( )Ksgoc hwp

Size: px

Start display at page:

Download "( )Ksgoc hwp"

주화 엄
5 years ago
Views:

1 원저 부인종양제 18 권제 2 호 2007 Vol. 18, No. 2, June, 2007 성균관대학교의과대학삼성서울병원산부인과학교실고옥진 최철훈 김태중 김우영 이경미 최정주 이정원 김병기 이제호 배덕수 목적 : 본연구는자궁경부포암에서염색체 3p 종양억제유전자인 FHIT의과메틸화와이형접합소실, 그리고이들의상관관계를분석하고자하였다. 연구방법 :37개의자궁경부암과각각의정상조직에서 FHIT 유전자의메틸화를메틸화특이중합효소연쇄반응을사용하여분석하였고, 또한이형접합소실에대해서도분석하였다. 결과 : 자궁경부암의 24% 에서 FHIT의과메틸화를보인반면에, 정상조직에서는과메틸화를관찰할수없었다. 이형접합소실은 FHIT 부위에서 10% (3/29) 관찰되었으나, 이형접합소실과과메틸화사이에연관성은보이지않았다. 또한 FHIT 과메틸화가있는종양은과메틸화가없는종양에비해종양의크기가작았고 (p=0.024), 종양의크기를보정하였을때림프절전이가유의하게더흔하게관찰되었다 (44.4% vs. 21.4%, p=0.034). 결론 :FHIT의 promoter 과메틸화와이형접합소실은초기자궁경부암에서흔히관찰되었고암의발생에중요한역할을할것으로보인다. 또한 FHIT 과메틸화는병의진행정도와상관관계가있는것으로보이며이에대한추가연구가필요하리라고사료된다. 중심단어 : 과메틸화, 이형접합소실, FHIT, 자궁경부암 서 론 자궁경부암은여성에서가장흔한암의하나로알려져있다. 1 전암상태가침습적자궁경부암이되기전까지발견될수있는충분한기회를제공하고초기진단의모델이된다는사실에도불구하고아직그발생률이높은것은매우주목할만한일이다. 인유두종바이러스의감염이자궁경부암발생에중요한역할을하는것은사실이지만, 이바이러스의감염만으로모든자궁경부암의발생을설명할수는없다. 실제로인유두종바이러스에오랜기간노출되었더라도모두가암으로진행하는것은아니며, 인유두종바이러스감염이검출되지않는자궁경부암도존재한다. 따라서자궁경부암의발생원인 논문접수일 :2007 년 5 월 8 일채택일 :2007 년 5 월 18 일교신저자 : 김병기, 서울시강남구일원동 50 번지삼성서울병원산부인과전화 :02) 전송 :02) bgkim@smc.samsung.co.kr 을파악하기위해서는인유두종바이러스감염이외에도발암유전자들의활성화, 일정한염색체부위의소실, p53 또는 Rb 유전자등과같은항암유전자들의변이및암화과정에있어서개인간의유전적감수성을결정짓는숙주인자들에대한역할의규명이필요하다. 정상의자궁경부세포가암세포로바뀌는과정에는다양한유전학적 (genetic) 및부유전학적 (epigenetic) 인변화가관여하는다단계의유전적변화를동반한다. 이러한다단계의유전적변화에는전암성종양유전자의활성화와종양억제유전자의불활성화등이있다. Saxon 등은정상염색체 11번을자궁경부암세포주 HeLa에삽입하여종양화과정이억제되는현상을알아냈으며, 2 Yokota 등은자궁경부암조직에서염색체 3번단완의결손이 100%, 17번단완및 13번장완의결손이 30% 정도있다는사실을밝히면서자궁경부암에서이들부위에존재하는종양억제유전자의가능성을시사하였다. 3 이중염색체 3번단완 (3p) 의결손은신세포암, 방광암, 폐암등여러종양에서관찰되었고, 3p12, 3p14, 3p21과 139

2 부인종양제 18 권 2 호 고옥진외 3p24-25 등을포함하는 3p 영역이종양억제유전자가상주하는곳이라믿어진다. 종양억제유전자의촉진부에위치한 CpG island의과메틸화는여러악성종양에서흔히관찰되고있는부유전학적변화로, 4-6 종양에서유전자의기능소실에중요한기전으로생각되고있다. 종양억제유전자는구조적변화 ( 변이, 결손 ) 뿐만아니라, 촉진부과메틸화에의해서도억제될수있다는사실로종양억제유전자의부유전학적상실이잘정립된종양발생의과정으로알려지고있다. 7 과메틸화됨으로써억제되는것으로알려진첫번째종양억제유전자는 Rb이며, 8 p16, MLH1, VHL과 E-cadherin 등도알려져왔다. 9 그러나과메틸화가종양억제유전자기능상실의원인인지결과인지는여전히논란의여지가있다. 또한염색체 3p 내의대립유전자소실역시자궁경부암을비롯한다양한종류의암에서흔하게보이는현상이며, VHL (3p25), RAR-β (3p24), RASSF1A (3p21.3), FHIT (3p14.2) 를포함한여러종양억제유전자가염색체 3p에존재한다고알려져있다 이중 FHIT (Fragile Histidine Triad) 유전자는 1996년 Ohta 등에의해서클로닝이되었으며, 13 암조직에서 FHIT 유전자의변이나비정상적 mrna 전사체형성은소세포폐암, 비소세포폐암, 위암, 메르켈세포암종, 유방암, 이하선의다형성선종등여러암에서보고된바있다. 14,15 자궁경부암에서도염색체표지자연구를통하여 FHIT 유전자영역에이형성소실 (loss of heterozygosity; LOH) 이있음이관찰되었고이러한변화는자궁경부암발생의초기에일어나는현상임이시사되었다. 16 본연구는자궁경부암에서염색체 3p에존재하는종양억제유전자중 FHIT 유전자의촉진부메틸화와이형접합소실의빈도, 이들사이의상관관계, 그리고그임상 적인의미에대해서분석하였다. 연구대상및방법 1. 조직표본과 DNA 추출자궁경부암으로삼성서울병원에입원하여근치적자궁절제술을시행한 37명의환자에서 ( 평균연령 48세, 범위 36-73세 ) 기관윤리위원회승인후암표본과정상조직을각각수집하였다. 수술중얻어진조직표본은즉시 -80 o C에서보관하였고 DNA를추출하였다. 17 FIGO stage IB인환자가 31명이었고 IIA 환자는 6명이었다. 평균종양크기는 3.6 cm이었고골반림프절전이가있는경우가 10명 (27%) 이었다. 2. 메틸화특이중합효소연쇄반응 (methylation-specific PCR) FHIT 18 promoter 부위의메틸화는메틸화특이중합효소연쇄반응에의해평가하였다. 각각의시발체 (primer) 서열은 Table 1과같고가열온도는 66 o C이었다. Genomic DNA는 Easy-spin genomic DNA extraction kit (intron Biotech, Seoul, Korea) 를사용하여분리하였다. 1μg의 genomic DNA는 EZ DNA methylation kit (Zymo Research, CA) 를사용하여 modify하였고각각비메틸화서열과메틸화서열에대한 primer를사용하여증폭하였다. PCR 증폭에는 i-max TM II DNA Polymerase kit (intron Biotech, Seoul, Korea) 를사용하였다. 대조군으로는, 생체외에서 SssI methylase에처리된림프구의 DNA를메틸화의양성대조군으로, SssI methylase에처리되지않은림프구의 DNA를비메틸화의양성대조군으로사용하였다. 이렇게얻은 PCR 산물은 2-3% agarose gel에전 Table 1. Primer sequences for MSP and markers for LOH MSP LOH Gene }} Primer sequence Region Marker FHIT U: TTGGGGTGTGGGTTTGGGTTTTTATG (sense) CATAAACAACACCAACCCCACTA (antisense) D3S1234 3p14.2 M: TTGGGGCGCGGGTTTGGGTTTTTACGC (sense) D3S1300 CGTAAACGACGCCGACCCCACTA (antisense) U; unmethylated, M; methylated, FHIT; fragile histidine triad 140

3 Fig. 1. Representative results of MSP analysis for FHIT gene using primers specific for unmethylated (U) or methylated (M) sequences. PC; positive control, NC; negative control, T; tumor, N; normal tissue, arrow; product size. 기영동하여각각의크기 (bp) 와증폭여부를확인하였다. 3. 이형접합소실분석정상조직과종양조직의 DNA 표본에서 2개의다형성표지자 (polymorphic microsatellite marker) 를이용하여분석하였다. 그 marker는 Table 1과같으며시발체서열은 Genome Database에서얻었다. PCR 증폭은미세위성표지자 (microsatellite primer) 에 label된 5'-fluorescent dye (6FAM, NED, HEX) 를사용하여시행하였다 (i-max TM II DNA Polymerase kit). PCR 산물을 HiDi formamide로 denature한후전기영동에의해 dye-labeled DNA fragment 를분리하였다. 이형접합소실은 Applied Biosystems Prism Genescan와 Applied Biosystems Prism Genetyper software (PerkinElmer/Applied Biosystems) 를사용하여분석하였고 peak allele signal이정상조직의 50% 이하일때이형접합소실이있다고보았다. 4. 통계학적분석통계분석은 Fisher's exact test와 Student's t-test로시행되었고 SPSS 10.0 (SPSS Inc., Chicago, IL) 를사용하였다. 결과 1. 메틸화분석자궁경부암과정상조직에서의 FHIT 유전자의메틸화빈도는 Table 2와같다. FHIT의과메틸화는정상조직에서는관찰되지않았고 (0/37), 암표본의 24% (9/37) 에서관찰되었다. 메틸화를보이는암조직에서도 unmethylated band를관찰할수있었는데이는종양에존재하는잔류기질세포 (residual stromal cell) 에기인한것으로보인다. 각각의암조직에서메틸화특이중합효소연쇄반응의결과는 Fig. 1, 2와같다. T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15 T16 T17 T18 T19 T20 T21 T22 T23 T24 T25 T26 T27 T28 T29 T30 T31 T32 T33 T34 T35 T36 T37 Hypermethylation FHIT D3S1234 LOH D3S1300 Fig. 2. Summary of hypermethylation and LOH analysis for FHIT gene in cervical squamous cell carcinomas. Black boxes; samples that are methylated or show LOH, white boxes; samples that are not methylated or show retention, gray boxes; samples that are not informative in LO H analysis. 141

4 부인종양제 18 권 2 호 고옥진외 Table 2. The frequency of promoter hypermethylation and LOH of FHIT gene in cervical carcinomas and corresponding nonmalignant cervical tissues (n=37) No. of No. of cases hypermethylation/loh Promoter hypermethylation Tumor 37 9 (24%) Nonmalignant tissue 37 0 (0%) Loss of heterozygosity Informative cases 29 3 (10%) Table 3. Correlation between hypermethylation and LOH of FHIT gene on chromosome 3p* No. of gene methylation + - LOH+ 1 2 LOH NI 1 7 p *+; hypermethylation, -; nonhypermethylation +; loss, -; retention, NI; not informative Fisher's exact test without NI 3. 메틸화 / 이형접합소실의임상병리학적연관성메틸화 / 이형접합소실과임상변수사이의상관관계는 Table 4와같다. FHIT 과메틸화가있는종양은과메틸화가없는종양에비해종양의크기가작았다 (p=0.024). 또한 FHIT 과메틸화가있는환자에서과메틸화가없는경우보다골반림프절전이가더흔하게관찰되었고 (44.4% vs. 21.4%, p=0.215), 종양의크기를보정하였을때 (logistic regression model, as a continuous variable) 통계적으로유의하였다 (p=0.034). 그러나, 이형접합소실과임상변수사이에서는의미있는연관성이관찰되지않았다. 고 찰 Fig. 3. Representative results of detection of LOH in primary cervical cancer. The marker D3S1234 (flanking 3p14.2 regions for FHIT) were used (T30). Arrows indicate alleles that showed LO H in the tumor samples. 2. 이형접합소실과메틸화사이의상관성 한가지이상의표지자 (marker) 에서 informative했던종양조직에서 FHIT 부위의이형접합소실은 10% (3/29) 에서관찰되었다 (Table 2). 이형접합소실의결과는 Fig. 2, 3과같다. 이형접합소실과과메틸화사이에연관성은보이지않았다 (Table 3). 본연구는자궁경부상피세포암에서염색체 3p에존재하는종양억제유전자인 FHI의 promoter 메틸화와이형접합소실의빈도를조사하였으며, 임상병리학적변수들과의상관관계를보고자하였다. 자궁경부암에서 FHIT 과메틸화의빈도는 11-88% 로다양하게보고되며, 환자군의특성과연구방법의차이에기인할것으로보이며, 본연구에서의빈도는이들의범위에속하였다. 식도상피세포암에서 FHIT의과메틸화가 FHIT 지역의이형접합소실과유의한상관관계가있다고보고된바있다. 22 이는한쪽대립유전자의메틸화와다른쪽대립유전자의이형접합소실에의한양쪽대립유전자의불활성화 (two-hit mechanism) 가식도상피세포암의발생에중요한역할을할것이라는가설을제시했다. 자궁경부암에서도 RASSF1A의과메틸화와 3p21부위의이형접합 142

5 Table 4. Clinicopathological correlations of promoter hypermethylation and LOH of FHIT gene* Methylation LOH }} + - p + - p Mean age (years) FIGO stage IB IIA Tumor size (cm) Invasion depth <50% % LNs metastasis Positive Negative *+; hypermethylation or loss, -; nonhypermethylation or retention Mean age and tumor size, Student's t-test; all other comparisons, Fisher's exact test; lymph nodes (LNs) metastasis, logistic regression model with tumor size (continuous variable) and LNs metastasis as covariates Pathologically determined greatest diameter of tumor Cervical stromal invasion depth FIGO; International Federation of Gynecology and Obstetrics 소실이동시에관찰되는경우가흔하다고보고된바있다. 23 그러나본연구에서는이와같은 two-hit mechanism 이단지 1개의종양표본에서만관찰되어자궁경부암에서는흔하지않는것으로보여진다. FHIT 단백질의발현소실과빈번한림프절전이사이의관계는자궁경부암을포함한여러암에서보고된바있다 본연구결과는 FHIT의과메틸화또한종양의크기나림프절전이와관련될수있음을시사한다. FHIT 전사의이상은자궁경부암에서는흔하지만전암병변에서는낮은빈도로나타난다고보고되고, 27,28 이러한결과는메틸화를포함한 FHIT 유전자의분자적변화가종양형성의후반에일어남을암시한다. 1996년에처음발견된 FHIT는종양억제유전자의하나로크게주목받고있으며세포자살 (apoptosis) 과세포주기 (cell cycle) 의조절에중요한역할을담당하고있는것으로알려져있다. 13,29 지금까지의연구에따르면폐암, 15 유방암, 14 소화기암, 30 등의종양에서이상발현의빈도가높게보고되고있어종양억제유전자로서상피성종양의발생에관여하고있음이밝혀지고있다. 또한인유두종바이러스 DNA의 integration 장소로알려진 3p14.2에위치하고있어자궁경부암과도밀접한관계가 있을것으로추정된다. 13 결론적으로 FHIT의 promoter 과메틸화나이형접합소실은초기자궁경부암에서흔히관찰되었고암의발생에중요한역할을할것으로보인다. 그러나 FHIT 유전자에있어과메틸화와이형접합소실이동시에일어나는 two-hit mechanism은자궁경부암에서는흔하지않은것으로보인다. 참고문헌 1. Pisani P, Bray F, Parkin DM. Estimates of the world-wide prevalence of cancer for 25 sites in the adult population. Int J Cancer 2002; 97: Saxon PJ, Srivatsan ES, Stanbridge EJ. Introduction of human chromosome 11 via microcell transfer controls tumorigenic expression of HeLa cells. Embo J 1986; 5: Yokota J, Tsukada Y, Nakajima T, Gotoh M, Shimosato Y, Mori N, et al. Loss of heterozygosity on the short arm of chromosome 3 in carcinoma of the uterine cervix. Cancer Res 1989; 49: Esteller M. CpG island hypermethylation and tumor suppressor genes: A booming present, a brighter future. Oncogene 2002; 21: Jin Z, Tamura G, Tsuchiya T, Sakata K, Kashiwaba M, Osakabe M, et al. Adenomatous polyposis coli (APC) gene 143

6 부인종양제 18 권 2 호 고옥진외 promoter hypermethylation in primary breast cancers. Br J Cancer 2001; 85: Soria JC, Lee HY, Lee JI, Wang L, Issa JP, Kemp BL, et al. Lack of PTEN expression in non-small cell lung cancer could be related to promoter methylation. Clin Cancer Res 2002; 8: Laird PW, Jaenisch R. DNA methylation and cancer. Hum Mol Genet 1994; 3: Greger V, Passarge E, Hopping W, Messmer E, Horsthemke B. Epigenetic changes may contribute to the formation and spontaneous regression of retinoblastoma. Hum Genet 1989; 83: Santini V, Kantarjian HM, Issa JP. Changes in DNA methylation in neoplasia: Pathophysiology and therapeutic implications. Ann Intern Med 2001; 134: Dammann R, Li C, Yoon JH, Chin PL, Bates S, Pfeifer GP. Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet 2000; 25: de The H, Vivanco-Ruiz MM, Tiollais P, Stunnenberg H, Dejean A. Identification of a retinoic acid responsive element in the retinoic acid receptor beta gene. Nature 1990; 343: Latif F, Tory K, Gnarra J, Yao M, Duh FM, Orcutt ML, et al. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science 1993; 260: Ohta M, Inoue H, Cotticelli MG, Kastury K, Baffa R, Palazzo J, et al. The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell 1996; 84: Negrini M, Monaco C, Vorechovsky I, Ohta M, Druck T, Baffa R, et al. The FHIT gene at 3p14.2 is abnormal in breast carcinomas. Cancer Res 1996; 56: Sozzi G, Veronese ML, Negrini M, Baffa R, Cotticelli MG, Inoue H, et al. The FHIT gene 3p14.2 is abnormal in lung cancer. Cell 1996; 85: Wistuba, II, Montellano FD, Milchgrub S, Virmani AK, Behrens C, Chen H, et al. Deletions of chromosome 3p are frequent and early events in the pathogenesis of uterine cervical carcinoma. Cancer Res 1997; 57: Mori M, Shiraishi T, Tanaka S, Yamagata M, Mafune K, Tanaka Y, et al. Lack of DMBT1 expression in oesophageal, gastric and colon cancers. Br J Cancer 1999; 79: Zochbauer-Muller S, Fong KM, Maitra A, Lam S, Geradts J, Ashfaq R, et al. 5' CpG island methylation of the FHIT gene is correlated with loss of gene expression in lung and breast cancer. Cancer Res 2001; 61: Dong SM, Kim HS, Rha SH, Sidransky D. Promoter hypermethylation of multiple genes in carcinoma of the uterine cervix. Clin Cancer Res 2001; 7: Narayan G, Arias-Pulido H, Koul S, Vargas H, Zhang FF, Villella J, et al. Frequent promoter methylation of CDH1, DAPK, RARB, and HIC1 genes in carcinoma of cervix uteri: Its relationship to clinical outcome. Mol Cancer 2003; 2: Virmani AK, Muller C, Rathi A, Zoechbauer-Mueller S, Mathis M, Gazdar AF. Aberrant methylation during cervical carcinogenesis. Clin Cancer Res 2001; 7: Kuroki T, Trapasso F, Yendamuri S, Matsuyama A, Alder H, Mori M, et al. Allele loss and promoter hypermethylation of VHL, RAR-beta, RASSF1A, and FHIT tumor suppressor genes on chromosome 3p in esophageal squamous cell carcinoma. Cancer Res 2003; 63: Yu MY, Tong JH, Chan PK, Lee TL, Chan MW, Chan AW, et al. Hypermethylation of the tumor suppressor gene RASSFIA and frequent concomitant loss of heterozygosity at 3p21 in cervical cancers. Int J Cancer 2003; 105: Mori M, Mimori K, Masuda T, Yoshinaga K, Yamashita K, Matsuyama A, et al. Absence of Msh2 protein expression is associated with alteration in the FHIT locus and Fhit protein expression in colorectal carcinoma. Cancer Res 2001; 61: Bragantini E, Barbi S, Beghelli S, Moore PS, de Manzoni G, Roviello F, et al. Loss of Fhit expression is associated with poorer survival in gastric cancer but is not an independent prognostic marker. J Cancer Res Clin Oncol 2006; 132: Huang LW, Chao SL, Chen TJ. Reduced Fhit expression in cervical carcinoma: Correlation with tumor progression and poor prognosis. Gynecol Oncol 2003; 90: Muller CY, O'Boyle JD, Fong KM, Wistuba II, Biesterveld E, Ahmadian M, et al. Abnormalities of fragile histidine triad genomic and complementary DNAs in cervical cancer: Association with human papillomavirus type. J Natl Cancer Inst 1998; 90: Yoshino K, Enomoto T, Nakamura T, Sun H, Ozaki K, Nakashima R, et al. FHIT alterations in cancerous and non-cancerous cervical epithelium. Int J Cancer 2000; 85: Croce CM, Sozzi G, Huebner K. Role of FHIT in human cancer. J Clin Oncol 1999; 17: Gemma A, Hagiwara K, Ke Y, Burke LM, Khan MA, Nagashima M, et al. FHIT mutations in human primary gastric cancer. Cancer Res 1997; 57:

7 Promoter hypermethylation and loss of heterozygosity of FHIT genes in squamous cell carcinoma of uterine cervix Ok Jin Ko, Chel Hun Choi, Tae-Joong Kim, Woo Young Kim, Kyung-Mee Lee, Jung-Joo Choi, Jeong-Won Lee, Byoung-Gie Kim, Je-Ho Lee, Duk-Soo Bae Department of Obstetrics and Gynecology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea Objective:This study was to investigate the status of hypermethylation and loss of heterozygosity (LOH) in chromosome 3p tumor-suppressor gene for cervical carcinoma. Methods:We examined the promoter methylation status of the chromosome 3p gene, fragile histidine triad (FHIT), in 37 samples of cervical squamous cell carcinoma and corresponding noncancerous tissues using a methylation-specific polymerase chain reaction. We also analyzed the 37 paired samples for LOH at two loci on chromosome 3p. Results:Promoter hypermethylation in FHIT was detected in 24% of tumors, whereas no hypermethylation was detected in the corresponding noncancerous tissues. LOH in the regions of FHIT was observed in 10% of informative cases. There were no correlations between LOH and promoter hypermethylation for the gene. FHIT hypermethylation was associated with small tumors and, when adjusted for tumor size, correlated significantly with more frequent lymph node metastasis. Conclusion:Promoter hypermethylation and LOH of FHIT gene may play a role in cervical carcinogenesis. In addition, hypermethylation of FHIT may be associated with the status (aggressiveness) of cervical carcinoma. Key Words : Promoter hypermethylation, Loss of heterozygosity, FHIT, Cervical squamous cell carcinoma 145

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean