Microsoft Word - 09-장원종.doc

Size: px

Start display at page:

Download "Microsoft Word - 09-장원종.doc"

근영 난
5 years ago
Views:

1 Journal of Bacteriology and Virology Vol. 39, No. 4 p DOI /jbv Original Article Detection and Identification of the Spotted Fever Group Rickettsial Agents from Haemaphysalis Ticks in Jeju Island, Korea Bong-Chun Moon 1, Jae-Hee Jeong 2, Yeon-Joo Choi 2, Jung-Eun Kim 2, Hyun-Ji Seo 2, E-Hyun Shin 3, Bong-Gu Song 3, Hee Il Lee 4, Seung-Hyun Lee 2, Kyung-Hee Park 2 and Won-Jong Jang 2 * 1 Institute of Environmental Resource Research of Jeju Special Self-Governing Province, Jeju, 2 Department of Microbiology, College of Medicine, Konkuk University, Seoul, 3 Department of Medical Entomology, 4 Division of Biosafety Evaluation and Control, Korea Center for Disease Control and Prevention, Seoul, Korea This study investigated the presence of nucleic acids of various Rickettsial agents in ticks collected in Jeju Island, Korea from June 2007 to August 2008, through the nested polymerase chain reaction (PCR) and sequencing analysis of partial citrate synthase (glta), Rickettsial outer membrane protein B (ompb), and 17-kDa genes. Examination of the 1,584 ticks showed that the subspecies distribution of Haemaphysalis longicornis was 99.81% (n=1,581) and H. flava was 0.19% (n=3). A total 224 out of 250 pools from one to 15 ticks were found to be positive in ompb-pcr assay (minimal infection rate 141 ticks/1,000 tested). From the positive samples, 26 were analyzed by glta- and 17-kDa-PCR assays. The nucleotide sequences of the ompb- and glta-pcr products showed a high degree of similarity with those of the Rickettsia japonica (98.7~99.2% and 98.7~99.3%, n=25) and R. monacensis (99% and 99.7%, n=1). However, analysis of the nucleotide sequences of the 17-kDa-PCR amplicons showed that the sequences of the 25 PCR amplicons were more close to R. marmionii (99.4~100%) than R. japonica (98.6~99.1%). These findings suggest that various rickettsial diseases could be transmitted via the bite of tick vectors in Jeju Island, Korea. Key Words: Rickettsial agents, Tick, Polymerase chain reaction, glta, ompb, 17-kDa gene 서론 리케차 (family Rickettsiaceae, order Rickettsiales) 는그람음성간균으로세포내기생하여자라며 (1), 길이는 0.7~1.0 μm, 폭은 0.3~0.5 μm이다. 리케차의 3층의세포벽은 inner cytoplasmic membrane, periplasmic space, outer membrane 으로구성된다 (2~4). 리케차는항원과표현형을기본으로 typhus group ( 티푸스군 ), spotted fever group ( 홍반열군 ), scrub typhus group ( 쯔쯔가무시군, 현재는리 Received: October 29, 2009/ Revised: November 19, 2009 Accepted: November 23, 2009 * Corresponding author: Won-Jong Jang, Ph.D., Department of Microbiology, College of Medicine, Konkuk University, Gwangjin-Gu, Seoul , Korea. Phone: , Fax: wjjang@kku.ac.kr 케차가아닌 Orientia로구분됨 ) 과같이 3개의군으로구분된다 (5). 최근에는 16S rrna, genus-common 17-kDa antigen, citrate synthase (glta), rickettsial outer membrane proteins A (ompa) 와 B (ompb) 유전자를사용한 polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), 염기서열분석기술을통해리케차를구분할수있다 (6~10). 리케차는자연에서이, 진드기, 벼룩등의흡혈성절지동물에기생하고이들을매개로하여사람에게전파되어질환을일으키며 (11), 주요임상증세는일반적으로절지동물에게물린지 6~10일후에나타나기시작하며, 39.5~40.0 의고열과두통, 오한, 근육통및발진의전신증상을보인다 (11, 12). 또한병리학적으로리케차증식은모세혈관의내피세포에서일어나며이세포내에서혈관염을일으킨다. 이질병은가볍거나심각할수있지만보통 2~3주간지속된다 (12). 317

2 318 B-C Moon, et al. 리케차를감염시키는절지동물중진드기는거미, 전갈등과같이거미강 (Arachnida) 에속하며, 큰진드기 (ticks) 와좀진드기 (mites) 로구분된다. 큰진드기는참진드기과 (Ixodidae, hard ticks) 와공주진드기과 (Argasidae, soft ticks) 의 2과로나눠진다. 좀진드기는옴진드기과 (Sarcoptidae) 와먼지진드기과 (Pyroglyphidae) 가있다. 진드기는세계적으로널리분포하며, 서식처의다양성과각기다른생활습성을가지며발달단계는유충 (larvae) 시기를지나자충 (nymph) 시기를거쳐성충 (adults) 이된다 (13, 14). 우리나라에서식분포하고있는큰진드기종은공주진드기과의 Argas 속에 3종, 참진드기과의 Amblyomma 속 1종, Bophilus 속 2종, Dermacentor 속 3종, Haemaphysalis 속 8 종, Ixodes 속 10종그리고 Rhipicephalus 속 1종등총 3 과 7속 28종이다 (15). Haemaphysalis longicornis ( 작은소참진드기 ) 와 H. flava ( 개피참진드기 ) 는 Haemaphysalis 속에속하는종이다. H. longicornis는전국적으로분포하며, 발생밀도가가장높은종으로 (16), 국내환자들에서교상 (biting) 이보고되고있다 (17, 18). H. flava는역시국내에분포하며, 그교상이 30대여자환자에서보고된바있다 (19). 이러한진드기는리케차의주요숙주이자병원소로서리케차감염증과매우높은관련이있다 (20). 이연구의목적은제주도에서식하고있는진드기종 의분포를알아보고, 분자생물학적인방법으로홍반열군리케차의감염여부와감염된리케차의종을분류하는데있다. 재료및방법진드기채집및분류 동정본연구에사용한진드기는 2007년부터 2008년도에걸쳐제주도에서 1 m 2 flannel flag를사용하여 dragging 과 flagging 방법을이용하여채집하였다. 채집된개체는 75% ethanol에넣어보관한후해부현미경을이용하여분류 동정하였다 (21). 진드기는유충, 자충, 수컷성충, 암컷성충으로분류하였다. 진드기는채집지역별, 진드기종별로고려하여유충과자충은시료당 1~15마리를기준으로나누었으며, 암컷성충과수컷성충은시료당 1~5 마리를기준으로하여전체를 250개의시료가되게나누었다 (Table 2). 진드기로부터 DNA 추출분류 동정된진드기로부터 DNA를추출하기위하여각각의진드기를 eppendorf tube에넣고 filtered tip (Axygen Biosciences, Union City, CA, USA) 으로파쇄하여 30 μl의 Table 1. Nucleotide sequences of PCR primers and conditions used in this study Target gene a Primer Nucleotide sequence (5' 3') Products PCR condition size Denaturation c Annealing c Extension c Cycles References ompb WJ77 OF GTAACCGGAAGTAATCGTTTCGTAA 500 bp WJ80 b OR GCTTTATAACCAGCTAAACCACC WJ79 SFG IF GTTTAATACGTGCTGCTAACCAA SFG 407 bp WJ83 TG IF AAGATCCTTCTGATGTTGCAACA TG 231 bp WJ78 b SFG/TG IR GGTTTGGCCCATATACCATAAG glta RpCS.877p OF GGGGGCCTGCTCACGGCGG 381 bp RpCS.1,258n b OR ATTGCAAAAAGTACAGTGAACA 24 RpCS.896p IF GGCTAATGAAGCAGTGATAA 330 bp RpCS.1,233n b IR GCGACGGTATACCCATAGC 17-kDa Rr17k. 1p OF TTTACAAAATTCTAAAACCAT 540 bp Rr17k. 539n b OR TCAATTCACAACTTGCCATT 25 Rr17k. 90p IF GCTCTTGCAACTTCTATGTT 360 bp Rr17k. 417n b IR TTTCCGCCTATTACAACTGTT a ompb, specific outer membrane protein B gene; glta, Rickettsial citrate synthase gene; 17-kDa, Rickettsia genus-specific outer membrane antigen gene, b Reverse orientation, c Temperature ( ).

3 SFG Rickettsial Agents in Haemaphysalis longicornis in Jeju Island, Korea 319 phosphate buffered saline ( 인산완충식염수, PBS, ph 7.4) 을추가하여부유시켰다. 이것을 Chelex 100 (Bio-Rad, Hercules, CA, USA) method (22) 를이용하여 DNA를추출하였다. 중합효소연쇄반응 (polymerase chain reaction, PCR) 진드기로부터추출한 DNA에리케차 DNA가검출되는지보기위하여 ompb, glta, 17-kDa 유전자에특이적으로반응하는프라이머 (23~25) 들을사용하였다 (Table 1). 1, 2차 PCR 모두 0.5 U의 Taq DNA polymerase, 250 mm 의 dntps, 50 mm의 Tris-HCl (ph 8.3), 40 mm의 KCl, 1.5 mm의 MgCl 2, gel loading dye가포함되어있는 premixture (AccuPower PCR PreMix, Bioneer, Daejeon, Korea) 에한쌍의 10 pmol 프라이머들을넣어총 20 μl의반응액으로맞춰 PCR을수행하였다. PCR은 Veriti 96 well Thermal Cycler (Applied Biosystems, Foster City, CA, USA) 를이용하였으며, 1차 PCR 반응은 94 에서 5분간변성시킨후 94 에서 20초간 denaturation, 47~54 에서 20초간 annealing, 72 에서 30초간 extension 순으로반응시켰으며, 최후반응 72 에서 3분간반응시켜 PCR 산물의연장을유도하였다. 이때증폭횟수는 35~40 cycle로하였다. 2차 PCR 반응의증폭횟수는 30~ 35 cycle로하였으며, 94 에서 5분간변성시킨후 94 에서 20초간 denaturation, 47~56 에서 20초간 annealing, 72 에서 20초간 extension 순으로반응시켰고, 최후반응 72 에서 3분간반응시켰다 (Table 1). PCR 수행시 양성대조군으로 R. japonica DNA (ATCC; American Type Culture Collection, VR-1363) 를 template로사용하였으며, 음성대조군으로 template DNA 대신증류수를사용하였다. PCR 산물은 ethidium bromide (0.5 μg/ml) 를첨가하여제작한 1.2% agarose gel에전기영동하였으며, standard molecular weight marker 100 bp DNA Ladder (intron Biotechnology, Seongnam, Korea) 와함께증폭된 DNA 부분을확인하였다. 클로닝및염기서열분석 2차 PCR 반응후양성을나타내는산물은 QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany) 로추출하였으며, pgem-t Easy Vector system I (Promega, Madison, WI, USA) 에클로닝하였다. 클론들이삽입유전자를가지고있음을확인하기위하여 plasmid DNA를분리하고 EcoRI (New England Biolabs, Beverly, MA, USA) 으로절단하여 1.2% agarose gel에서전기영동하였다. 염기서열은 ( 주 ) 제노텍 (Daejeon, Korea) 에의뢰하여분석하였다. 분석된염기서열들은프라이머부분을제외하고 GenBank database의다른리케차의해당염기서열과 MegAlign software package (Windows version 7.1; DNA-STAR, Madison, WI, USA) 의 multisequence alignment program을이용하여비교하였다. 'Neighbor-joining algorithm' 과 'Jukes and Cantormatrix' 를이용하여 phylogenetic tree를제작하고, tree의안정성을조사하기위하여 bootstrap analysis를수행하였다. Species Stages Table 2. Tick collected at Jeju Island, Korea, 2007~2008 Collection June July August April May June July August No. ticks Larvae a H. longicornis Nymph b , Adults male c Adults female c Larvae a H. flava Nymph b Adults male c Adults female c Total , a 1~5 larvae/pool, b 1~15 nymphs/pool, c 1~5 adults/pool No. pools

4 320 B-C Moon, et al. Figure 1. Map of Jeju Island, Korea showing the geographic distribution of ticks collected from 2007 to Dots indicate the collection area of the H. longicornis and squares indicate the collection area of H. longicornis and H. flava. 결과진드기의종별분포 2007년 6월부터 8월까지와 2008년 4월부터 8월에걸쳐제주도에서채집한진드기는총 1,584마리였으며, 해부현미경을이용하여분류한결과 H. longicornis의유충단계가 3마리, 자충단계가 1,173마리, 수컷성충단계가 179 마리, 암컷성충단계가 226마리로총 1,581마리 (99.81%) 였다. H. flava는수컷성충단계가 1마리, 암컷성충단계가 2마리로총 3마리 (0.19%) 였다 (Table 2). H. longicornis 는제주도전지역에서채집되었고, 3마리의 H. flava 중수컷성충단계의 1마리는동경 , 북위 에서, 암컷성충단계가 2마리중 1마리는동경 , 북위 에서, 나머지 1마리는동경 , 북위 에서채집되었다 (Fig. 1). 진드기 DNA 추출물로부터 PCR 증폭산물의확인진드기는성숙단계를기준으로하여 1,581마리의 H. longicornis를 247개의 pooled sample ( 합동시료 ), 3마리의 H. flava를 3개의진드기시료로나누어전체 250개의진드기시료들로만들었다 (Table 2). 250개의시료들에서추출한각각의 DNA에서 ompb 유전자를증폭시켜검출한결과, H. longicornis 시료들은 224개 [1,000마리시험시최소감염율 142 (=224 양성합동시료수 / 검사한 1,581 마리진드기 1000)] 에서 407 bp 크기의증폭산물을보 였으며, H. flava 시료들은모두음성반응을보였다 (data not shown). 양성반응을보인 224개의시료들중 26개의시료를선별하여 glta, 17-kDa 유전자를표적으로하는 nested PCR을수행하였다. glta PCR 결과 26개 (100%) 에서 330 bp 크기의증폭산물을나타내었으며, 17-kDa PCR 결과 25개 (96.2%) 에서 360 bp 크기의증폭산물을나타내었다 (Fig. 2). 클로닝및염기서열분석각 partial ompb, glta, 17-kDa 유전자의중폭산물을 TA vector에클로닝한후각산물당 1개의클론의염기서열분석하여 GenBank database 에서얻은다양한리케차염기서열과비교하였다. Table 3은 GenBank database 에서얻은다양한리케차 ompb 염기서열들과본연구에서얻은 224개의 ompb-pcr 산물클론들중선별된 10개클론들의염기서열을비교한것이다. 10개의클론들중 9개의클론들 (No. 1, 5, 14, 35, 45, 81, 85, 97, 100) 은 R. japonica 와 cluster를형성하였으며, 98.7~99.2% 의유사도를나타냈다. 10개의클론들중 1개의클론 (No. 226) 은 R. monacensis와독립적인 cluster를형성하였으며, 99.0% 의유사도를나타냈다. 각클론들의리케차 genus의분류에서 genotype의위치를확인하기위하여 ompb 유전자의염기서열분석에근거하여계통발생학적인분석을수행하였다. 9개의클론들 (No. 1, 5, 14, 35, 45, 81, 85, 97, 100) 은 R. japonica와유사도를갖는 Group 1과 R. monacensis와유사도를갖는 1개의클론 (No. 226) 을포함하는 Group 2

Lane 1, positive control (R. japonica); lane 2~4, each number of the amplified ompb products. (B) The size of amplified glta product was about 330 bp. Lane 1, positive control (R.

5 SFG Rickettsial Agents in Haemaphysalis longicornis in Jeju Island, Korea 321 A B C Figure 2. Electrophoresis analysis on 1.2% agarose gel of DNAs amplified by PCR targeted ompb (panel A), glta (panel B), and the 17-kDa (panel C) antigen gene. (A) The size of amplified ompb product was about 407 bp. Lane 1, positive control (R. japonica); lane 2~4, each number of the amplified ompb products. (B) The size of amplified glta product was about 330 bp. Lane 1, positive control (R. japonica); lane 2~3, each number of the amplified glta products. (C) The size of amplified 17-kDa product was about 360 bp. Lane 1, positive control (R. japonica); lane 2~3, each number of the amplified 17-kDa products. Lane M, 100 bp DNA ladder; lane N, negative control. The number on the left indicates the molecular size (in base pairs) of the amplified PCR products. Table 3. Similarity matrix between partial ompb gene sequence of various Rickettsial strains and nested PCR ompb products , partial ompb of R. africae (AF123706); 2, R. akari (AF123707); 3, R. conorii (AF149110); 4, R. japonica (AB003681); 5, R. monacensis (EF380356); 6, R. sibirica (AF123722); 7, ompb PCR clone 1; 8, clone 5; 9, clone 14; 10, clone 35; 11, clone 45; 12, clone 81; 13, clone 85; 14, clone 97; 15, clone 100; 16, clone 226 로 clustering 되었다 (Fig. 3). Table 4는 GenBank database에서얻은다양한리케차 glta 염기서열과본연구에서얻은 glta 클론 26개중 10 개의클론들을비교한것이다. 10개의클론들중 9개의클론들 (No. 1, 5, 14, 35, 45, 81, 85, 97, 100) 은 R. japonica 와 cluster를형성하였으며, 98.7~99.3% 의유사도를나

6 322 B-C Moon, et al. Figure 3. Dendrogram representing phylogenetic relationships between partial ompb gene sequences (the size of about 407 bp) of various Rickettsial strain and PCR-amplified ompb products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates. 타냈다. 10개의클론들중 1개의클론 (No. 226) 은 R. monacensis와 cluster를형성하였으며, 99.7% 의유사도를나타냈다. 각클론들을계통발생학적인분석을수행한결과, R. japonica와유사도를갖는 9개클론들을포함하는 Group 1과 R. monacensis와유사도를갖는 1개클론을포함하는 Group 2로 clustering되었다 (Fig. 4). Table 5는다양한리케차 17-kDa 염기서열들과본연구에서얻은 25개의 17-kDa 양성클론들중 9개의클론들을비교한것이다. 9개의클론들 (No. 1, 5, 14, 35, 45, 81, 85, 97, 100) 은모두 R. marmionii와 cluster를형성하였으며유전자염기서열유사도를분석한결과, 9개의클론들은 R. marmionii와 99.4~100% 의유사도를나타냈다. 각클론을계통발생학적인분석을수행한결과, R. marmionii 와유사도를갖는 9개의클론들을포함하는 Group 1으로 clustering 되었다 (Fig. 5). Figure 4. Dendrogram representing phylogenetic relationships between partial glta gene sequences (the size of about 330 bp) of various Rickettsial strains and PCR-amplified glta products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates. 고찰 리케차는자연에서이, 진드기, 벼룩등의흡혈성절지동물에기생하고, 이들을매개로하여사람에게전파되는질환으로인간에게감염되면심각한질병을야기한다 (8). 리케차질환은그원인이되는리케차종에따라여러 group으로나뉘어진다. 현재까지알려진리케차는약 25 종이며 (26), 그중 R. japonica는 Japanese spotted fever를일으키는원인체이며, 1984년일본에서처음분리되었으며, 그이후로다수의환자가보고되었다 (27, 28). 국내에서는 H. longicornis 진드기에서그핵산이존재가확인되었으며 (29), 최근환자에서도분리된바있다 (30). R. monacensis는독일의 English Garden에서채집한 Ixodes ricinus 진드기에서최초로분리된바있으며, Slovakia와 Bulgaria의 I. ricinus 진드기에서분리되었다 (31). 최근에는 Algeria에서채집된 I. ricinus 진드기에서분리되었으

7 SFG Rickettsial Agents in Haemaphysalis longicornis in Jeju Island, Korea 323 Table 4. Similarity matrix between partial glta gene sequence of various Rickettsial strains and nested PCR glta products , partial glta of R. africae (RAU59733); 2, R. akari (RAU59717); 3, R. conorii (RCU59730); 4, R. japonica (RJU59724); 5, R. marmionii (AY737684) 6, R. monacensis (DQ100163); 7, R. sibirica (RSU59734); 8, glta PCR clone 1; 9, clone 5; 10, clone 14; 11, clone 35; 12, clone 45; 13, clone 81; 14, clone 85; 15, clone 97; 16, clone 100; 17, clone 226 Table 5. Similarity matrix between partial 17-kDa gene sequence of various Rickettsial strains and nested PCR 17-kDa products , partial 17-kDa of R. africae (AF445383); 2, R. akari (AF445383) 3, R. conorii (AE008675); 4, R. japonica (RIR17KGCA); 5, R. marmionii (AY737683); 6, R. monacensis (EF380355) 7, R. sibirica (AF445384); 8, 17-kDa PCR clone 1; 9, clone 5; 10, clone 14; 11, clone 35; 12, clone 45; 13, clone 81; 14, clone 85; 15, clone 97; 16, clone 100

8 324 B-C Moon, et al. Figure 5. Dendrogram representing phylogenetic relationships between partial 17-kDa gene sequences (the size of about 360 bp) of various Rickettsial strain and PCR-amplified 17-kDa products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates. 며 (32), Spain에환자의혈액에서균주가분리되어인체에감염될수있음이확인되었다 (33). R. marmionii ( 호주리케차학자 'Marmion' 의이름에서유래 ) 는 Flinders Island spotted fever의원인체인 R. honei의 genetic variant strain으로알려져있으며 (34), 호주의동부지역에서발견되었다 (20, 35). 본연구에서는제주도지역에서채집한진드기의동정을통해진드기의종의분포를확인하는한편, 리케차특이유전자를 PCR 방법으로검출하여그염기서열을분석하여리케차의존재유무의확인과균종의규명에초점을맞추었다. 2007년부터 2008년에걸쳐제주도에서채집한진드기는총 1,584마리였으며, 종을분석한결과 H. longicornis가 1,581마리 (99.81%), H. flava는 3마리 (0.19%) 였다. 따라서제주도지역은 H. longicornis가우점종인것으로확인되었다. ompb 유전자를표적으로하는프라이머를사용하여 nested PCR을수행한결과 H. longicornis 시료들에서최 소감염률은 142였으며 (1,000마리검사기준 ), H. flava 시료들에서최소감염률은 0이었다. 본실험의결과로홍반열군리케차의감염이일어날수있다는것을알수있었다. 하지만이번실험에사용한 H. flava 의개체수가적어감염률을정확히확인하기에는부족한면이있다고할수있다. 따라서더많은 H. flava의개체수를확보하여확인할필요가있다고사료된다. H. longicornis에서추출한 247개의시료중 ompb-pcr 에서 224개에서양성반응을보였으며, 이중 26개를선별하여 PCR을실시하여그산물을클로닝하여염기서열을분석한후 GenBank database에서얻은다양한리케차 partial ompb, glta, 17-kDa 유전자염기서열과비교, 분석하였다. 첫번째로기존에알려진다양한리케차 partial ompb 유전자의염기서열들과 ompb-pcr 산물클론들의염기서열을비교하였다. 총 26개의클론들중 25개의클론들은 R. japonica와가장높은유사도 (98.7~99.2%) 를보였으며, R. africae, R. akari, R. conorii, R. monacensis, R. sibirica 의염기서열과각각 94.9~95.4%, 89.3~89.8%, 95.2~95.7%, 91.2~91.7%, 94.6~95.4% 의유사도를나타내었다. 25개의클론들중 5개의클론들 (No. 1, 35, 61, 66, 77) 은 R. japonica와 98.7%, 7개의클론들 (No. 5, 45, 91, 115, 142, 153, 226) 은 R. japonica와 98.9%, 13개의클론들 (No. 14, 19, 22, 24, 31, 81, 85, 97, 100, 111, 113, 131, 177) 은 R. japonica와 99.2% 의유사도를보였다. 그리고 26개의클론들중 1개의클론 (No. 226) 은 R. monacensis와 99.0% 의유사도를보였다. 두번째로기존에알려진다양한리케차 partial glta 유전자의염기서열들과 glta-pcr 산물클론들의염기서열을비교하였다. 총 26개의클론들중 25개의클론들은 R. japonica와가장높은유사도 (98.7~99.3%) 를보였으며, R. marmionii, R. africae, R. akari, R. conorii, R. monacensis, R. sibirica의염기서열과각각 98.0~98.7%, 98.0~98.7%, 93.6~94.0%, 97.3~98.0%, 94.6~95.3%, 98.0~98.7% 의유사도를보였다. 25개의클론들중 2개의클론들 (No. 5, 22) 은 R. japonica와 98.7% 의유사도를보인반면, R. marmionii와는 98.0% 의유사도를보였다. 25개의클론들중 14개의클론들 (No. 24, 35, 45, 61, 66, 77, 81, 111, 113, 115, 131) 은 R. japonica와 99.0% 의유사도를보인반면, R. marmionii와는 98.3% 의유사도를보였다. 25개의클론들중 9개의클론들 (No. 14, 19, 85, 91, 97, 100, 142, 153,

9 SFG Rickettsial Agents in Haemaphysalis longicornis in Jeju Island, Korea , 189) 은 R. japonica와 99.3% 의유사도를보인반면, R. marmionii와는 98.7% 의유사도를보였다. 그리고 26개의클론중 1개의클론 (No. 226) 은 R. monacensis와 99.7% 의높은유사도를보였다. 마지막으로기존에알려진다양한리케차 partial 17- kda 유전자의염기서열들과 17-kDa-PCR 산물클론들의염기서열을비교하였다. 총 26개의클론들중양성반응을보인 25개의클론들은 R. africae, R. akari, R. conorii, R. japonica, R. marmionii, R. monacensis, R. sibirica의염기서열과각각 97.4~98.0%, 93.3~93.9%, 97.4~98.3%, 98.6~99.1%, 99.4~100%, 93.6~94.2%, 97.7~98.3% 의유사도를보였다. 위의 ompb, glta 유전자의분석결과와달리클론들의 17-kDa 유전자의염기서열의경우 R. japonica와의유사도 (98.6~99.1%) 보다 R. marmionii와높은유사도 (99.4~ 100%) 를보였다. 25개의클론들중 2개의클론들 (No. 1, 113) 은 R. marmionii와 99.4% 의유사도를보인반면, R. japonica와 98.6% 의유사도를보였으며, 23개의클론들 (No. 5, 14, 19, 22, 24, 31, 35, 45, 61, 66, 77, 81, 85, 91, 97, 100, 111, 115, 131, 142, 153, 177, 189, 226) 은 R. marmionii와 100% 의유사도를보인반면, R. japonica와 99.1% 의유사도를보였다. GenBank database에는 R. marmionii에서분석된 ompb 유전자의염기서열이등록되어있지않았으며, 등록된 R. japonica와 R. marmionii의 glta 유전자염기서열을비교한결과 2개의염기가달랐으며 ( 유사도 99.3%), 17-kDa 유전자염기서열을비교한결과 3개의염기차이를보였다 ( 유사도 99.1%). 25개클론의 glta, 17-kDa 유전자염기서열과 R. marmionii의 glta, 17-kDa 유전자염기서열의유사도를비교한결과 glta에서 R. japonica와 98.7~99.3%, R. marmionii와 98.0~98.7% 의유사도를나타내었으며, 17-kDa에서는 R. japonica와 98.6~99.1%, R. marmionii와 99.4~100% 의유사도를나타내었다. 본연구에서는제주도에서채집된진드기의 DNA를사용하여 PCR 방법을통해제주도에분포하는진드기가가지고있는리케차를알아보았으며, 대부분의진드기가홍반열군에감염되어있음을확인하였다. 현재제주도지역의진드기에서리케차검출에관한내용이보고된바가없으나, 열성질환자를대상으로 indirect immunofluorescence assay (IFA) 를사용하여혈청역학조사를한결과제주도지역의환자에서 R. japonica에대한항체를보유한환자가있음이확인되었다 (36). 이러한결과로볼때, 제주도에서식하는 H. longicornis 진드기가병원체의매개체역할을할것으로예상된다. 본연구에서검출한홍반열군리케차핵산들을분석한결과 ompb, glta 유전자특성으로는 R. japonica에가까우며, 17-kDa 유전자특성으로는 R. marmionii에가까운것으로나타났다. 이러한것으로미루어보아제주도에분포하는리케차가새로운종일가능성을배제할수없다. 본연구에서분석한 ompb, glta, 17-kDa 유전자의크기가 500 bp 미만의길이였다. 따라서제주도에분포하는홍반열군리케차를정확히분류하기위해서는보다신뢰성있는길이의유전자를분석하는것이필요하며, 이를위해서는균주를분리하는것이반드시필요할것으로사료된다. 참고문헌 1) Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 2001;51: ) Anacker RL, Pickens EG, Lackman DB. Details of the ultrastructure of Rickettsia prowazekii grown in the chick yolk sac. J Bacteriol 1967;94: ) Pang H, Winkler HH. Analysis of the peptidoglycan of Rickettsia prowazekii. J Bacteriol 1994;176: ) Silverman DJ, Wisseman CL Jr. Comparative ultrastructural study on the cell envelopes of Rickettsia prowazekii, Rickettsia rickettsii, and Rickettsia tsutsugamushi. Infect Immun 1978; 21: ) Drancourt M, Raoult D. Taxonomic position of the rickettsiae: current knowledge. FEMS Microbiol Rev 1994;13: ) Anderson BE, Tzianabos T. Comparative sequence analysis of a genus-common rickettsial antigen gene. J Bacteriol 1989; 171: ) Fournier PE, Raoult D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann N Y Acad Sci 2009;1166: ) Roux V, Raoult D. Phylogenetic analysis of the members of

10 326 B-C Moon, et al. the genus Rickettsia using the gene encoding the outermembrane protein rompb (ompb). Int J Syst Evol Microbiol 2000;50: ) Sekeyová Z, Fournier PE, Rehácek J, Raoult D. Characterization of a new spotted fever group Rickettsia detected in Ixodes ricinus (Acari: Ixodidae) collected in Slovakia. J Med Entomol 2000;37: ) Williams SG, Sacci JB Jr, Schriefer ME, Andersen EM, Fujioka KK, Sorvillo FJ, Barr AR, Azad AF. Typhus and typhus like rickettsiae associated with opossums and their fleas in Los Angeles County, California. J Clin Microbiol 1992;30: ) Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis 2001; 32: ) Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev 1997;10: ) 김관천, 이진종, 김종선, 조영관. 위생곤충학. 파주 : 신광문화사, ) 이순형, 채종일, 홍성태. 임상기생충학개요. 서울 : 고려과학, ) 한국동물분류학회. 한국동물명집. 서울 : 아카데미서적, ) Noh YT. A Taxonomical Study on Ticks in Korea. 한국생물상에관한연구. 과학기술처 R : ) Kim JE, Park HJ, Lee JY, Cho BK, Lee IY, Lee WK, Koh CJ. Three cases of tick bites by Haemophysalis longicornis. Korean J Dermatol 2003;41: ) Roh DK, Jang IG, Cho BK, Son SJ, Lee IY, Lee WK. Tick bite by Haemophysalis longicornis Neumann: Laboratory observation of the causative tick. Korean J Dermatol 1999; 37: ) Yoon SY, Kim KH, Suhr KB, Cho BK, Nam IH, Lee WK, Lee JH, Park JK. A case of tick bite caused by Haemophysalis flava. Korean J Dermatol 1996;34: ) Unsworth NB, Stenos J, Graves SR, Faa AG, Cox GE, Dyer JR, Boutlis CS, Lane AM, Shaw MD, Robson J, Nissen MD. Flinders Island spotted fever rickettsioses caused by "marmionii" strain of Rickettsia honei, Eastern Australia. Emerg Infect Dis 2007;13: ) Yamaguti N, Tipton VJ, Keegan H, Toshioka S. Ticks of Japan, Korea, and the Ryukyu islands. Brigham Young University Science Bulletin 1971;15: ) Choi YJ, Lee SH, Park KH, Koh YS, Lee KH, Baik HS, Choi MS, Kim IS, Jang WJ. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin Diagn Lab Immunol 2005;12: ) Choi YJ, Jang WJ, Kim JH, Ryu JS, Lee SH, Park KH, Paik HS, Koh YS, Choi MS, Kim IS. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis 2005;11: ) Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspeecies sequence divergence for portions of two rickettsial genes. J Bacteriol 1991; 173: ) Leitner M, Yitzhaki S, Rzotkiewicz S, Keysary A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am J Trop Med Hyg 2002;67: ) Rolain JM, Maurin M, Vestris G, Raoult D. In vitro susceptibilities of 27 rickettsiae to 13 antimicrobials. Antimicrob Agents Chemother 1998;42: ) Gaywee J, Sunyakumthorn P, Rodkvamtook W, Ruang-areerate T, Mason CJ, Sirisopana N. Human infection with Rickettsia sp. related to R. japonica, Thailand. Emerg Infect Dis 2007; 13: ) Mahara F, Koga K, Sawada S, Taniguchi T, Shigemi F, Suto T, Tsuboi Y, Ooya A, Koyama H, Uchiyama T, T. Uchida. The first report of the rickettsial infections of spotted fever group in Japan: three clinical cases. Kansenshogaku Zasshi 1985;59: ) Lee JH, Park HS, Jung KD, Jang WJ, Koh ES, Kang SS, Lee IY, Lee WJ, Kim BJ, Kook YH, Park KH, Lee SH. Identification of the spotted fever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol 2003;47: ) Chung MH, Lee SH, Kim MJ, Lee JH, Kim ES, Lee JS, Kim MK, Park MY, Kang JS. Japanese spotted fever, South Korea. Emerg Infect Dis 2006;12: ) Weller SJ, Baldridge GD, Munderloh UG, Noda H, Simser J, Kurtti TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J Clin Microbiol 1998;36: ) Dib L, Bitam I, Bensouilah M, Parola P, Raoult D. First description of Rickettsia monacensis in Ixodes ricinus in Algeria. Clin Microbiol Infect 2009 May 27 [Epub ahead of print].

11 SFG Rickettsial Agents in Haemaphysalis longicornis in Jeju Island, Korea ) Jado I, Oteo JA, Aldámiz M, Gil H, Escudero R, Ibarra V, Portu J, Portillo A, Lezaun MJ, García-Amil C, Rodríguez- Moreno I, Anda P. Rickettsia monacensis and human disease, Spain. Emerg Infect Dis 2007;13: ) Unsworth NB, Stenos J, Faa AG, Graves SR. Three rickettsioses, Darnley Island, Australia. Emerg Infect Dis 2007;13: ) Graves S, Stenos J. Rickettsioses in Australia. Ann N Y Acad Sci 2009;1166: ) Jang WJ, Kim JH, Choi YJ, Jung KD, Kim YG, Lee SH, Choi MS, Kim IS, Walker DH, Park KH. First serologic evidence of human spotted fever group rickettsiosis in Korea. J Clin Microbiol 2004;42:

Lumbar spine

Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical