45(3)-6(040)p fm

Size: px

Start display at page:

Download "45(3)-6(040)p fm"

서진 두
5 years ago
Views:

1 The Korean Journal of Microbiology, Vol. 45, No. 3, September 009, p Copyright 009, The Microbiological Society of Korea RpoS ³ ³ ƒ 1, Á½ ³ 1 * w w w w s» p RpoS w s w x w. ³ proline w w proba proc x s» w, s» proba proc x w, s» x w. ù rpos x ³ w proline w w proba proc x s» w. w RpoS ƒ proline w w proba proc x z eš w. wr rpos ³ proline threonine, methionine, lysine, arginine x w ƒ, rpos ³ ³ ƒ w. Key words ý amino acids, E. coli, proline, rpos mutant w w w z š, p w w œ z w ³, z y w» š (1). p, ³ w w ³ k w ù, ³ k jš w. q system biology d wš w š ³ œw w x w y jš w (8, 15, 17). wr, w m ³ w w w w x w mw x w ƒ š (5, 0, 3), œ w w x x ùkú w d p j(global network) d w w.» w w w w ü w z ³ w. *To whom correspondence should be addressed. Tel: , Fax: igkim@kaeri.re.kr ³(Escherichia coli)» s»(stationary phase) RpoS rpos w yy, s» w p w, ³ w v w (, 11, 19). p, w RpoS s» x s w x w (10, 1, ). wr, s s» s z d w RNA w g w v ƒ w s» ƒ, s w j w. RpoS mw ƒ w». proline w w x RpoS w w š, x rpos w k k ³ w proline w ƒw š w. ³ ƒ w z e w. ³ ³ w ³ ³ K-1 x ³ QC461 (9) w.» x ³ l rpos ³ P1 x y(p1 transduction) 63

2 64 Il Lae Jung and In Gyu Kim Kor. J. Microbiol w QC461, rpos::tn10 (13) ³ w.» ³ 37 o C, 00 rpm w k w. LB (Luria-Bertani medium, LB; bacto-tryptone 10 g, bacto-yeast extract 5 g, NaCl 10 g per L) 1~16 w s» Ÿ (600 nm)ƒ 0.01 LB w w.» ù s l»( 3 )»( 8 ) ƒƒ s w x w. RNA c-dna w p ³ s QIAGEN RNA Isolation kit w RNA w. RNA l cdna w jp(( ) Intron, Korea) w cdna w w z x w. RT-PCR w (polymerization chain reaction, PCR)» ww (1), š j k. prob-f (aaccgtgcccatatcgttgaac), prob-r (aaatgcctt ccatcacatcacc), proa-f (ccgatgaactggaagcacaaag), proa-r (tccgcca tttgtttgcttaatg), proc-f (aatatgggaaaagccattctcg), proc-r (ccgg tgagcagaccatatcttt). ƒ PCR tube PCR r (500 mm KCl, 00 mm Tris-Cl; ph 7.4) 50 pmol š j k v, 0.4 mm dntp, 4 mm MgCl, ³ cdna, š 10 U Taq DNA polymerase ƒw. PCR DNA thermal cycler (Perkin-Elmer Cetus) ww. w s 5% TCA w z 15 w. z 0.0 N HCl w z vl w w. û w œ x ninhydrin w post-reaction w.»» HITACHI L Amino Acid Analyzer w main column HITACHI HPLC Packed Column #6PF Column ( mm) ion exchange column w. w ƒ x ninhydrin 1ml (PH-1) 1 ml ƒƒ ƒw z C ƒ g o. Wako L-8500 buffer solution PF-1,,3,4, RG ninhydrin coloring solution set w, 570 nm Ÿ d w.» VIS1: 570 nm, VIS: 440 nm, UV detector EZ chrom Elite ver b v w.» w t Wako PF standard (Type B, ) w t Ÿ w w. Proline w x α-ketoglutarate l glutamate γ-semialdehyde (GSA) L-proline w Vogel Davis w (4). Proline w Fig. 1A B ùkü. wr, prob w yy γ- glutamyl kinase (EC.7..11) proa w yy γ- glutamic semialdehyde dehydrogenase (EC ) ³ 5.6~5.7 ewš r (3). w proc w yy pyrroline- 5-carboxylate reductase (EC ) 8.7 e (3). Fig. 1. Proline biosynthetic pathway (A), the related genes (B), and RT-PCR analysis of proba and proc genes (C).

3 Vol. 45, No. 3 RpoS 65 proba proc x w» w x QC461 rpos ³ LB w z ƒƒ s» s» RNA w cdna w w z, w cdna x w proba proc x PCR» w. x ³ proba proc» j x, s» x š w (Fig. 1C). w, rpos» x w proba proc x ù, s» x proba proc x š,» w x š (Fig. 1C). s» x w» w x w rpos k s» x w proline w ƒ ù w. RpoS ƒ proba proc x w sƒ» proba proc ƒ š x š ùkü. rpos s s» proba proc ù. w proba proc x ª s» proline w w» w ww. w x rpos s LB w s» ƒƒ w proline w. rpos ³ x w.5 proline w š (Fig. ). rpos ³ proba proc x w w proline w ƒ y y š proline w z w. rpos ³ w proba proc» w proline w k Fig.. Comparison of proline production in the wild type and its isogenic rpos mutant. Mean data of two independent experiments are presented and the variations are below 10%. Fig. 3. Comparison of amino acid production in the wild type and its isogenic mutant. (þ ) QC461;(ý ) QC461, rpos. Mean data of two independent experiments are presented and the variations are below 10%.. wr, proline x rpos s w w. Fig. 3 threonine, methionine, lysine, arginine x w ƒ. š Corynebacterium m ³ w š ³ (18). w w w ³ k w ù w w z jš w š. wr, œw w k ³ threonine w jš w ƒ š» w (16). Corynebacterium ³ jš w system biology š, t ³ š ³ ƒ ³. ³ š» œw w š. proline w j» w w ¼ w (analog) w ù (feedback inhibition) w» (4, 6, 7). w š ³ global (global regulator) š RpoS yyw rpos k, proline w jš w. RpoS sƒ s»» y w w j» ƒ š global w. s»

4 66 Il Lae Jung and In Gyu Kim Kor. J. Microbiol w v w RpoS w» s w» ww š w., w» RpoS k s s» ã ý y š ü. w q ww ew., q s» w š s» w TCA z w p k yz (isocitrate dehydrogenase) y w rpos» s» x w (14). s» w RpoS» w x w x, TCA cycle w x qw w w y j w. Fig. 1 proline w w proba proc x RpoS w w š, rpos s proline w x w ƒw. w» w w œw (, w ) y x w x w w jš w. Fig. 3 threonine, methionine, lysine, arginine x w ƒ ù, x w x w ƒ. RpoSƒ w w w x e z ³ w w, w w RpoS z d w w» w û w. w RpoS z x ƒ w global w z r w q. RpoS RNA polymerase ³ promoter ww x w t (, 11, 19).» w ³ Corynebacterium w ƒ w x ù, RpoS» RNA wz (RNA polymerase)» Corynebacterium w w ƒ j š w. wz Corynebacterium ³ w RpoS w w v ƒ š q. ³ wz w œw» w ³ š ³ rpos wì w z w». š x ³. KISTI» w š.. Becker, G. and R. Hengge-Aronis What makes an Escherichia coli promoter sigma(s) dependent? Role of the -13/-14 nucleotide promoter positions and region.5 of sigma(s). Mol. Microbiol. 39, Bachmann, B.J Linkage map of Escherichia coli K-1, 8 th ed. Microbiol. Rev. 54, Bloom, F., C.J. Smith, J. Jessee, B. Veiileux, and A.H. Deutch The use of genetically engineered strains of Escherichia coli for the overproduction of free amino acids: proline as a model system, pp In Advances in Gene Technology, Academic Press, Orlando, Fla., USA. 5. Burgard, A.P., P. Pharkya, and C.D. Maranas Optknock: a bilevel programming framework for identifying gene knockout strategies for microbial strain optimization. Biotechnol. Bioeng. 84, Condamine, H Sur la regulation de la production de proline chez E. coli K1. Ann. Inst. Pasteur 10, Csonka, L.N Proline overproduction results in enhanced osmotolerance in Salmonella typhimurium. Mol. Gen. Genet. 18, Fong, S.S., A.P. Burgard, C.D. Herring, E.M. Knight, F.R. Blattner, C.D. Maranas, and B.O. Palsson In silico design and adaptive evolution of Escherichia coli for production of lactic acid. Biotechnol. Bioeng. 91, Gaudu, P., S. Dubrac, and D. Touati Activation of SoxR by overproduction of desulfoferrodoxin: multiple ways to induce the soxrs regulon. J. Bacteriol. 18, Hengge-Aronis, R Regulation of gene expression during entry into stationary phase, pp In Escherichia coli and Salmonella: nd ed. ASM Press, Washington, D.C., USA. 11. Hengge-Aronis, R. 00. Signal transduction and regulatory mechanisms involved in control of the sigma(s) (RpoS) subunit of RNA polymerase. Microbiol. Mol. Biol. Rev. 66, Jung, I.L. and I.G. Kim Polyamines and glutamate decarboxylase-based acid resistance in Escherichia coli. J. Biol. Chem. 78, Jung, I.L. and I.G. Kim Transcription of ahpc, katg, and kate genes in Escherichia coli is regulated by polyamines: polyamine-deficient mutant sensitive to H O -induced oxidative damage. Biochem. Biophys. Res. Commun. 301, Jung, I.L., S.K. Kim, and I.G. Kim The RpoS-mediated regulation of isocitrate dehydrogenase gene expression in Escherichia coli. J. Curr. Microbiol. 5, Kim, T.Y., H.U. Kim, and S.Y. Lee Metabolite-centric approaches for the discovery of antibacterials using genome-scale metabolic networks. Metab. Eng. doi: /j.ymben [in press] 16. Lee, K.H., J.H. Park, T.Y. Kim, H.U. Kim, and S.Y. Lee Systems metabolic engineering of Escherichia coli for L-threonine production. Mol. Syst. Biol. 3, Lee, S.Y., H.U. Kim, J.H. Park, J.M. Park, and T.Y. Kim Metabolic engineering of microorganisms: general strategies and drug production. Drug Discov. Today 14, Leuchtenberger, W., K. Huthmacher, and K. Drauz Biotechnoligical production of amino acids and derivatived: current status

5 Vol. 45, No. 3 RpoS 67 and prospects. Appl. Microbiol. Biotechnol. 69, Loewen, P.C., B. Hu, J. Strutinsky, and R. Sparling Regulation in the rpos regulon of Escherichia coli. Can. J. Microbiol. 44, Pharkya, P., A.P. Burgard, and C.D. Maranas OptStrain: a computational framework for redesign of microbial production systems. Genome Res. 14, Sambrook, J. and D.W. Russell Molecular cloning: A laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, N.Y., USA.. Schellhorn, H.E., J.P. Audia, L.I. Wei, and L. Chang Identification of conserved, RpoS-dependent stationary-phase genes of Escherichia coli. J. Bacteriol. 180, Segr, D., D. Vitkup, and G.M. Church. 00. Analysis of optimality in natural and perturbed metabolic networks. Proc. Natl. Acad. Sci. USA 99, Vogel, H.J. and B.D. Davis Glutamic γ-semialdehyde and 1 -pyrroline-5-carboxylic acid, intermediates in the biosynthesis of proline. J. Am. Chem. Soc. 74, (Received August 11, 009/Accepted September 15, 009) ABSTRACT : Increased Production of Amino Acids in an Escherichia coli rpos Mutant Il Lae Jung 1, and In Gyu Kim 1 * ( 1 Department of Radiation Biology, Korea Atomic Energy Research Institute, Daejon , Republic of Korea, Division of Biological Sciences, Chonbuk National University, Chonbuk , Republic of Korea) An RpoS factor is a transcriptional regulator which participates in numerous biological processes. In this work, we investigated the transcriptional regulation of proba and proc composing proline biosynthetic pathway in Escherichia coli. While the proba and proc genes were greatly induced in an exponential growth phase, they were dramatically repressed in a stationary growth phase in the wild type E. coli. Unlike the wild type E. coli, the proba and proc genes were not repressed even in the stationary growth phase in its isogenic rpos mutant. These results suggest that the RpoS factor acts as a transcriptional repressor of proba and proc genes. The production of threonine, methionine, lysine, and arginine in the rpos mutant were also increased by more than two times compared to its parental wild type, suggesting that the mutant is able to be used as an useful host strain for the amino acid overproduction.

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½