 등 1996, Akao T 등 1998). 특히인삼에대하여생물전환율이높은균주의탐색에대한보고가있다 (Bae EA 등 2003, Rowe GE 등 2004, Chi H 등 2005). 발효인삼은유익균주를공급할수있는장점과동시에 ginsenosides 배당체의당을분해하여고효율의사포닌을섭취할수있는장점이있다 (Kim HG 등 2007). 우리나라의대표적인전통발효식품인김치는발효에관여하는다양한유용유산균을다량함유하고있다 (Lee HJ 등 1993). 따라서, 본연구에서는유용한미생물을김치및사람의분변에서분리하고, 이를이용하여홍삼을발효하여사포닌의생물학적전환을통하여영양학적, 기능적가치를높이고자한다. Corresponding author: Yong-Seo Shin, Chong Kun Dang Healthcare Corp. Research Center Tel: 041-357-6699 Fax: 041-357-9474 E-mail: freeminde@paran.com 1. 균주분리 II. 재료및방법 469
470 신용서 가정에서담근잘익은배추김치와건강한성인 5 명으로부터분변을수집하여균일하게교반한후에멸균거즈로여과하였다. 여과액을멸균수를이용하여단계적으로희석한후에 100 ul 를취하여 MRS(Difco Laboratories, MI, USA)-BCP(Bromocresol Purple) 한천배지 (1.5% agar) 에도말하여 30 에서배양하였다. 투명환을나타내는균들을분리하여재배양하였다. 2. 홍삼첨가배지제조 홍삼분말을첨가한배지는홍삼 ( 금산, 6 년근 ) 을사용하였으며, 홍삼을수세한후 70 에서건조한후분쇄기로분말화하였다. 이렇게얻어진홍삼분말은멸균수와혼합하여액체배지 (2.5%, w/v, 1%, w/v) 를만들었고, 121, 1.5 기압, 15 분간멸균하였다. 3. 생균수측정 생균수는시료 1 ml 를멸균생리식염수 9 ml 에희석하고잘섞은후단계별로희석한다음 1 ml 을취하여 glucose 함량을 1% 로높인표준한천배지에접종하여잘혼합하여도말한후혐기성상자 (BBL Gas Pak Anaerobic System) 에넣고 37 에서 48 시간배양한후생성된집락수를계측하고그평균집락수에희석배수를곱하여배양액 ml 당생균수를산출하였다. 4. 발효홍삼제조에적합한유산균주선정 김치에서분리된유산균들 (1.0 10 6 CFU/mL) 을이용하여홍삼분말배지에배양한결과생균수가약 1.0 10 8 CFU/mL이상인균주들을홍삼을잘이용할수있는유산균주로선정하였다. 5. 분리균주의동정 발효홍삼배지에서생육이좋은균주의동정을위하여일차적으로형태학적, 생화학적특성을조사하였다. 그람염색및현미경관찰과 API 50 CHL System(BioMerieux, Marcy IEtoile, France) 을이용하여당발효능을조사한후에균주동정프로그램을이용하여균주를동정하였다. 분리균주의 16S rrna 염기서열은프라이머 8F (AGAGTTTGATCCTGGCTCAG, 서열번호 3) 와 1514R (AAGGAGGTGATCCAGCC, 서열번호 4) 을사용하여 PCR 을이용하여증폭하고, 최종동정하였다. 6. 선별된균주를이용한홍삼발효물제조 홍삼분말 50 g 에물 450 ml 를가하고, 90 에서 1 시간동안멸균한다음, 선별된균주 2 종을약 5% 의농도로접종한후, 37 에서 3 일동안교반하면서감압배양하였다. 얻어진배양액을 75 에서 24 시간동안숙성및 멸균처리하였다. 7. HPLC 를통한 ginsenoside 분석 사포닌함량측정은시료 5 g 을 HPLC 용메탄올로녹여낸후 0.45 µm 의필터로여과하여 HPLC 를이용하여사포닌조성을분석하였다. 이때컬럼은 µ-bondapak C18 Column(10 µm, 3.9 300 cm, Water) 을이용하였으며다음과같은조건으로수행하였다. 검출기는 Jasco UV detector(302 nm) 를사용하였다. 이동상으로는물 (A) 과 acetonitrilie(b) 의 gradient system 을사용하였으며 A 를기준으로 80%(0 분 ), 80%(20 분 ), 70%(40 분 ), 55%(60 분 ), 20%(80 분 ), 0%(90 분 ), 20%(100 분 ) 이었다. 이동상의유속은분당 1.8 ml 이었으며, 시료주입량은 10 µl, 분석온도는 30 이었다. III. 결과및고찰 1. 김치및분변에서의균주분리및동정 수집된시료를도말한 MRS 배지에서유의한수준의집락이형성될때까지 24~48 시간동안배양하였다. 단일집락으로구분할수있도록희석한농도의배지에서균주집락을선별하였다. 이때균주의선별기준은원래배지의색인보라색이균주의젖산형성을통해노란색의집락및경계를형성하는것으로하였다. 선택된집락들은다시 MRS-BCP 평판배지에계대배양하여단일집락임을다시확인하였다. 특히, 단일집락으로확인된균주들가운데홍삼분말배지에서생육이높은미생물 2 종 (CKDHC 0801 및 CKDHC 0802) 을선별하였다. CKDHC 0801 은사람의장내에서분리된균주이고, CKDHC 0802 는김치액에서분리된균주이다. 최근연구보고에의하면 (Park S 등 2006) 일부유산균의경우인삼또는홍삼을배지에첨가하고배양했을때농도의존적으로생육이더욱촉진되는균주가있음이확인되었다. 본연구에서, 일반 MRS 배지에서시험균주는두균주모두가 24 시간이내에성장의최종점에도달했으며, CKDHC 0801 이 CKDHC 0802 보다더높은성장률을보였다 (Fig. 1(a)). 반면, 홍삼배지에서는 CKDHC 0801 이 24 시간에최고생육도를보였으나, CKDHC 0802 균주는 48 시간에서성장이급속하게높아지는것을확인하였다. 또한두균주를혼합하여배양한경우에는 24 시간만에높은생육도를나타냈다 (Fig. 1(b)). 홍삼배지에서두균주의생육도차이는당의이용능에대한차이에의해서나타나는것으로사료된다. 즉, 선별된 2 개의균주에대해서 API 50 CHL kit (BioMerieux, France) 를이용하여 49 종의당에대한발효검사를실시한결과 CKDHC 0801 의균주가발효에이용되는당이더많은것으로밝혀졌다 (Table 1). 한국식품조리과학회지제 26 권제 4 호 (2010)
CKDHC 0801 과 CKDHC 0802 균주를이용한홍삼발효 471 Fig. 1. Growth of Lactobacillus plantarum (CKDHC 0801, LP) and Lactobacillus sake i(ckdhc 0802, LS) in MRS borth (a) or red ginseng broth (b). All values were mean±s.d. (n=3). Table 1. Carbohydrate utilization profile of the CKDHC 0801 & 0802 isolate, as determined using the API 50 CHB system Characteristics CKDHC CKDHC Characteristics 0801 0802 0801 0802 Glycerol - - Salicin + - Erythritol - - D-Cellobiose + - D-Arabinose - - D-Maltose + + L-Arabinose + + D-Lactose + - D-Ribose + + D-Melibiose + + D-Xylose - - D-Saccharose + + L-Xylose - - D-Trehalose + + D-Adonitol - - Inulin + - Methyl-β-D-Xylopyranoside - - D-Melezitose + - D-Galactose + + D-Raffinose + - D-Glucose + + Amidon (starch) - - D-Fructoe + + Glycogen - - D-Mannose + + Xylitol - - L-Sorbose - - Gentiobiose + + L-Rhamnose - - D-Turanose - - Dulcitol - - D-Lyxose - - Inositol - - D-Tagatose - - D-Mannitol + - D-Fucose - - D-Sorbitol + - L-Fucose - - a-methyl-d-mannoside + - D-Arabitol - - a-methyl-d-glucoside - - L-Arabitol - - N-Acetylglucosamine + + Potassium Gluconate - - Amygdalin + - Potassium 2-Ketogluconate - - Arbutin + - Potassium 5-Ketogluconate - - Esculin ferric citrate - - +, positive; -, negative. Korean J. Food Cookery Sci. Vol. 26, No. 4 (2010)
472 신용서 Fig. 3. HPLC chromatogram of the ginsenoside standards. 이는 CKDHC 0801 이당에대한이용율이높아생육에있어서 CKDHC 0802 보다먼저최고생육도에이르는것을알수있다. CKDHC 0802 의경우에는 ph 에민감하다는보고가 (Leroy F 등 2001) 있어두균주의생육에따른 ph 변화를관찰한결과 CKDHC 0801 과두균주를혼합하여배양한경우에는 24 시간만에 ph 의급감이나타나 4.5 이하로낮아진반면에, CKDHC 0802 의균주는배양후 48 시간후에야 ph 4.5 로낮아짐을알수있었다 (Fig. 2). 이결과는박등이유산균을이용한백삼및홍삼을첨가한발효에의해 ph 가배양후 24 시간에서 3.42~ 4.30 으로낮아진다는보고와일치한다 (Park S 등 2006). Fig. 2. ph of CKDHC 0801 and CKDHC 0802 in red ginseng broth. 2. 16S rrna 유전자염기서열분석에의한분리균주의동정 CKDHC 0801 및 CKDHC 0802의 16S rrna 서열을결정하여각각 1,474 bp 및 1,455 bp로이를 GenBank에등록된표준균주 (type strain) 나참고균주 (reference strain) 의 16S rrna gene 염기서열들과상동성을비교하였다. 그결과 CKDHC 0801 균주는 Lactobacillus plantarum에속하고, CKDHC 0802 균주는 Lactobacillus sakei에속하는새로운균주로판명되었다. 판명된두균주는한국미생물보존센터에기탁하고, 기탁번호 KFCC 11434P 및 KFCC 11435P를부여받았다. 3. 분리균주를이용한홍삼발효후 ginsenoside 전환분리된미생물을이용하여홍삼추출물 10 g에물 90 ml를가하고, 85 에서멸균한다음, 미생물을약 5% 의농도로접종한후, 37 에서 2일동안배양하였다. 얻어진배양액을 85 에서 24시간동안숙성및멸균처리한다음, HPLC로 ginsenoside의전환양상을분석하였다. HPLC로 11종의사포닌표준품을이용하여확인하였으며 (Fig. 3), 발효전과발효후의사포닌함량을분석한결과 Rg1, Rh1, Rb1, Rb2 등과같은고분자의사포닌들은감소하고, Rh1, Rg3, Rg5+Rk1, PPD 등저분자의대사체사포닌은증가함을확인하였다 (Table 2). 최근에연구된많은보고에의하면, ginsenoside가체내에서장내의미생물에의해서전환되어지고, 이과정에서저분자화된구조들이흡수되어그효능을나타내는것을알려져있다 (Odani T 등 1983, Strombom J 등 1985, Karikura M 등 1990, Hasegawa H 등 1996, Akao T 등 1998). 본연구는김치및인체분변에서홍삼이용률이높은균주를분리동정하였고, 이들균주를이용하여홍 한국식품조리과학회지제 26 권제 4 호 (2010)
CKDHC 0801 과 CKDHC 0802 균주를이용한홍삼발효 473 Table 2. The change of content ginsenoside in Red ginseng and Fermented red ginseng Compound Red ginseng Fermented red ginseng Area(uV.min) Concentration(mg/g) Area(uV.min) Concentration(mg/g) Rg1 12,909 11.21 821 0.71 Re - - 441 0.11 Rh1(S) 1,976 1.27 2,124 1.36 Rh1(R) 7,957-586 - Rb1 4,324 5.30 1,146 1.40 Rb2 2,970 3.54 - - Rg3(S) 549 0.44 4,674 3.75 Rg3(R) 1,202 0.87 6,883 4.97 Rk1 1,204 6,100 0.911 Rg5 753 12,109 14.64 PPD 3,828 0.50 5,678 0.75 삼을발효한결과홍삼의알려진주요활성성분, ginsenoside 가저분자로전환되는것을확인하였다. 따라서이들균주를이용한발효홍삼은체내에흡수되기쉬운형태로써홍삼의효능을증진시킬수있을것으로기대된다. IV. 요약 김치와사람의분변에서 ginsenoside 전환이높은균주 2 종을분리하였다. 분리된균주는형태학적, 생화학적특성조사와 16S rrna 염기서열결정을통한균주동정결과 Lactobacillus plantarum 과 Lactobacillus sakei 로밝혀졌고이를각각 CKDHC 0801 및 CKDHC 0802 로명명하였다. 두균주의홍삼배지에서의생육도를관찰한결과 CKDHC 0801 은 24 시간에 CKDHC 0802 는 48 시간에최고성장도를보였다. 특히두균주를혼합하여홍삼배지에배양시더욱높은성장률을나타냄으로써홍삼을발효하기에적합한균주임을확인하였다. 당이용율을살펴본결과 CKDHC 0801 이더높게나타났다. ph 변화측정결과 CKDHC 0801 과두개의균주를혼합배양한경우에는배양후 24 시간에서 48 시간사이에 5.2 에서 4.2 로낮아졌으나, CKDHC 0802 는배양후 3 일후에야 ph 4.2 수준으로낮아졌다. 이균주들을이용한홍삼발효는 ginsenoside 의조성이고분자인 Rg1, Rb1 등에서저분자인 Rg3, Rg5+Rk1 등으로전환되어지는것을확인하였다. 이를통해서이두가지의균주를이용한발효홍삼은홍삼의효능을증진시킬수있는좋은사용예가될것으로사료된다. 참고문헌 Akao T, Kanaoka M, Kobashi K. 1998. Appearance of compound K, a major metabolite of ginsenoside Rb1 by intestinal bacteria, in rat plasma after oral administrationmeasurement of compound K by enzyme immunoassay. Biol. Pharm. Bull. 21(3):245-249 Bae EA, Kim NY, Han MJ, Choo MK, Kim DH. 2003. Transformation of ginsenosides to compounds K (IH-901) by latic acid bacteria of human intestine. J. Microbiol. Biotechnol. 13:9-14 Chi H, Kim DH, Ji GE. 2005. Transformation of ginsenosides Rb2 and Rc from Panax ginseng by food microorganisms. Biol. Pharm. Bull. 28(11):2102-2105 Cho WC, Chung WS, Lee SK, Leung AW, Cheng CH, Yue KK. 2006. Ginsenoside Re of Panax ginseng possesses significant antioxidant and antihyperlipidemic efficacies in streptozotocin-induced diabetic rats. Eur. J. Pharmacol. 550: 173-179 Hasegawa H, Sung J-H, Matsumiya S, and Uchiyama M (1996) Main ginseng matabolites formed by intestinal bacteria. Planta. Med. 62:453-455 Heo JH, Lee ST, Chu K, Oh MJ, Park HJ, Shim JY, Kim M. 2008. An open-label trial of Korean red ginseng as an adjuvant treatment for cognitive impairment in patients with Alzheimer's disease. Eur. J. Neurol. 15(8):865-868 Karikura M, Miyase T, Tanizawa H, Takino Y, Taniyama T, Hayashi T. Studies on absorption, distribution, excretion and metabolism of ginseng saponins. V. The decomposition products of ginsenoside Rb2 in the large intestine of rats. Chem. Pharm. Bull. 1990 38(10):2859-2861 Kim KR, Chung TY, Shin H, Son SH, Park KK, Choi JH, Chung WY. 2010. Red Ginseng Saponin Extract Attenuates Murine Collagen-Induced Arthritis by Reducing Pro-inflammatory Responses and Matrix Metalloproteinase-3 Expression. Biological & Pharmaceutical Bulletin 33(4):604-610 Kim DH, Yu KW, Bae EA, Park HJ, Choi JW. 1998. Metabolism of kalopanaxsaponin B and H by human intestinal Korean J. Food Cookery Sci. Vol. 26, No. 4 (2010)
474 신용서 bacteria and antidiabetic activity of their metabolites. Biol. Pharm. Bull. 21(4):360-365 Kim HG, Kim KY, Cha CJ. 2007. Screening for ginsengfermenting microoragnisms capable of biotransforming ginsenosides. Kor. J. Microbiol. 43(2):142-146 Lee HJ, Baek JH, Yang M, Han HU, Ko YD, Kim HJ. 1993. Characterizations of lactic acid bacterial community during kimchi fermentation by temperature downshift. Kor. J. Microbiol. 31:346-353 Lee SH, Jung BH, Kim SY, Lee EH, Chung BC. 2006. The antistress effect of ginseng total saponin and ginsenoside Rg3 and Rb1 evaluated by brain polyamine level under immobilization stress. Pharmacol. Res. 54(1):46-49 Leroy F, Luc DV. 2001. Growth of the bacterioncin-producing Lactobacillus sakei strain CTC 494 in MRS broth is strongly induced nutrient exhaustion: a nutrient depletion model for the growth of lactic acid bacteria. Applied and Environmental Microbiol. 67:4407-4413 Odani T, Tanizawa H, Takino Y. 1983. Studies on the absorption, distribution, excretion and metabolism of ginseng saponins. II. The absorption, distribution and excretion of ginsenoside Rg1 in the rat. Chem. Pharm. Bull. 31(1):292-298 Park EK, Shin YW, Lee HU, Kim SS, Lee YC, Lee BY, Kim DH. 2005. Inhibitory effect of ginsenoside Rb1 and compound K on NO and prostaglandin E2 biosyntheses of RAW264.7 cells induced by lipopolysaccharide. Biol. Pharm. Bull. 28(4):652-656 Park S, Kim DH, Paek NS, Kim SS. 2006. Preparation and quality characteristics of the fermentation product of ginseng by lactic acid bacteria (FGL). J. Ginseng Res. 30:88-94 Rowe GE, Margaritis A. 2004. Enzyme kinetic properties of α- 1,4-glucosidase in Bacillus thuringiensis. Biochemical Engineering Journal. 17(2):121-128 Strömbom J, Sandberg F, Denckér L. 1985. Studies on absorption and distribution of ginsenoside Rg-1 by whole-body autoradiography and chromatography. Acta. Pharm. Suec. 22(3):113-22 Vuksan V, Sung MK, Sievenpiper JL, Stavro PM, Jenkins AL, Di Buono M, Lee KS, Leiter LA, Nam KY, Arnason JT, Choi M, Naeem A. 2008. Korean red ginseng (Panax ginseng) improves glucose and insulin regulation in wellcontrolled, type 2 diabetes: results of a randomized, doubleblind, placebo-controlled study of efficacy and safety. Nutr. Metab. Cardiovasc. Dis. 18(1):46-56 Xia ZY, Liu XY, Zhan LY, He YH, Luo T, Xia Z. 2005. Ginsenosides compound (shen-fu) attenuates gastrointestinal injury and inhibits inflammatory response after cardiopulmonary bypass in patients with congenital heart disease. J. Thorac. Cardiovasc. Surg. 130(2):258-264 2010 년 7 월 16 일접수 ; 2010 년 8 월 13 일심사 ( 수정 ); 2010 년 8 월 13 일채택 한국식품조리과학회지제 26 권제 4 호 (2010)