한수지 50(6), , 2017 Original Article Korean J Fish Aquat Sci 50(6), ,2017 해삼 (Stichopus japonicus) 의 microsatellite 유전자형분석을위한 multiplex PCR
|
|
- 창기 국
- 6 years ago
- Views:
Transcription
1 한수지 50(6), , 2017 Original Article Korean J Fish Aquat Sci 50(6), ,2017 해삼 (Stichopus japonicus) 의 microsatellite 유전자형분석을위한 multiplex PCR 시스템개발 심용택 * 이철상 1 * midna 유전체연구소, 1 군산대학교생물학과 Development of a Multiplex PCR System for Microsatellite Genotyping of the Sea Cucumber Stichopus japonicus Yong-Teak Sim* and Chul-Sang Lee 1 * midna Genome Research institute, Kunsan 54156, Korea 1 Department of Biology, Kunsan National University, Kunsan 54150, Korea A multiplex PCR system comprising 14 microsatellite markers was developed for genotyping analysis of the sea cucumber Stichopus japonicus. A total of 286 samples were used to evaluate genetic polymorphisms and forensic parameters of the microsatellite loci. In a single PCR reaction, all 14 loci were uniformly amplified and a total of 269 alleles were identified. The AJ19024 locus had the largest number of alleles (46), and its discriminatory power and exclusion power were 0.99 and 0.76, respectively. The fewest alleles (8) were present at the Psj2575 locus, which provided the lowest discriminatory power (0.81) and exclusion power (0.20). The mean number of alleles, mean heterozygosity, mean discrimination power and mean exclusion power per locus were 19.21, 0.70, 0.93, and 0.46, respectively. The combined matching probability for the 14 loci was , and the combined power of exclusion was Thus, the forensic parameters evaluated in the present study demonstrated the utility of our multiplex PCR system for biological tracing methods, such as individual identification and paternity testing, in the sea cucumber. Key words: Sea Cucumber, Stichopus japonicus, Multiplex, Microsatellite, Identification 서론 (sea cucumber) 1, (Paulay, 2014). (Stichopus japonicus),, (Park et al., 2013). (Kim and Lee, 2016), (Purcell et al., 2016).,. DNA microsatellite (polymorphism) (Jeffreys et al., 1985). Kanno et al. (2005) Psj microsatellite 20, Zhan et al. (2007) Chen et al. (2013),, AH AJ microsatellite 45. Kanno et al. (2005) Psj microsatellite 9 (Kim et al., 2008). microsatellite, (Kang et al., 2011). Korean J Fish Aquat Sci 50(6) , December 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 6 November 2017; Revised 27 November 2017; Accepted 12 December 2017 *Corresponding author: Tel: Fax: address: Loud2004@kunsan.ac.kr Copyright 2017 The Korean Society of Fisheries and Aquatic Science 806 pissn: , eissn:
2 해삼의초미니위성유전자형분석 807 microsatellite PCR 1-3,. DNA microsatellite PCR 10 (multiplex PCR) (Krenke et al., 2002)., PCR stutter peak (primer) (Berg et al., 2000). (Hill et al., 2009). DNA microsatellite multiplex PCR (combined power of discrimination) (combined power of exclusion) (Turrina et al., 2014). (Stichopus japonicus) DNA microsatellite, AH075, AH204, AH025, AH198, AJ19270, AH028, AJ03, AJ78245, AJ08658, Psj2575, Psj2409, AJ14707, AJ19024 AH144 multiplex PCR, 286,. 재료및방법 시료의수집및 DNA 추출 70, 70, 74, 72. DNA 2 mm Ivanova et al. (2006). Multiplex PCR 과 Genotyping Zhan et al. (2007), Chen et al. (2013), Kanno et al. (2005) microsatellite 8, multiplex, 14. Multiplex PCR DNA ng, hot-start Taq polymerase (Genetbio, Korea) 1 unit, 10X PCR buffer 2 μl, dntp 200 mm, MgCl 2 mm, primer mix 2 μl 15 μl. primer Table 1. PCR GeneAmp PCR System 9700 (Applied Biosystems, USA) , (ramp 50%), (ramp 60%) 30 cycle, μl GeneScan 500 LIZ (Applied Biosystems, USA) Hi-Di Formamide (Thermo Fisher Scientific, USA) 98 1 (denaturation), POP-7 polymer (Thermo Fisher Scientific, USA) 36 cm Applied Biosystems 3130x1 (Applied Biosystems, USA) 60. (genotype) GeneMapper ID v3.1 (Applied Biosystems, USA) 500 LIZ size standard. 법과학적지표의산출 FSTAT (Lausanne University, Switzerland) (gene diversity), (number of alleles) (Goudet, 2001). - (hardy-weinberg equilibrium exact test, HWE) GENEPOP v4.2 dememorization number=10,000, number of batches=5,000 number of iterations per batch=10,000 (Guo and Thompson, 1992). (polymorphism information content), (power of discrimination), (matching probability) (power of exclusion) PowerState v1.2 (Promega, USA) (Tereba, 1999). n i=1 (1-Pdi) 1- n i=1 (1-PEi) (Jones, 1972; Krüger et al., 1968). 결 과 Microsatellite 14 multiplex PCR 14 (Fig. 1). AH025, AH028, AJ19024 (heterozygote) peak 10-30% stutter peak, GeneMapper. stutter peak peak 5%. 286 DNA 14 microsatellite 269, AJ19024
3 808 심용택ㆍ이철상 Table 1. Primer sequences and locus characteristics for microsatellite multiplex PCR system Locus Primer sequence (5' to 3') Repeat Motif Reference AH075 AH204 AH025 AH198 AJ19270 AH028 AJ03 AJ78245 AJ08658 Psj2575 Psj2409 AJ14707 AJ19024 AH144 F 6-FAM-GCAACAACACTGTTTAAGCAGATAA R GTTTCTTCCCACAGCAGAGAGTAATTC F 6-FAM-TTTGGTGATATTCTGGGAGTG R GTTTCTTAAGAAGAGGGGTGCCTATTT F 6-FAM-GTATAGGGCTCTCATACGATCA R GTTTCTTGATATATGACACAAGTCCATAGC F 6-FAMACGTACACGTTTAGCAGAGC R GTTTCTTGATGTGTGTTCTCGGATTTG F VIC-ATTGTCTTCCTTGCCTTCCT R GTTTCTTGGAAACAGAAATGGAACCTG F VIC-TCAGTTCTACAAACATATGTAATCC R GTTTCTTCCAAAGTCGGACGTTATTACC F VIC-GGTATTACATTGTATGGAAGCCTAC R GTTTCTTCGAGTACAAGTACGGAGTTATCTG F NED-GACACATTTTCCTCCATCTCA R GTTTCTTCTCGCTTGAAGACGATGAC F NED-AAGGAGCCACTACGATGACG R ACCGTCAAAACCCACAAAAA F NED-GATGTTTCGCTAAATACATGG R GTTTCTTCGCTCGCTTGGAGAGTAA F NED-TCAATCATAAGGTCCCGAGT R GTTTCTTCGTATTCATGTCCGACAAC F PET-CGGGATGATGACTTTGATTT R GTTTCTGAGTTGATTGCACAAGGTT F PET-TCGTGGAAAAAGTTGGATTTG R GTTTCTTGCTGCTATCGGTCTCTTTCG F PET-TTCCGTTAACGCATATCTCAA R GTTTCTTCTACATTCACGACGGGTGTA (GA)n Zhan et al. (2007) (AG)n Zhan et al. (2007) (AG)n Zhan et al. (2007) (AC)n..(AC)n Zhan et al. (2007) (TCC)n Chen et al. (2013) (TA)n(GA)n..(GA)n Zhan et al. (2007) (AC)n Zhan et al. (2007) (TCT)n Chen et al. (2013) (TGT)n Chen et al. (2013) (CA)n Kanno et al. (2005) (CA)n(AT)n Kanno et al. (2005) (GAG)n Chen et al. (2013) (GAA))n Chen et al. (2013) (AG)n Zhan et al. (2007) 46, 0.89, 0.95, 0.95, 0.99, (Table 2). Psj , 0.58, HWE AH204 AH144 p = HWE., AH , 고 찰 stutter peak. Stutter peak (Arif et al., 2010). Stutter peak DNA microsatellite 1-2 slippage (Walsh et al., 1996). 2 AH025, AH028, AJ stutter peak peak 30-44% (Bacher et al., 2004). stutter peak
4 해삼의초미니위성유전자형분석 809 Fig. 1. Capillary electrophoretic separation of the fourteen-microsatellite multiplex PCR. Electrophoresis was carried out under POP -7 polymer and the sequences were analyzed by ABI 3130xl Genetic Analyzer. The blue line (FAM): AH075, AH204, AH025 and AH198; green line (VIC): AJ19270, AH028 and AJ03; black line (NED): AJ78245, AJ08658, Psj2575 and Psj2409; red line (PET): AJ14707, AJ19024 and AH144. Table 2. Forensic parameters of 14 microsatellite loci in sea cucumber Stichopus japonicus (n=286) na He obs GD PIC PD MP PE HWE AH <0.01 AH AH AH <0.01 AJ <0.01 AH <0.01 AJ <0.01 AJ <0.01 AJ Psj <0.01 Psj <0.01 AJ <0.01 AJ <0.01 AH na, Number of observed alleles; He obs, Observed heterozygosity; GD, Gene diversity; PIC, Polymorphism information content; PD, Power of discrimination; MP, Matching probability; PE, Power of exclusion; HWE, Hardy-Weinberg equilibrium exact test. stutter peak. HWE AH204 AH144.. HWE (genetic drift). 14 microsatellite 0.93, 14 multiplex PCR
5 810 심용택ㆍ이철상 ,., 14 (combined PE) , multiplex PCR. 14 microsatellite multiplex PCR DNA DNA. DNA. 사사 References Arif IA, Khan HA, Shobrak M, Al Homaidan AA, Al Sadoon M, Al Farhan AH and Bahkali AH Interpretation of electrophoretograms of seven microsatellite loci to determine the genetic diversity of the Arabian Oryx. Genet Mol Res 9, Bacher JW, Flanagan LA, Smalley RL, Nassif NA, Burgart LJ, Halberg RB, Megid WM and Thibodeau, SN Development of a fluorescent multiplex assay for detection of MSI-High tumors. Dis Markers 20, Berg KD, Glaser CL, Thompson RE, Hamilton SR, Griffin CA and Eshleman JR Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction. J Mol Diagn 2, Chen M, Gao L, Zhang W, You H, Sun Q and Chang Y Identification of forty-five gene-derived polymorphic microsatellite loci for the sea cucumber, Apostichopus japonicus. J Genet 92, Goudet J FSTAT, a program to estimate and test gene diversities and fixation indices. Version Retrieved from on Jul 11, Guo SW and Thompson EA Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48, Guo SW and Thompson EA Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48, Hill CR, Butler JM and Vallone PM A 26 plex autosomal STR assay to aid human identity testing. J Forensic Sci 54, Ivanova NV, Dewaard JR and Hebert PDN An inexpensive, automation-friendly protocol for recovering high-quality DNA. Mol Ecol Notes 6, Jeffreys AJ, Wilson V and Thain SL Hypervariable minisatellite regions in human DNA. Nature. 314, Jones DA Blood samples: probability of discrimination. J Forensic Sci 12, Kang JH, Kim YK, Kim MJ, Park JY, An CM, Kim BS, Jun JC and Kim SK Genetic differentiation among populations and color variants of sea cucumbers (Stichopus japonicus) from Korea and China. Int J Biol Sci 30, Kanno M, Li Q and Kijima A Isolation and characterization of twenty microsatellite loci in japanese sea cucumber (Stichopus japonicus). Mar Biotechnol 7, dx.doi.org/ /s Kim IS and LEE SJ Incheon Customs Press Release. Retrieved form selectboard.do?bbsid=bbsmstr_1075&layoutmenuno =20716&nttId=1083 on May 15, Kim MJ, Choi TJ and An HS Population genetic structure of sea cucumber, Stichopus japonicus in Korea using microsatellite markers. Aquaculture Res 39, Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ, Tomsey CS, Zachetti JM, Masibay A, Rabbach DR, Amiott EA and Sprecher CJ Validation of a 16-locus fluorescent multiplex system. J Forensic Sci 47, Krüger J, Fuhrmann W, Lichte KH and Steffens C Zur Verwendung des Polymorphismus der sauren Erythrocytenphosphatase bei der Vaterschaftsbegutachtung. Dtsch Z Gerichtl Med 64, Park KJ, Ryu SO, Baek YS, Kim YS, Kang HW and Han HS Substrate Characteristics of Sea Cucumber Stichopus japonicus Habitats in the West Coast of Korea. Korean J Fish Aquat Sci 46, KFAS Paulay G Holothuroidea. World Register of Marine Species. Retrieved from php?p=taxdetails&id= on May 15, Purcell SW, Conand C, Uthicke S and Byrne M Ecological roles of exploited sea cucumbers. Oceanography and Marine Biology. An Annual Review 54, Tereba A Tools for analysis of population statistics, Profiles in DNA, vol 2. Promega Corporation Press, Madison, U.S.A., Turrina S, Ferrian M, Caratti S and De Leo D Evaluation of genetic parameters of 22 autosomal STR loci (PowerPlex Fusion System) in a population sample from Northern Italy. Int J Legal Med 128, org/ /s Walsh PS, Fildes, NJ and Reynolds R Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vwa. Nucleic Acids Res 24,
6 Zhan AB, Bao ZM, Lu W, Hu XL, Peng W, Wang M and Hu J Development and characterization of 45 novel microsatellite markers for sea cucumber (Apostichopus japonicus). Mol Ecol Notes 7, 해삼의초미니위성유전자형분석 811
±ÇÁ¤½Â
Kor. J. Legal Med. Vol. 27, No. 1 = Abstract = A Korean population study for the COfiler STR loci (D3S1358, D16S539, TH01, TPOX, CSF1PO, D7S820) Jeong-Seung Kwon, Kyoung-Jin Shin 2, 4, 5, Yun-Seok Yang
29(2)-04(임시근).fm
Printed in the Republic of Korea ANALYTICAL SCIENCE & TECHNOLOGY Vol. 29, No. 2, 79-84, 2016 http://dx.doi.org/10.5806/ast.2016.29.2.79 Note ( 단신 ) Performance of MiniPCR TM mini8, a portable thermal cycler
Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
09권오설_ok.hwp
(JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
04김호걸(39~50)ok
Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*
???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적
用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
CERIUM OXIDE Code CeO CeO 2-035A CeO 2-035B CeO REO % CeO 2 /REO % La 2 O 3 /REO %
희토류 SPEC CERIUM OXIDE Code CeO 2-040 CeO 2-035A CeO 2-035B CeO 2-025 REO % 99 99 98 97.5 CeO 2 /REO % 99.99 99.98 99.95 99.50 La 2 O 3 /REO % 0.004 0.01 0.03 0.1 0.01 (1) Pr 6 O 11 /REO % 0.003 0.004 0.015
<31325FB1E8B0E6BCBA2E687770>
88 / 한국전산유체공학회지 제15권, 제1호, pp.88-94, 2010. 3 관내 유동 해석을 위한 웹기반 자바 프로그램 개발 김 경 성, 1 박 종 천 *2 DEVELOPMENT OF WEB-BASED JAVA PROGRAM FOR NUMERICAL ANALYSIS OF PIPE FLOW K.S. Kim 1 and J.C. Park *2 In general,
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS
<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>
기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를
<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>
J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2
(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
한수지 47(6), , 2014 Original Article Kor J Fish Aquat Sci 47(6), ,2014 한국남해연안에분포하는눈볼대 (Doederleinia berycoides) 의자원생태학적특성치 최정화 최승희 1 * 이동우
한수지 47(6, 901-907, 014 Original Article Kor J Fish Aquat Sci 47(6,901-907,014 한국남해연안에분포하는눈볼대 (Doederleinia berycoides 의자원생태학적특성치 최정화 최승희 1 * 이동우 류동기 국립수산과학원, 1 한국해양수산연구원, 군산대학교 Population Ecology of Blackthroat
Rheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
DBPIA-NURIMEDIA
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic
09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 28(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2017 Mar.; 28(3), 163 169. http://dx.doi.org/10.5515/kjkiees.2017.28.3.163 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) PCB
<31372DB9DABAB4C8A32E687770>
김경환 박병호 충북대학교 도시공학과 (2010. 5. 27. 접수 / 2011. 11. 23. 채택) Developing the Traffic Severity by Type Kyung-Hwan Kim Byung Ho Park Department of Urban Engineering, Chungbuk National University (Received May
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Feb.; 29(2), IS
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Feb.; 29(2), 93 98. http://dx.doi.org/10.5515/kjkiees.2018.29.2.93 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) UHF-HF
상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /
,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;
08김현휘_ok.hwp
(Regular Paper) 21 3, 2016 5 (JBE Vol. 21, No. 3, May 2016) http://dx.doi.org/10.5909/jbe.2016.21.3.369 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a), a) An Audio Coding Technique Employing the Inter-channel
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
Buy one get one with discount promotional strategy
Buy one get one with discount Promotional Strategy Kyong-Kuk Kim, Chi-Ghun Lee and Sunggyun Park ISysE Department, FEG 002079 Contents Introduction Literature Review Model Solution Further research 2 ISysE
2 : (JEM) QTBT (Yong-Uk Yoon et al.: A Fast Decision Method of Quadtree plus Binary Tree (QTBT) Depth in JEM) (Special Paper) 22 5, (JBE Vol. 2
(Special Paper) 22 5, 2017 9 (JBE Vol. 22, No. 5, Sepember 2017) https://doi.org/10.5909/jbe.2017.22.5.541 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) (JEM) a), a), a) A Fast Decision Method of Quadtree
139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
Microsoft Word - 크릴전쟁_당신이 모르는 남극 바닷속 쟁탈전_FINAL.docx
2 3 20. 1 2 4 4. 7.7. 8. 9. 9. 30 3 4 5 6 7 8 9 10 11 그림 2. 남극해 지도, 보호구역 지정이 합의되었거나 제안된 구역 12 13 14 15 16 17 18 20 21 22 23 24 25 26 27 28 29 30 31 1 O'Leary, B. C., Winther-Janson, M., Bainbridge, J.
한국전지학회 춘계학술대회 Contents 기조강연 LI GU 06 초강연 김동욱 09 안재평 10 정창훈 11 이규태 12 문준영 13 한병찬 14 최원창 15 박철호 16 안동준 17 최남순 18 김일태 19 포스터 강준섭 23 윤영준 24 도수정 25 강준희 26
2015 한국전지학회 춘계학술대회 2일차 한국전지학회 춘계 학술대회(신소재 및 시장동향 관련 주제 발표) 시간 제목 비고 세션 1 차세대 이차전지용 in-situ 분석기술 좌장 : 윤성훈 09:00~09:30 Real-time & Quantitative Analysis of Li-air Battery Materials by In-situ DEMS 김동욱(한국화학연구원)
자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 A B Fig. 1. High-contrast spatial resolution in phantom test. A. Slice 1 with three sets of hole arr
Original Article pissn 1738-2637 J Korean Soc Radiol 2012;67(2):129-134 The Survey of Magnetic Resonance Imaging Quality according to in Korea 1 자기공명영상장치(MRI) 자장세기에 따른 MRI 품질관리 영상검사의 개별항목점수 실태조사 1 Hyun-Hae
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
Y 염색체미세결실증례보고 이지현외 117 이없는곳이지만, 법의학에서나산전진단시흔히성별을감식하는데사용된다. Y 염색체의단완 11.2 (Yp 11.2) 부위의유전자성별감식시동체 ( 프라이머, primer) 결합부위에전좌또는돌연변이, 결실로인해 amelogenin Y gen
Korean J Leg Med 2014;38:116-120 증례보고 Y 염색체단완미세결실유전자검사사례보고 이지현 1 김한나 1 V. Shinde 2 신동훈 3,4 이숭덕 1,3 1 서울대학교의과대학법의학교실 2 데칸대학교고고학교실 3 서울대학교의학연구원법의학연구소 4 서울대학교의과대학해부학교실 접수 : 2014년 6월 16일수정 : 2014년 7월 28일게재승인
02양은용
The filial piety of Won-Buddhism in the tradition of filial piety Yang, Eun-Yong Dept. of Korean Culture, Wonkwang University Keyword : Filial piety, Fourfold Grace, the grace of parents, Xiao Jing (),
노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
<C7A5C1F620BEE7BDC4>
연세대학교 상경대학 경제연구소 Economic Research Institute Yonsei Universit 서울시 서대문구 연세로 50 50 Yonsei-ro, Seodaemun-gS gu, Seoul, Korea TEL: (+82-2) 2123-4065 FAX: (+82- -2) 364-9149 E-mail: yeri4065@yonsei.ac. kr http://yeri.yonsei.ac.kr/new
디지털포렌식학회 논문양식
ISSN : 1976-5304 http://www.kdfs.or.kr Virtual Online Game(VOG) 환경에서의 디지털 증거수집 방법 연구 이 흥 복, 정 관 모, 김 선 영 * 대전지방경찰청 Evidence Collection Process According to the Way VOG Configuration Heung-Bok Lee, Kwan-Mo
Jkcs022(89-113).hwp
대한배뇨장애 및 요실금 학회지 J. Korean Continence Society 2004;8:89-113 Bristol Female Lower Urinary Tract Symptom 설문지의 한국어 번역 및 번역본의 언어 타당도 Seung-June Oh*, Hyung Geun Park*, Sung Hyun Paick, Won Hee Park and Myung-Soo
Æ÷Àå82š
Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose
°ø±â¾Ð±â±â
20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
IASB( ) IASB (IASB ),, ( ) [] IASB( ), IASB 1
IASB( ) IASB (IASB ),, 2007 8 31 ( ) [] IASB( ), IASB 1 ,,,,,,,, 2 IASB IFRS(International Financial Reporting Standards) IASB, IASB IASC(International Accounting Standards Committee) IAS(International
(5차 편집).hwp
(215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)
DBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
135 Jeong Ji-yeon 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 머리말 협저불상( 夾 紵 佛 像 )이라는 것은 불상을 제작하는 기법의 하나로써 삼베( 麻 ), 모시( 苧 ), 갈포( 葛 ) 등의 인피섬유( 靭 皮 纖 維 )와 칠( 漆 )을 주된 재료
MUNHWAJAE Korean Journal of Cultural Heritage Studies Vol. 47. No. 1, March 2014, pp.134~151. Copyright 2014, National Research Institute of Cultural Heritage 심향사 극락전 협저 아미타불의 제작기법에 관한 연구 정지연 a 明 珍 素 也
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 25(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2014 Mar.; 25(3), 304310. http://dx.doi.org/10.5515/kjkiees.2014.25.3.304 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
DBPIA-NURIMEDIA
무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 901 무선 센서 네트워크 환경에서 링크 품질에 기반한 라우팅에 대한 효과적인 싱크홀 공격 탐지 기법 (A Effective Sinkhole Attack Detection Mechanism for LQI based Routing in WSN) 최병구 조응준 (Byung
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
Ⅲ Ⅲ Ⅰ Ⅰ Ⅰ α < < < < < χ χ Ⅰ Ⅱ Ⅲ Ⅰ Ⅲ Ⅰ Bagozzi, R., & Dholakia, U. (2002). Intentional Social Action in Virtual Communities. Journal of Interactive Marketing, 16(2), 2-21. Borkovec, T. D. (1976).
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Mar.; 30(3),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Mar.; 30(3), 223 228. http://dx.doi.org/10.5515/kjkiees.2019.30.3.223 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Analysis
DBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Dec.; 27(12),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Dec.; 27(12), 1036 1043. http://dx.doi.org/10.5515/kjkiees.2016.27.12.1036 ISSN 1226-3133 (Print) ISSN 2288-226X (Online)
(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
KIM Sook Young : Lee Jungsook, a Korean Independence Activist and a Nurse during the 이며 나름 의식이 깨어있던 지식인들이라 할 수 있을 것이다. 교육을 받은 간 호부들은 환자를 돌보는 그들의 직업적 소
1 의사학 제24권 제1호(통권 제49호) 2015년 4월 Korean J Med Hist 24 ː1-34 Apr 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.1 pissn 1225-505X, eissn 2093-5609 간호부 이정숙의 독립운동 김숙영* 1. 서론 2. 본론 1) 출생에서 정신여학교 수학시절까지
1. KT 올레스퀘어 미디어파사드 콘텐츠 개발.hwp
Journal of Next-generation Convergence Information Services Technology Vol.4, No.1, June (2015), pp. 1-8 차세대컨버전스정보서비스기술논문지 KT 올레스퀘어 미디어파사드 콘텐츠 개발 Media Fasade Contents Development of KT Olleh Square 김동조
목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i
11-1480523-000748-01 배경지역 ( 백령도 ) 에서의 대기오염물질특성연구 (Ⅲ) 기후대기연구부대기환경연구과,,,,,,, Ⅲ 2010 목차 ⅰ ⅲ ⅳ Abstract v Ⅰ Ⅱ Ⅲ i 목차 Ⅳ ii 목차 iii 목차 iv 목차 μg m3 μg m3 v 목차 vi Ⅰ. 서론 Ⅰ μm μg m3 1 Ⅰ. 서론 μg m3 μg m3 μg m3 μm 2
04±èºÎ¼º
Introduction of Integrated Coastal Management Program and Sustainable Development of Fishing Villages in Cheonsu Bay Region* Boosung Kim** Abstract : Sustainable Development(SD) is an important concept
10 (10.1) (10.2),,
Chapter 16 Precipitation Equilibria Copyright 2001 by Harcourt, Inc. All rights reserved. Requests for permission to make copies of any part of the work should be mailed to the following address: Permissions
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jun.; 27(6),
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2016 Jun.; 27(6), 495 503. http://dx.doi.org/10.5515/kjkiees.2016.27.6.495 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Design
<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*
책임연구기관
2009. 2. 책임연구기관 - i - - ii - - iii - - iv - 6.3.1 Sample Collection and Analysis 161 6.3.1.1 Sample Collection 161 6.3.1.2 Sample Analysis 161 6.3.2 Results 162 6.3.2.1 Dalian 162 6.3.2.2 Xiamen 163 6.3.3
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 6, Jun Rate). STAP(Space-Time Adaptive Processing)., -
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Jun.; 29(6), 457463. http://dx.doi.org/10.5515/kjkiees.2018.29.6.457 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Sigma-Delta
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
433대지05박창용
Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
<BED6C7C3BCD2BDBA5F4B5350BBFDBBEABCBA31C0E5312D32302E70312E504446>
2011 ISBN 978-89-8063-572-6 94320 ISBN 978-89-8063-562-7 11-1051000-000135-01 Knowledge Sharing Program Preface Contents 4 16 18 19 22 25 25 34 37 37 37 38 39 40 40 43 70 73 73 78 82 82 84 90 93 95 95
02이용배(239~253)ok
A study on the characteristic of land use in subcenter of Seoul. - Cases of Yeongdeungpo and Kangnam Ok Kyung Yuh* Yong-Bae Lee**,. 2010,,..,.,,,,.,,.,,.,,,, Abstract : This study analyzed the land use
±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
2014_........pdf
1, 1, 2, 1 (1, 2 ) Jin Suk Suh 1, Jong In Kim 1, Ryeong Jae Park 2, Sang Bum Park 1 (1 Korea Forest Research Institute, 2 Korea Traditional Dye Institute) Introduction (2011-2013), (VOCs)., (7 ),,. Materials
<30312DC1A4BAB8C5EBBDC5C7E0C1A420B9D720C1A4C3A52DBDC5C1F82E687770>
Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 3 : 493~499 Mar. 2015 이동통신정책의 공공선택 분석 신진 * The Public Choice Analysis
Microsoft Word - 1-차우창.doc
Journal of the Ergonomics Society of Korea Vol. 28, No. 2 pp.1-8, May 2009 1 하이브리드 환경하의 인간기계시스템 제어실 평가에 관한 연구 차 우 창 김 남 철 금오공과대학교 산업시스템공학과 A Study of the Evaluation for the Control Room in Human Machine
한수지 51(3), , 2018 Original Article Korean J Fish Aquat Sci 51(3), ,2018 확률신경망에의한해저저질의식별 이대재 * 부경대학교해양생산시스템관리학부 Classifying Seafloor Sedim
한수지 51(3), 321-327, 2018 Original Article Korean J Fish Aquat Sci 51(3),321-327,2018 확률신경망에의한해저저질의식별 이대재 * 부경대학교해양생산시스템관리학부 Classifying Seafloor Sediments Using a Probabilistic Neural Network Dae-Jae Lee*
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
<372E20B9DAC0B1C8F12DB0E62E687770>
7 사회과학연구 2010; 36(2) Journal of Social Science Vol.36, No.2, 2010; 45-69 사 회 과 학 연 구 의원 웹사이트의 네트워크 분석에 관한 연구 : 17대 국회의원과 7대 서울시의회 의원 웹사이트 비교 분석을 중심으로 박윤희 (Yun-Hee Park) 동국대학교 정치학과 박사과정 수료 mihoo@hanmail.net
DBPIA-NURIMEDIA
95 일반논문 해항도시 부산과 인천의 음식문화 변동 분석 이종수* 1) Ⅰ. 서론 Ⅱ. 해항도시 음식문화의 정체성과 변동 Ⅲ. 부산과 인천의 음식문화 변동 분석 Ⅳ. 부산과 인천의 음식문화 변동과 대응과제 Ⅴ. 결론 Ⅰ. 서 론 본 고는 해항도시 1) 지역 음식문화에 영향을 미치는 요인은 무엇일 까, 왜 그런 특성을 띄게 됐나, 어떤 요인에 의해 변화가 야기되었고,
泰 東 古 典 硏 究 第 24 輯 이상적인 정치 사회의 구현 이라는 의미를 가지므로, 따라서 천인 합일론은 가장 적극적인 경세의 이론이 된다고 할 수 있다. 권근은 경서의 내용 중에서 현실 정치의 귀감으로 삼을 만한 천인합일의 원칙과 사례들을 발견하고, 이를 연구하여
權 近 의 五 經 인식 - 經 學 과 經 世 論 의 연결을 중심으로 - 姜 文 植 * 1. 머리말 2. 經 學 과 經 世 論 연결의 이론적 기반 3. 五 經 淺 見 錄 의 經 典 해석과 經 世 論 4. 맺음말 요약문 권근( 權 近 )은 체용론( 體 用 論 )에 입각하여 오경( 五 經 ) 간의 관계 및 각 경서의 근본 성격을 규정하였다. 체용론에서 용( 用 )
DBPIA-NURIMEDIA
방송통신연구 2011년 봄호 연구논문 64 98 PD수첩 관련 판례에서 보이는 사법부의 사실성에 대한 인식의 차이 연구* 1)2) 이승선 충남대학교 언론정보학과 부교수** Contents 1. 문제제기와 연구문제 2. 공적인물에 대한 명예훼손 보도의 면책 법리 3. 분석결과의 논의 4. 마무리 본 이른바 PD수첩 광우병 편 에 대해 다양한 법적 대응이 이뤄졌다.
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
<353420B1C7B9CCB6F52DC1F5B0ADC7F6BDC7C0BB20C0CCBFEBC7D120BEC6B5BFB1B3C0B0C7C1B7CEB1D7B7A52E687770>
Journal of the Korea Academia-Industrial cooperation Society Vol. 13, No. 2 pp. 866-871, 2012 http://dx.doi.org/10.5762/kais.2012.13.2.866 증강현실을 이용한 아동교육프로그램 모델제안 권미란 1*, 김정일 2 1 나사렛대학교 아동학과, 2 한세대학교 e-비즈니스학과