한수지 50(6), , 2017 Original Article Korean J Fish Aquat Sci 50(6), ,2017 해삼 (Stichopus japonicus) 의 microsatellite 유전자형분석을위한 multiplex PCR

Size: px

Start display at page:

Download "한수지 50(6), , 2017 Original Article Korean J Fish Aquat Sci 50(6), ,2017 해삼 (Stichopus japonicus) 의 microsatellite 유전자형분석을위한 multiplex PCR"

창기 국
5 years ago
Views:

1 한수지 50(6), , 2017 Original Article Korean J Fish Aquat Sci 50(6), ,2017 해삼 (Stichopus japonicus) 의 microsatellite 유전자형분석을위한 multiplex PCR 시스템개발 심용택 * 이철상 1 * midna 유전체연구소, 1 군산대학교생물학과 Development of a Multiplex PCR System for Microsatellite Genotyping of the Sea Cucumber Stichopus japonicus Yong-Teak Sim* and Chul-Sang Lee 1 * midna Genome Research institute, Kunsan 54156, Korea 1 Department of Biology, Kunsan National University, Kunsan 54150, Korea A multiplex PCR system comprising 14 microsatellite markers was developed for genotyping analysis of the sea cucumber Stichopus japonicus. A total of 286 samples were used to evaluate genetic polymorphisms and forensic parameters of the microsatellite loci. In a single PCR reaction, all 14 loci were uniformly amplified and a total of 269 alleles were identified. The AJ19024 locus had the largest number of alleles (46), and its discriminatory power and exclusion power were 0.99 and 0.76, respectively. The fewest alleles (8) were present at the Psj2575 locus, which provided the lowest discriminatory power (0.81) and exclusion power (0.20). The mean number of alleles, mean heterozygosity, mean discrimination power and mean exclusion power per locus were 19.21, 0.70, 0.93, and 0.46, respectively. The combined matching probability for the 14 loci was , and the combined power of exclusion was Thus, the forensic parameters evaluated in the present study demonstrated the utility of our multiplex PCR system for biological tracing methods, such as individual identification and paternity testing, in the sea cucumber. Key words: Sea Cucumber, Stichopus japonicus, Multiplex, Microsatellite, Identification 서론 (sea cucumber) 1, (Paulay, 2014). (Stichopus japonicus),, (Park et al., 2013). (Kim and Lee, 2016), (Purcell et al., 2016).,. DNA microsatellite (polymorphism) (Jeffreys et al., 1985). Kanno et al. (2005) Psj microsatellite 20, Zhan et al. (2007) Chen et al. (2013),, AH AJ microsatellite 45. Kanno et al. (2005) Psj microsatellite 9 (Kim et al., 2008). microsatellite, (Kang et al., 2011). Korean J Fish Aquat Sci 50(6) , December 2017 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Licens ( which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Received 6 November 2017; Revised 27 November 2017; Accepted 12 December 2017 *Corresponding author: Tel: Fax: address: Loud2004@kunsan.ac.kr Copyright 2017 The Korean Society of Fisheries and Aquatic Science 806 pissn: , eissn:

2 해삼의초미니위성유전자형분석 807 microsatellite PCR 1-3,. DNA microsatellite PCR 10 (multiplex PCR) (Krenke et al., 2002)., PCR stutter peak (primer) (Berg et al., 2000). (Hill et al., 2009). DNA microsatellite multiplex PCR (combined power of discrimination) (combined power of exclusion) (Turrina et al., 2014). (Stichopus japonicus) DNA microsatellite, AH075, AH204, AH025, AH198, AJ19270, AH028, AJ03, AJ78245, AJ08658, Psj2575, Psj2409, AJ14707, AJ19024 AH144 multiplex PCR, 286,. 재료및방법 시료의수집및 DNA 추출 70, 70, 74, 72. DNA 2 mm Ivanova et al. (2006). Multiplex PCR 과 Genotyping Zhan et al. (2007), Chen et al. (2013), Kanno et al. (2005) microsatellite 8, multiplex, 14. Multiplex PCR DNA ng, hot-start Taq polymerase (Genetbio, Korea) 1 unit, 10X PCR buffer 2 μl, dntp 200 mm, MgCl 2 mm, primer mix 2 μl 15 μl. primer Table 1. PCR GeneAmp PCR System 9700 (Applied Biosystems, USA) , (ramp 50%), (ramp 60%) 30 cycle, μl GeneScan 500 LIZ (Applied Biosystems, USA) Hi-Di Formamide (Thermo Fisher Scientific, USA) 98 1 (denaturation), POP-7 polymer (Thermo Fisher Scientific, USA) 36 cm Applied Biosystems 3130x1 (Applied Biosystems, USA) 60. (genotype) GeneMapper ID v3.1 (Applied Biosystems, USA) 500 LIZ size standard. 법과학적지표의산출 FSTAT (Lausanne University, Switzerland) (gene diversity), (number of alleles) (Goudet, 2001). - (hardy-weinberg equilibrium exact test, HWE) GENEPOP v4.2 dememorization number=10,000, number of batches=5,000 number of iterations per batch=10,000 (Guo and Thompson, 1992). (polymorphism information content), (power of discrimination), (matching probability) (power of exclusion) PowerState v1.2 (Promega, USA) (Tereba, 1999). n i=1 (1-Pdi) 1- n i=1 (1-PEi) (Jones, 1972; Krüger et al., 1968). 결 과 Microsatellite 14 multiplex PCR 14 (Fig. 1). AH025, AH028, AJ19024 (heterozygote) peak 10-30% stutter peak, GeneMapper. stutter peak peak 5%. 286 DNA 14 microsatellite 269, AJ19024

3 808 심용택ㆍ이철상 Table 1. Primer sequences and locus characteristics for microsatellite multiplex PCR system Locus Primer sequence (5' to 3') Repeat Motif Reference AH075 AH204 AH025 AH198 AJ19270 AH028 AJ03 AJ78245 AJ08658 Psj2575 Psj2409 AJ14707 AJ19024 AH144 F 6-FAM-GCAACAACACTGTTTAAGCAGATAA R GTTTCTTCCCACAGCAGAGAGTAATTC F 6-FAM-TTTGGTGATATTCTGGGAGTG R GTTTCTTAAGAAGAGGGGTGCCTATTT F 6-FAM-GTATAGGGCTCTCATACGATCA R GTTTCTTGATATATGACACAAGTCCATAGC F 6-FAMACGTACACGTTTAGCAGAGC R GTTTCTTGATGTGTGTTCTCGGATTTG F VIC-ATTGTCTTCCTTGCCTTCCT R GTTTCTTGGAAACAGAAATGGAACCTG F VIC-TCAGTTCTACAAACATATGTAATCC R GTTTCTTCCAAAGTCGGACGTTATTACC F VIC-GGTATTACATTGTATGGAAGCCTAC R GTTTCTTCGAGTACAAGTACGGAGTTATCTG F NED-GACACATTTTCCTCCATCTCA R GTTTCTTCTCGCTTGAAGACGATGAC F NED-AAGGAGCCACTACGATGACG R ACCGTCAAAACCCACAAAAA F NED-GATGTTTCGCTAAATACATGG R GTTTCTTCGCTCGCTTGGAGAGTAA F NED-TCAATCATAAGGTCCCGAGT R GTTTCTTCGTATTCATGTCCGACAAC F PET-CGGGATGATGACTTTGATTT R GTTTCTGAGTTGATTGCACAAGGTT F PET-TCGTGGAAAAAGTTGGATTTG R GTTTCTTGCTGCTATCGGTCTCTTTCG F PET-TTCCGTTAACGCATATCTCAA R GTTTCTTCTACATTCACGACGGGTGTA (GA)n Zhan et al. (2007) (AG)n Zhan et al. (2007) (AG)n Zhan et al. (2007) (AC)n..(AC)n Zhan et al. (2007) (TCC)n Chen et al. (2013) (TA)n(GA)n..(GA)n Zhan et al. (2007) (AC)n Zhan et al. (2007) (TCT)n Chen et al. (2013) (TGT)n Chen et al. (2013) (CA)n Kanno et al. (2005) (CA)n(AT)n Kanno et al. (2005) (GAG)n Chen et al. (2013) (GAA))n Chen et al. (2013) (AG)n Zhan et al. (2007) 46, 0.89, 0.95, 0.95, 0.99, (Table 2). Psj , 0.58, HWE AH204 AH144 p = HWE., AH , 고 찰 stutter peak. Stutter peak (Arif et al., 2010). Stutter peak DNA microsatellite 1-2 slippage (Walsh et al., 1996). 2 AH025, AH028, AJ stutter peak peak 30-44% (Bacher et al., 2004). stutter peak

4 해삼의초미니위성유전자형분석 809 Fig. 1. Capillary electrophoretic separation of the fourteen-microsatellite multiplex PCR. Electrophoresis was carried out under POP -7 polymer and the sequences were analyzed by ABI 3130xl Genetic Analyzer. The blue line (FAM): AH075, AH204, AH025 and AH198; green line (VIC): AJ19270, AH028 and AJ03; black line (NED): AJ78245, AJ08658, Psj2575 and Psj2409; red line (PET): AJ14707, AJ19024 and AH144. Table 2. Forensic parameters of 14 microsatellite loci in sea cucumber Stichopus japonicus (n=286) na He obs GD PIC PD MP PE HWE AH <0.01 AH AH AH <0.01 AJ <0.01 AH <0.01 AJ <0.01 AJ <0.01 AJ Psj <0.01 Psj <0.01 AJ <0.01 AJ <0.01 AH na, Number of observed alleles; He obs, Observed heterozygosity; GD, Gene diversity; PIC, Polymorphism information content; PD, Power of discrimination; MP, Matching probability; PE, Power of exclusion; HWE, Hardy-Weinberg equilibrium exact test. stutter peak. HWE AH204 AH144.. HWE (genetic drift). 14 microsatellite 0.93, 14 multiplex PCR

5 810 심용택ㆍ이철상 ,., 14 (combined PE) , multiplex PCR. 14 microsatellite multiplex PCR DNA DNA. DNA. 사사 References Arif IA, Khan HA, Shobrak M, Al Homaidan AA, Al Sadoon M, Al Farhan AH and Bahkali AH Interpretation of electrophoretograms of seven microsatellite loci to determine the genetic diversity of the Arabian Oryx. Genet Mol Res 9, Bacher JW, Flanagan LA, Smalley RL, Nassif NA, Burgart LJ, Halberg RB, Megid WM and Thibodeau, SN Development of a fluorescent multiplex assay for detection of MSI-High tumors. Dis Markers 20, Berg KD, Glaser CL, Thompson RE, Hamilton SR, Griffin CA and Eshleman JR Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction. J Mol Diagn 2, Chen M, Gao L, Zhang W, You H, Sun Q and Chang Y Identification of forty-five gene-derived polymorphic microsatellite loci for the sea cucumber, Apostichopus japonicus. J Genet 92, Goudet J FSTAT, a program to estimate and test gene diversities and fixation indices. Version Retrieved from on Jul 11, Guo SW and Thompson EA Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48, Guo SW and Thompson EA Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48, Hill CR, Butler JM and Vallone PM A 26 plex autosomal STR assay to aid human identity testing. J Forensic Sci 54, Ivanova NV, Dewaard JR and Hebert PDN An inexpensive, automation-friendly protocol for recovering high-quality DNA. Mol Ecol Notes 6, Jeffreys AJ, Wilson V and Thain SL Hypervariable minisatellite regions in human DNA. Nature. 314, Jones DA Blood samples: probability of discrimination. J Forensic Sci 12, Kang JH, Kim YK, Kim MJ, Park JY, An CM, Kim BS, Jun JC and Kim SK Genetic differentiation among populations and color variants of sea cucumbers (Stichopus japonicus) from Korea and China. Int J Biol Sci 30, Kanno M, Li Q and Kijima A Isolation and characterization of twenty microsatellite loci in japanese sea cucumber (Stichopus japonicus). Mar Biotechnol 7, dx.doi.org/ /s Kim IS and LEE SJ Incheon Customs Press Release. Retrieved form selectboard.do?bbsid=bbsmstr_1075&layoutmenuno =20716&nttId=1083 on May 15, Kim MJ, Choi TJ and An HS Population genetic structure of sea cucumber, Stichopus japonicus in Korea using microsatellite markers. Aquaculture Res 39, Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ, Tomsey CS, Zachetti JM, Masibay A, Rabbach DR, Amiott EA and Sprecher CJ Validation of a 16-locus fluorescent multiplex system. J Forensic Sci 47, Krüger J, Fuhrmann W, Lichte KH and Steffens C Zur Verwendung des Polymorphismus der sauren Erythrocytenphosphatase bei der Vaterschaftsbegutachtung. Dtsch Z Gerichtl Med 64, Park KJ, Ryu SO, Baek YS, Kim YS, Kang HW and Han HS Substrate Characteristics of Sea Cucumber Stichopus japonicus Habitats in the West Coast of Korea. Korean J Fish Aquat Sci 46, KFAS Paulay G Holothuroidea. World Register of Marine Species. Retrieved from php?p=taxdetails&id= on May 15, Purcell SW, Conand C, Uthicke S and Byrne M Ecological roles of exploited sea cucumbers. Oceanography and Marine Biology. An Annual Review 54, Tereba A Tools for analysis of population statistics, Profiles in DNA, vol 2. Promega Corporation Press, Madison, U.S.A., Turrina S, Ferrian M, Caratti S and De Leo D Evaluation of genetic parameters of 22 autosomal STR loci (PowerPlex Fusion System) in a population sample from Northern Italy. Int J Legal Med 128, org/ /s Walsh PS, Fildes, NJ and Reynolds R Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vwa. Nucleic Acids Res 24,

6 Zhan AB, Bao ZM, Lu W, Hu XL, Peng W, Wang M and Hu J Development and characterization of 45 novel microsatellite markers for sea cucumber (Apostichopus japonicus). Mol Ecol Notes 7, 해삼의초미니위성유전자형분석 811

±ÇÁ¤½Â

±ÇÁ¤½Â Kor. J. Legal Med. Vol. 27, No. 1 = Abstract = A Korean population study for the COfiler STR loci (D3S1358, D16S539, TH01, TPOX, CSF1PO, D7S820) Jeong-Seung Kwon, Kyoung-Jin Shin 2, 4, 5, Yun-Seok Yang