Microsoft Word doc
|
|
- 서천 방
- 6 years ago
- Views:
Transcription
1
2 의학박사학위논문 결장직장암에서 Bone Morphogenetic Protein 2 유전자의후향적변이에관한연구 The Study of Epigenetic Alteration of the Bone Morphogenetic Protein 2 in Human Colorectal Cancer 2007 년 2월 인하대학교대학원의학과 ( 외과학전공 ) 구지회 1
3 의학박사학위논문 결장직장암에서 Bone Morphogenetic Protein 2 유전자의후향적변이에관한연구 The Study of Epigenetic Alteration of the Bone Morphogenetic Protein 2 in Human Colorectal Cancer 2007 년 2월 지도교수김경래이논문을박사학위논문으로제출함인하대학교대학원의학과 ( 외과학전공 ) 구지회 2
4 목 차 국문요약... 4 Abstract List oft ables List of Figures 9 서론.. 11 연구대상및방법 결과 21 고찰.. 27 결론.. 31 참고문헌 Tables Figures.. 42 감사의글
5 국문요약 BMP2 ( Bone morphogenetic proteins 2) 는 TGF-β (transforming growth factor-β) 의한종류로써세포의증식에중요한역할을하는것으로알려져있다. 최근연구에서외부적인 BMP-2는위장관의정상및암세포를포함한여러종류의세포주에서항증식작용을하는것으로보고되고있다. 저자는인간의결장직장암에서의 BMP-2의변이여부를확인하기위하여인하대학교외과학교실에서결장직장암으로진단받고수술이시행된환자 40예의정상및암조직세 포와 6 예의결장직장암세포주의 RNA 를역전사중합효소연쇄반 응을이용하여분석하였다. 대상환자의평균연령은 64.7세이었으며, 남자는 25예 (62.5%) 이었고, 여자는 15예 (37.5%) 이었다. 이들중결장암환자는 18예 (45%) 이었고직장암환자는 22예 (55%) 이었다. 조직학적분화도는고분화형이 6예 (15%), 중등도분화형 31예 (77.5%), 저분화형 2예 (5%), 점액성암 1예 (2.5%) 이었다. 정상결장직장조직 40예에서는 BMP-2의감소가나타나지않았으며, 결장직장암 40예중 13예 (33%) 와결장직장암세포주 6예중 3예 (50%) 에서 BMP-2의발현이감소되었다. 남자 25예중 8예 (32.%) 에서 BMP-2발현감소를보였고, 여자 15예중 5예 (33.3%) 에서발현감소를보였다. 결장암 18예중 BMP-2의발현감소는 5예 (27.8%) 에서보였으며, 직장암 22예중 8예 (36.4%) 에서발현감소를보였다. 40예의결장직 4
6 장암세포와세포주각각 60% 와 50% 에서 BMP-2 유전자의 CpG island에서메틸화를확인하였으며, BMP-2 유전자의발현이감소된결장직장암세포 13예모두를포함하고있었다. 그러나, 임상병리학적요소들과암조직세포의 BMP-2 발현정도에는통계적인연관성없었다. 본연구에서메틸화특이적중합효소연쇄반응기법에의한 BMP-2의 CpG island 메틸화는결장직장암발생에있어서중요한역할을함을알수있었다. 그러므로, BMP-2 유전자의메틸화의이상변이에의한 BMP-2 유전자발현의소실또는감소는결장직장암발생과연관되어있다고추측된다. 5
7 Abstract Bone morphogenetic proteins (BMPs), are members of the transforming growth factor-beta family and play an important role in the cellular growth. Recently, it was reported that exogenous bone morphogenetic protein (BMP)- 2 acted as an antiproliferative agent in a variety of cell lines, including normal and cancerous gastric cell lines. To determine whether BMP-2 is altered in human colorectal cancer, we analyzed 40 colorectal cancer diagnosed and treated by Inha University Hospital and 6 colorectal cancer cell lines by reverse transcription-pcr for expression of BMP-2. Thirteen of 40 colorectal cancer (33%) and three of 6 colorectal cancer cell lines (50%) revealed the decreased expression of BMP-2. According to stage, the rate of decreased expression of BMP-2 were 0%(0/7) in stage I, 42.1%(8/19) in stage II, 28.6%(2/7) in stage IIIa, 33.3%(2/6) in stage IIIb and 100%(1/1) in stage IV. According to histologic grade, the rate of the decreased expression of BMP-2 were 33.3%(2/6) in well differentiated, 32.2%(10/21) in moderately differentiated, 50%(1/2) in poorly differentiated, and 0%(0/1) mucinous type. According to location of the cancer, the rate of decreased expression of BMP- 2 were 27.8%(5/18) in colon cancer and 36.4%(8/22) in rectal cancer. We identified the methylation in CpG island of BMP-2 gene, 60% in colorectal 6
8 cancer cell and 50% in colorectal cancer cell lines, the 13 cases depressed or lost BMP-2 gene was involved. But there was no significantly correlation between the clinicopathologic factors and the loss or decrease of BMP-2 expression. Epigenetic silencing through DNA methylation is one of the key steps during carcinogenesis. In this study, we found, through analysis by the methylation-specific polymerase chain reaction technique, CpG island methylation of the BMP-2 promoter region in colorectal cancer. Thus, aberrant BMP-2 methylation and the resultant loss of BMP-2 expression may be related to colorectal carcinogenesis. 7
9 List of Tables Table 1. Summary of bone morphogenetic protein 2 primer sequence, annealing temperatures ( ).38 Table 2. Clinicopathological characteristics of the patients (N = 40)..39 Table 3-1. The correlation between histopathologic factors and the loss of the expression of Bone morphogenetic protein 2 in colorectal cancer cell Table 3-2. The correlation between histopathologic factors and the loss of the expression of Bone morphogenetic protein 2 in colorectal cancer cell
10 List of Figures Fig. 1. The action mechanism of bone morphogenetic proteins-2 (BMP-2)...42 Fig. 2. Chemical reaction of bisulfate treatment for DNA methylation analysis Fig. 3. Bone morphogenetic protein 2 expression in colorectal Cancer.44 Fig. 4. Bone morphogenetic protein 2 expression in colorectal cancer cell lines. 45 Fig. 5. Schematic representation of the human bone morphogenetic protein Fig. 6. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell
11 Fig. 7. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell lines. 48 Fig. 8. RT PCR analysis after treatment with 5-aza-2 -. Deoxycytidine
12 서 론 Bone morphogenetic protein (BMP)-2 는 Transforming growth factor-β (TGF-β) 계통의한종류로서생체내에서정상골조직이이외의장소에서연골및골생성을하는기능을가진것으로알려져있다 (1). TGF-β와유사하게 BMPs는특이적인 type I과 type II serine-threonine kinase 수용체 (Bone morphogenetic protein receptor, BMPR) 를통하여작 용하는것으로알려져있다. II 형수용체와 BMP-2 의 결합은수용 체복합체의올리고화를유도하여 I 형수용체의인산화를일으킨후신호단백질인 Smad1, Smad5와 Smad8로신호를전달한다 (2). 여러연구에서 Smad1은 BMPR 신호의표적으로써많은연구가이루어지고있는데, BMPR에의해 Smad1이인산화가되면 Smad4 와이형중합체를형성하고핵안으로들어가서전사인자의역할을하게된다 (3)(Fig.1). BMP-2는과거에는골조직이외의장소에서골형성에관여하거나또는전립선암, 유방암등의골전이에관여하는것으로연구되어왔으나, 최근에는정상소화기관내의세포에서도 BMP-2 발현이확인되었다. 특히인체의정상대장세포내에서도높게발현되고있으며, 세포내에서앞서설명한기전을통하여세포의 apoptosis와분화를촉진하며, 세포의증식을억제하는것으로알려져있다. 또한가 11
13 족성용종증환자의선종내에서 BMP-2의소실을보이고있고이러한소실은가족성용종증에서의암발생과연관되어있는것으로알려져있다. 이러한 BMP-2 유전자의역할은결장직장암에서암억제유전자로써의가능성을제시하고있다 (4). 그러나아직까지결장직장암의발생과 BMP-2 유전자와의연관성에관한연구는미미한실정이다. 메틸화에의한 genomic DNA의후향적변이는몇몇의암억제유전자의유전자기능의소실에있어서중요한역할을하고있다. 거의모든유핵세포에서의 DNA 메틸화는정상적으로 CpG dinucleotide내의 cytosine 잔기에서발생한다 (5). 이러한형태의변이는전사요소의결합을방해하여직접적으로유전자의발현을억제하거나, methyl-cpgbinding protein(mecp2) 과 histone deacetylase로구성된복합체를유도함으로써간접적으로유전자의발현을억제한다 (6). 유전적인변이와 더불어, CpG islands 촉진구역내의 DNA 과메틸화는암억제유전자 의억제성전사를야기하기때문에암발생과정의한단계로써많 이연구되고있다. 이러한후향적변이는여러암세포에서다양한 빈도로발견되고있다. 특히결장직장암의발생기전인선종 - 암화 과정중 초기선종의단계에서메틸화가관찰되고있다 (7,8). 이러한 메틸화는여러암종류에서비특이적으로발생한다고알려져있었 으나, 최근에는암종류에따라특이적으로발생하기도한다고알려 12
14 지고있다 (9). 저자는본연구를통하여인간의결장직장암조직에서의 BMP-2 유전자의발현여부를확인하고이들과결장직장암의임상병리학적요인들과의상호연관관계에대해알아보고자하였으며, 메틸화에의한 BMP-2의발현여부에관하여연구하였다. 13
15 연구대상및방법 1. 연구대상 본연구는 2005 년 12 월부터 2006 년 7 월까지인하대병원외과학 교실에서결장직장암으로진단받고, 수술당시근치적절제술을 시행받은 40 예를대상으로하였다. 대상환자의평균연령은 64.7 세로 29 세부터 83 세까지의연령분포를보였으며남자는 25 예, 여 자 15 예이었다. 2. 실험방법 (1) 세포주와조직검출 본연구는 6 예의인간결장직장암세포주 (SW480, SW620, HCT116, LOVO, DLD-1, LS174T) 와 40 예의결장직장암환자의정상조직과 암조직을가지고이루어졌다. 모든정상및암조직은수술직후 해부병리과의도움으로 채취되었으며, 이러한조직의채취및전 연구과정은임상시험심사위원회의승인아래환자의자발적인동의 14
16 를얻어시행되었다. (2) 세포배양 인간결장직장암세포주 SW480, SW620, HCT116, LOVO, DLD-1, LS174T은 (Korean Cell Line Bank) 37 C에서 RPMI 1640 (Life Technologies, Inc.) 배양액에 10% (v/v) heat-inactivated bovine calf serum (Life Technologies, Inc.) 와 1:100 dilution of a penicillin-streptomycinfungizone solution (Life Technologies, Inc.) 을첨가한후사용하였다. (3) DNA 추출 암세포와정상세포에서 DNA 및 RNA를분리하였다. 이를위해조직을 digestion buffer (50mM Tris HCl, ph 8.5, 1mM EDTA, 0.5% Tween 20, 400μg proteinase K) 가들은 1.5ml Eppendorf tube에넣어 55 에서 24 시간부란하였다. 부란후 proteinase K의활성을억제하기위하여 97 에서 5분간처리하였고그후phenol/chloroform으로 DNA를추출하였다. 추출과정은 % sodium sarcosin의 buffer-saturated phenol 을 300μl씩시료에넣어 vortex시켜 homogenous emulsion을만든후 3500g로원심분리하였다. 그후상층액을깨끗한 Eppendorf tube에 15
17 옮긴후 300 μl의 chloroform isoamyl alcohol 을첨가하여 vortex 로잘 섞어 3500g로원심분리하였고, 이과정을 3회반복하였다. 그후상층액을새 tube에옮긴후 1/10 volume의 3M sodium acetate와 2X volume의 100% ethanol을첨가하여조심스럽게섞은후 -70 에 1시간방치하여 DNA를침전시켰다. 그후 3500g로 5분간원심분리한후상층액을버리고침전물을 70% cold ethanol로수세후재원심분리하여 DNA를침전시키고 DNA pellet을공기중에건조시킨후멸균증류수로용해시켰다. 추출한 DNA의순도는 spectrophotometer 로 260nm와 280nm의파장에서수치를읽어이수치의비 260/280가 1.8 이상인 DNA를시료로사용하였고순도가이수치이하인경우에는 phenol/chloroform 추출을다시하였다. 이렇게추출한 DNA는 1% agarose gel에전기영동하여 DNA를확인하였다. (4) RNA 추출 Total RNA 는 Acid-Guanidinium thiocyanate Chloroform (AGPC) extration 방법을응용한 TRIZOL reagent 를이용하여분리하였다. 분리된 RNA 는 Spectrophotometer 를사용하여 RNA mode (260 과 280 nm) 에서 정량하였다. 16
18 (5) 역전사중합효소반응 ( Reverse Transcriptase - Polymerase Chain Reaction, RT-PCR ) 합성된 cdna 로부터 RT-PCR 를이용한분석 : 역전사반응후 1st strand cdna 를각 1µl 씩취하여 1 x Tag Buffer, dntp(10mm) 와 각각 의 primer 쌍과 1.25 unit Taq DNA polymerase를섞어 PCR을수행하였다. PCR 은 Perkin-Elmer thermal Cycler (GeneAmp PCR system, PerkinElmer Life Science) 을사용하였고온도조건은 94 C 에서 30초, 56 C 에서 30초 70 C 에서 1분의조건으로 30회반복하였다. (6) BMP-2 유전자의메틸화분석 ( Methylation Analysis of BMP-2 gene ) 50μl용액중 1μg의 DNA를최종농도 0.2M의 NaOH용액으로 37 에서 10분간처리하여 DNA를변성시겼다. 그후 urea/sodium bisulfite로 DNA를변환시키기위하여 50ml의 Falcon tube에 7.5g의 urea(analytical grade, BDH) 를넣고여기에 10ml의증류수를첨가하여 vortex하면서녹였다. 여기에실온에서 7.6g의 sodium metabisulfite(sigma) 를넣고증류수 20ml로용해시키면서 vortex하여 17
19 녹이면서용액의 ph를 10M NaOH로 5.0으로조절하였다. 이렇게만든 urea/sodium bisulfite용액과hydroquinone을변성시킨 DNA에최종농도가각각 5.36M, 3.44M 및 0.5mM되도록 DNA 용액 22.2μl, urea/sodium bisulfite 208μl및 10mM의신선한 hydroquinone용액 12 μl씩혼합하였다. 그후혼합용액을 0.5ml의 Polymerase Chain Reaction(PCR) tube 에넣고 55 에서 15 분, 이어서 95 에서 30 초반 응시키는과정을 20회반복하였다. 이러한과정이끝난 modified DNA는 WizardDNA purification resin(promega, Madison, WI, USA) 으로정제후다시 NaOH(final concentration 0.3M) 로실온에서 5분간처리후 ethanol로침전시켜멸균증류수로녹였다. (7) 메틸화특이적중합효소연쇄반응 (Methylation-Specific Polymerase Chain Reaction, MSP) PCR 반응을위한 primer는인간의 BMP-2 유전자의 promoter/exon 1 부위중일부를증폭하도록설계하여사용하였다. DNA의 nucleotide 중메틸화된 cytosine을관찰하기위하여 DNA를 urea/sodium bisulfite 로화학반응시켜메틸화된 cytosine과메틸화가되지않은 cytosine 이 uracil로변환되는것으로메틸화의여부를알수있으며이렇게처리된 DNA를 PCR로증폭함으로 uracil로변환된 cytosine은 PCR산 18
20 물에서 thymidine으로치환된것을알수있다 (Fig2). PCR증폭에쓰이는 primer set는 BMP-2U (Bone morphogenetic protein unmethylated), CpG island의 cytosine에메틸화된 DNA를특이적으로증폭할수있도록제작된 primer BMP-2M (Bone morphogenetic protein methylated), CpG island에메틸화가안된 DNA를증폭할수있도록제작된 BMP-2U primer등을각각사용하였다 (Table 1.). 반응은 20μl의반응으로 1x PCR buffer에 dntp 각각 250mM, 각각의 primer 10pM, DNA/modified DNA 50ng, 1.25mM MgCl2, Taq polymerase 0.5U들을넣어반응시켰고반응조건은 95 에서 5분반응후 95 에서 30초, 65 에서 30초, 72 에서 30초반응시키고이과정을 35회반복하였다. 그후 72 에서 5분연장한후반응을종결하였다. 이렇게반응시켜얻은 PCR 산물은 1% agarose gel에전기영동하여확인하였다. 19
21 3. 통계처리 BMP-2 발현의감소에따른다른임상병리학적인자와의연관성 비교는 chi-square test 를통해검증하였고 p 값이 0.05 미만인경우 통계적으로유의한관련성이있는것으로판정하였다. 20
22 결 과 환자의임상병리학적특성 대상환자의평균나이는 64.7±11.4세이었으며최저 29세최고 83 세이었다. 남자는 25예 (62.5%) 여자 15예 (37.5%) 로남녀비는 1.67:1 이었고, 결장암이 18예 (45%) 이었으며, 직장암은 22예 (55%) 이었다. 이들의수술전암태아성항원 (carcinoembryonic antigen, CEA) 농도는 21.4ng/ml 이었고, 수술후 CEA 는 6.7ng/ml 이었다. 종양의분화도 에따라구분한결과고분화형이 6예 (15%), 중등도분화형 31예 (77.5%), 저분화형 2예 (5%), 점액성암 1예 (2.5%) 이었다. 27예 (67.5%) 에 서는대장직장주위림프절전이가없었으나 13예 (32.5%) 에서주위 림프절전이가있었으며이들의평균림프절수는 4.8개 (1개-18개) 이 었다. TNM 병기로는 Stage I 7예 (17.5%), Stage II 19예 (47.5%), Stage IIIa 7예 (17.5%), Stage IIIb 6예 (15%) 그리고 Stage IV 1예 (2.5%) 이었 다 (Table 2). 21
23 결장직장암에서의 BMP-2의발현 40예의결장직장암환자에서 BMP-2 mrna 발현을 RT-PCR을통해분석하였다. 40예의정상조직모두에서 BMP-2 mrna가발현되었으나, 결장직장암조직 40예중 13예 (32.5%) 에서 BMP-2 mrna 발현이감소되거나소실됨을보였다 (Fig. 3). 결장직장암세포주에서의 BMP-2의발현 결장직장암세포주 6예중 3예 (50%) 에서 BMP-2 mrna 발현의감소를보였다. SW480, LOVO, 와 DLD-1에서 BMP-2 mrna의양성발현을보였으나, SW620, HCT116, LS174T에서는 BMP-2 mrna가발현되지않거나아주약한발현을보였다 (Fig. 4). 22
24 결장직장암세포와세포주에서의 BMP-2의메틸화분석 메틸화특이적중합효소연쇄반응 (Methylation specific polymerase chain reaction, MSP) 를시행하기앞서 BMP-2 유전자의 CpG islands를분석하였다. 분석결과 4개의 CpG islands를발견하였으며, 3번째 CpG islands를중심으로탈메틸화를확인하기위한 MSP를시행하였다 (Fig. 5). urea/sodium bisulfite로처리시킨정상조직은모두 BMP-2U primer로증폭되었으며종양조직의 DNA는 BMP-2M primer로는 40예중 24예 (60%) 에서증폭이확인되었다 (Fig.6). 증폭된 24예는 RT-PCR에서 BMP-2의발현이저하된 13예모두를포함하였다 (No. 4, 8, 9, 16, 24, 27, 29, 30, 32, 34, 38, 52, 62). 또한결장직장암세포주의경우총 6예중 3예인 SW480, SW620, HCT116에서메틸화가확인되었으며이중 SW620과 HCT116에서는 BMP-2의발현이소실된세포주였다 (Fig. 7).. 23
25 탈메틸화에의한 BMP-2 유전자발현의효과 메틸화에의한 BMP-2 발현조절을확인하기위해본연구진은 BMP-2의 mrna의발현이억제되어있는결장직장암세포주인 HCT-116 세포주에 BMP-2 유전자발현을탈메틸화시약인 5-aza-2 - deoxycytidine (1µM) 처리후역전사중합효소반응으로분석한결과 BMP-2의발현이유도됨을관찰하였다 (Fig. 8). 따라서 CpG 메틸화에의한 BMP-2 유전자발현이조절됨을시사해준다. 24
26 BMP-2 발현감소에따른임상병리학적인자와의연관성 남자의경우 25 예중 8 예에서 (32.0%) 에서 BMP-2 발현이감소되었 고, 여자에서는 15 예중 5 예 (33.3%) 에서감소하였다. 상행, 횡행, 하행및구불결장을포함한결장암 조직 18 예중 5 예 (27.8%) 에서 BMP-2의발현이감소되었고직장암조직에서는 22예중 8예 (36.4%) 에서감소되었다. 술전 CEA 수치에따른 BMP-2 발현감소는 CEA의수치가정상범위내에있었던 30예중 9예 (30.0%) 에서나타났고, 정상범위보다높았던 10예중 4예 (40%) 에서감소를나타내었다조직학적분화도에따른 BMP-2 발현감소는고분화분화암에서 6 예중 2예 (33.3%), 중등도분화암에서 31예중 10예 (32.2%), 저분화암에서 2예중 1예 (50%) 에서나타났으며, 점액성암에 1예에서는 BMP-2의감소가나타나지않았다. 종양이점막하층에국한된 T1 병변 2 예와 고유근층에국한된 T2 병변 5예에서는 BMP-2 발현의감소가나타나지않았으나, 고유근층을넘어서점막하까지침윤된 T3 에서는 31예중 11예 (35.3%) 에서, 장막을투과하거나타장기혹은조직에직접적으로침윤된 T4 에서는 2예모두에서 BMP-2 발현의감소가나타났다. 주위림프절전이유무에따른 BMP-2 발현의감소는 림프절전이 25
27 가없는경우 27예중 9예 (33.3%) 에서, 림프절전이가있는경우 13 예중 4예 (30.8%) 에서나타났다.. 병기에따른 BMP-2 발현의감소는 I기 7예에서는보이지않았으나, II기 19예중 8예 (42.1%), IIIa기 7예중 2예 (28.6%), IIIb기 6예중 2예 (33.3%) 그리고 IV기 1예중 1예 (100%) 에서발현의감소를보였다. BMP-2 발현의소실과결장직장암의임상병리학적요인들과의연관성에관하여알아보았으나각요인들과 BMP-2 발현정도와는통계적으로상호연관성을보이지는않았다 (Table 3). 26
28 고 찰 암의발생은암관련유전자의기능적인변이를포함한여러단계를거쳐서발생한다고알려져있다. 이러한과정들에는촉진자의메틸화나유전자전반에걸친저메틸화와같은후향적인변이뿐만아니라돌연변이이형성의소실을포함하는유전적현상들이있다 (7,8). 과거많은연구들의결과로결장직장암발생과정에대한기전이제시되고있는데, 먼저약 70 80% 정도의결장직장암에서 5번장완염색체내의 APC (adenomatous polyposis coli) 유전자의소실이나돌연변이로설명되며, 이러한예로 K-ras 암유전자의점돌연변이, 암억제유전자로알려진 18번장완염색체내의 DCC 와 SMAD4 유전자의소실또는 17번단완염색체의 p53 유전자의소실등이있다 (10-12). 다른기전으로는전체결장직장암의약 10 15% 를차지하고있는유전성비용종증결장직장암 (Hereditary nonpolyposis colorectal cancer) 증후군에서나타나는 DNA 복제실수 교정유전자인 hmsh2, hmlh1, hpms1 의돌연변이에의해결장직장 암의발생한다고제시되고있다 (13). 본연구는지금껏결장직장암 의암유전자로알려진앞서설명한유전자들이외에 BMP-2 유전 자와결장직장암과의연관성을알아보고자하였다. 최근연구들은 위장관을포함한여러장기의암발생에있어서 BMP signaling 과의 27
29 연관성을제시하였다. 먼저시험관내에서의 rhbmp-2 는전립선암, 위암, 결장암세포에서항증식작용을하는것으로알려졌으며, 두 번째로는전립선암과결장암등에서 BMP-2 발현이감소되나정상 결장직장세포에서는 BMP-2 의발현이높다고보고하고있고 (4), 세 번째로는 BMPRI 와 Smad4 에서의돌연변이는소아성용종증 (Juvenile Polyposis) 과연관되어있음을 보고하고있으며, 이러한환자 들은위장관암의발생위험성이있다 (21). 본연구에서도총 40예의정상결장직장세포전체에서는 BMP-2 유전자가발현되었으나, 결장직장암세포와 6예의결장직장암세포주에서는각각 32.5% 와 50% 의낮지않은비율로 BMP-2 유전자의감소또는소실을나타내었다. 이러한결과로볼때향후에도많은연구가필요하겠지만 BMP-2 유전자도암억제유전자로알려진 p53, DCC, APC 유전자와같이결장직장암발생에있어서억제유전자로써의가능성이있다. 암억제유전자의 CpG island내에서이상적인메틸화는억제유전자의기능의소실을야기하며, 이는암발생기전을설명하는중요한기전중의하나로연구되고있다 (14-20). 결장직장암발생의유전자모델로알려진선종 - 암화과정 단계에서 의메틸화의변화는암유전자나암억제유전자의변이를가져오 고특히촉진구역내의 CpG island 의과메틸화는교정유전자뿐만아 니라억제유전자의소실을초래한다 (22-24). 본연구에서는결장직 28
30 장암세포 60% 에서메틸화를확인하였으며, 이는결장직장암에서의메틸화를연구한다른연구의결과들과유사하였으며 (25-27), 특히 BMP-2 유전자의발현이감소되거나소실된 13예모두에서메틸화가발생하였다. 또한메틸화에의해 BMP-2 유전자발현이소실된세포주 HCT116에탈메틸화시약인 5 -aza-2 -deoxycytidine 으로처리하였을때메틸화가발생하지않고 BMP-2 유전자의발현이나타났으며이러한결과는다른연구에서도확인할수있었다 (28,29). 이는 CpG 메틸화에의한 BMP-2 유전자발현이조절됨을시사해준다. 이러한결과로볼때 BMP-2 유전자의발현이소실되거나감소된 결장직장암에서는 BMP-2 CpG islands 의메틸화가나타나며, BMP-2 유전자가높게발현되는세포에서는 CpG islands 메틸화가나타나지않음을알수있었다. 그러므로, 결장직장암세포에서의 BMP-2 유전자발현의소실은 BMP-2 유전자촉진자의메틸화와강한연관이있으며, 즉 BMP-2 유전자는다른결장직장암억제유전자들과유사하게결장직장암세포와배양된결장직장암세포주에서메틸화를통하여억제되어지는것으로생각된다. 본연구에서 BMP-2 유전자발현감소여부와임상병리학적인자들간의상호연관관계를알아보았으나통계학적으로의의는없었다. 이는본연구가적은수를대상으로시행되었고단기간에이루어진통계학적인오류를포함시켜야하겠지만, 결장직장암의발생에 29
31 있어서메틸화에의한유전자의변이는선종-암화과정의여러단계에서산발적으로발생하는것으로알려져있고 (30), 또한다른암유전자와예후와연관된임상병리학적인자들간의관계에대해서는명확히밝혀진바가없다 (31,32). 그러므로, BMP-2 유전자발현의소실여부와결장직장암의예후와연관된여러임상병리학적인자들간의상호관계를확인하기위해서는향후많은대상을통한연 구와함께 결장직장암세포내에서의작용기전에대한연구가필 요할것으로여겨진다. 30
32 결 론 저자는본연구에서결장직장암환자의정상결장직장조직과암 조직에서 BMP-2 유전자발현정도를비교하였을때 정상조직에서 BMP-2 유전자가 40예모두에서발현이되었고암조직 40예중 13 예에서발현감소가있었음을확인할수있었고, 이러한유전자발현감소에 CpG island의메틸화가관여함을확인할수있었다. 그러므로 BMP-2 유전자도다른암억제유전자들과유사하게결장직장암발생과정에있어서하나의억제유전자로써기능을가지고있으리라추측되나, 향후 BMP-2 유전자발현의억제를가져오는 CpG island 메틸화의발생원인과결장직장암의선종암화과정중어느단계에서메틸화가발생하는가에대한연구는지속되어야하겠다. 31
33 참고문헌 1. von Bubnoff, A. and Cho, K. W. Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev Biol, 239: 1-14, Heldin, C. H., Miyazono, K., and ten Dijke, P. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature, 390: , Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and Massague, J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature, 381: , Hardwick, J. C. H., Van Den Brink, G. R., Bleuming, S. A., Ballester, I., Van Den Brande, J. M. H., Keller, J. J., Offerhaus, G. J. A., Van Deventer, S. J. H., and Peppelenbosch, M. P. Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. Gastroenterology, 126: , Jones, P. A. and Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet, 3: ,
34 6. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J., and Wolffe, A. P. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet, 19: , Farber E. Cancer development and its natural history. A cancer prevention perspective. Cancer, 62(Supple.8): , Cairns J. Mutation selection and the natural history of cancer. Nature, 255: , Costello, J. F., Fruhwald, M. C., Smiraglia, D. J., Rush, L. J., Robertson, G. P., Gao, X., Wright, F. A., Feramisco, J. D., Peltomaki, P., Lang, J. C., Schuller, D. E., Yu, L., Bloomfield, C. D., Caligiuri, M. A., Yates, A., Nishikawa, R., Su Huang, H., Petrelli, N. J., Zhang, X., O'Dorisio, M. S., Held, W. A., Cavenee, W. K., and Plass, C. Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat Genet, 24: , Lengauer C, Kinzler KW, Vogelstein B, Genetic instability in colorectal cancer. Nature, 386: , Thiagalingam S, Lengauer C, Leach FS Evaluation of candidate tumor suppressor gene on chromosome 18 in colorectal cancer. Nat. Genet, 13: ,
35 12. Nigro JM, Baker SJ, Preisinger AC.,Mutations in the p53 gene occur in divers human tumor types. Nature, 342: , Lothe RA, Peltomaki P, Meling GI, Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history. Cancer Res, 53: , Issa, J. P., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., Hamilton, S. R., and Baylin, S. B. Increased cytosine DNAmethyltransferase activity during colon cancer progression. J Natl Cancer Inst, 85: , Wu, J., Issa, J. P., Herman, J., Bassett, D. E., Jr., Nelkin, B. D., and Baylin, S. B. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells. Proc Natl Acad Sci U S A, 90: , Issa, J. P., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., and Baylin, S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat Genet, 7: , Issa, J. P. and Baylin, S. B. Epigenetics and human disease. Nat Med, 2: ,
36 18. Herman, J. G., Merlo, A., Mao, L., Lapidus, R. G., Issa, J. P., Davidson, N. E., Sidransky, D., and Baylin, S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res, 55: , Issa, J. P., Baylin, S. B., and Herman, J. G. DNA methylation changes in hematologic malignancies: biologic and clinical implications. Leukemia, 11 Suppl 1: S7-11, Toyota, M., Ho, C., Ahuja, N., Jair, K. W., Li, Q., Ohe-Toyota, M., Baylin, S. B., and Issa, J. P. Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification. Cancer Res, 59: , Howe, J. R., Bair, J. L., Sayed, M. G., Anderson, M. E., Mitros, F. A., Petersen, G. M., Velculescu, V. E., Traverso, G., and Vogelstein, B. Germline mutations of the gene encoding bone morphogenetic protein receptor 1A in juvenile polyposis. Nat Genet, 28: , Esteller M, Spark A, Toyota M. Analysis of adenomatous polyposis coli promoter hypermethylation in humna cancer. Res, 60: , Toyota M, Ohe-Toyota M, Ahuja N, Issa JP. Distinct genetic profiles in colorectal tumor with ir without the CpG island methylation phenotype. 35
37 Proc. Natl. Acad. Sci. USA, 97: , Paz MF, Fraga MF, Avila S. A systematic profiles of DNA methylation in human cancer cell lines. Cancer Res, 63: , Toyota, M., Ahuja, N., Ohe-Toyota, M., Herman, J. G., Baylin, S. B., and Issa, J. P. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A, 96: , Park SJ, Rashid A, Lee JH, Kim SG, Hamilton SR, Wu TT. Frequent CpG island methylation in serrated adenomas of the colorectum. Am J Pathol, 162: , Bariol C, Suter C, Cheong K. The relationship between hypomethylation and CpG island methylation in colorectal neoplasia. Am J Pathol, 162: , Li H, Myeroff L, Kasturi L Krumroy L, Schwarts S, Willson JK, Stanbridge E, Casey G, Markowitz S. Chromosomal autonomy of hmlh1 methylation in colon cancer. Oncogene, 21: , Suter CM, Norris N, Ku SL, Cheong KF, Tomlinson I, Ward RL. CpG island methylation is a common finding in colorectal cancer. Br J Cancer, 88: , Kim HC, Rho SA, Ga IH, Kim JS, Chang SY, Kim JC. CpG island methylation as an early event during adenoma progression in carcinogenesis of sporadic colorectal cancer. Gastroenterol, 20: ,
38 31. Ogunbiyi OA, Goodfellow PJ, Herfarth K. Conformation that chromosome 18q allelic loss in colon cancer is a prognostic indicator. J Clin Oncol, 16: , Martinez-Lopez E, Abad A, Font A. Allelic loss on chromosome 18q as a prognostic marker in stage II colorectal cancer. Gastroenterol, 114: ,
39 Table 1. Summary of BMP-2 primer sequence, annealing temperatures ( ). Forward primer (5-3 ) Reverse primer (5-3 ) BMP-2U ATGGTTGTTTTGAGTTATGGGTTGT CTTAAAAACCAACACCCAAAAAACACA 58 BMP2M GGTTGTTTCGAGTTATGGGTAGC ACCAACGCCCGAAAAAACGCG 58 RT-PCR CCTAAGGAGGACGACAGCAC GAGACCGCAAGTCCGTCTAAG 52 BMP-2U; Bone morphogenetic protein-2 unmethylated BMP-2M; Bone morphogenetic protein-2 methylated 38
40 Table 2. Clinicopathological characteristics of the patients (N=40) Age 64.7 ± 11.4 Sex Male 25 (62.5%) Female 15 (37.5%) Location Colon 18 (45%) Rectum 22 (55%) CEA Level (ng/ml) Pre-Op 21.4 Post-Op 6.7 Histologic Grade Well Differentiated 6 (15%) Moderately 31 (77.5%) Poorly 2 (5%) Mucinous 1 (2.5%) AJCC Stage I 7 (17.5%) II 19 (47.5%) IIIa 7 (17.5%) IIIb 6 (15%) IV 1 (2.5%) CEA, carcinoembryonic antigen, Pre-op; pre-operation, Post-op; post operation, AJCC; American Joint Committee on Cancer 39
41 Table The correlation between histopathologic factors f and the loss of the expression of BMP-2 in colorectal cancer cell BMP-2 Variable Expression Loss p-value No. of Patients 27 (67.5%) 13 (32.5%) Sex Male 17 (68.0%) 8 (32.0%) Female 10 (66.7%) 5 (33.3%) Location Colon 13 (72.2%) 5 (27.8%) Rectum 14 (63.6%) 8 (36.4%) Pre-op CEA (ng/nl) Normal 21 (70.0%) 9 (30.0%) Abnormal 6 (60.0%) 4 (40.0%) Histologic grade Well 4 (66.7%) 2 (33.3%) Moderated 21 (67.8%) 10 (32.2%) Poorly 1 (50.0%) 1 (50.0%) Mucinous 1 (100%) 0 (0%) BMP-2: Bone morphogenetic protein-2, Pre-op: pre operation, CEA: Carcinoembryonic antigen, 40
42 Table 3-2. The correlation between clinicopathologic factors and the loss of the expression of BMP-2 in colorectal cancer cell BMP-2 Variable Expression Loss p-value Tumor Depth T1 2 (100%) 0 T2 5 (100%) 0 T3 20 (64.7%) 11 (35.3%) T4 0 (0%) 2 (100%) Lymph Node Negative 21 (70.0%) 9 (30.0%) Positive 6 (60.0%) 4 (40.0%) Stage I 7 (100%) 0 (0%) II 11 (57.9%) 8 (42.1%) IIIa 5 (71.4%) 2 (28.6%) IIIb 4 (66.7%) 2 (33.3%) IV 0 (0%) 1 (100%) BMP-2; Bone morphogenetic protein 2 41
43 Figure 1. The action mechanism of bone morphogenetic proteins-2 (BMP-2). BMPR; Bone morphogenetic protein receptor 42
44 1) Unmethylated DNA 2) Methylated DNA Figure 2. Chemical reaction of bisulfate treatment for DNA methylation analysis. 43
45 Figure 3. BMP-2 expression in colorectal cancer. The BMP-2 mrna expression level was examined by RT PCR in 40 colorectal cancer cell lines. β-actin expression was used as an internal loading control for RT PCR. The cycle numbers for BMP-2 and β-actin were 30 and 25, respectively. BMP-2: Bone Morphogenetic Prptein -2 N: normal, C: cancer 44
46 SW480 SW620 HCT116 LOVO DLD-1 LS174T BMP-2 β-actin Figure 4. BMP-2 expression in colorectal cancer cell lines. The BMP-2 mrna expression level was examined by RT PCR in six colorectal cancer cell lines. β-actin expression was used as an internal loading control for RT PCR. The cycle numbers for BMP-2 and β-actin were 30 and 25, respectively. BMP-2; Bone Morphogenetic Prptein-2 45
47 Figure 5. Schematic representation of the human BMP-2 genes. Arrows denote the locations of the distal (at 1) and proximal (at 735) transcription start sites; the lower panel shows a schematic representation of the human BMP-2 gene (GenBank Accession No. AL035668). An arrow indicates the transcription start site. Boxes indicate exons, including coding (black) and non-coding (white) regions. Vertical bars show CpG sites. Black arrows below the CpG sites indicate the regions subjected to MSP and bisulfite sequencing (BS). 46
48 Figure 6. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell. Lanes; U, unmethylated alleles; M, methylated alleles. 47
49 Figure 7. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell lines samples. Lanes; U, unmethylated alleles, M; methylated alleles. 48
50 Figure 8. RT PCR analysis after treatment with 5-aza-2 - Deoxycytidine (5-aza). Bone morphogenetic protein-2 (BMP-2) gene expression was reactivated after treatment with 5-aza-20-deoxycytidine in HCT-116 cell lines. b-actin was amplified as in internal control (30 cycles of PCR). - and + denote with and without 5-aza-20-deoxycytidine treatment, respectively. U; Unmethylated alleles, M; Methylated alleles. 49
51 감사의글 부족한점이많은논문을완성하도록지도편달을아끼지않으신김경래지도교수님께진심으로감사드리며, 심사과정에서많은조언을해주셨던신용운교수님, 오승택교수님, 오재환교수님, 장준혁교수님께도진심으로감사드립니다. 실험을시작할수있도록도와주신최인호교수님과선배로서옆에서힘이되주신최선근교수님께도감사드립니다. 오늘의제가있기까지항상격려와사랑을베풀어주신부모님과사랑하는나의아내와아들에게감사의말을전합니다. 끝으로무사히논문을마칠수있도록도와주시고관심을보여주신모든분들게감사드립니다. 저자씀 50
Jkbcs016(92-97).hwp
Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean
Jkbcs032.hwp
Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments
l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II)
전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) 전립선암발생률추정과관련요인분석 : The Korean Cancer Prevention Study-II (KCPS-II) - i - - ii - - iii - - iv - - v - - vi - - vii - - viii - - ix - -
김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
Chapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세
본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
석사논문.PDF
ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh
7.ƯÁýb71ÎÀ¯È« š
J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr
IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) IL-1β, IL-1RN, IL-8, MUC, NAT, GST 등 ) l l l α β α β β α β β α β 목적 (Background/Aims): 위암의가족력과 Helicobacter pylori 감염은각각위암발생의위험인자로알려져있으나,
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
( )Jkstro011.hwp
비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy
연하곤란
2015.03.04 부울경소화기내시경지회 Intramucosal gastric cancer: The rate of lymph node metastasis in signet ring cell carcinoma was as low as that in welldifferentiated adenocarcinoma 인제대부산백병원 소화기내과 지삼룡 Signet ring
mau A B C Qsepharose051229manual001:1_UV@01,SHFT Qsepharose051229manual001:1_Conc Qsepharose051229manual001:1_Fractions Qsepharose051229manual001:1_Inject Manual run 3:1_UV@01,SHFT Manual run 3:1_Fractions
한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
cdna의신장반응이저해된다. 이와같이 AMV 유래 RTase 와 MoMLV 유래 RTase 는모두일장일단을가지나필자는 MoMLV 유래 RTase 를선호한다. 또두효소는최적 ph, 최적염농도등에서도차이가있으므로주의해야한다. 최근 Myers 등은 RTase 활성과 PCR
RT-PCR 법 II. 역전사효소반응 ( 주 ) 다인바이오연구소 현재분자생물학분야에서 RNA 수준의 gene expression ( 유전자발현 ) 과 cdna (complementary DNA) cloning에널리이용되고있는 RT-PCR (Reverse transcription ploymerase chain reaction) 은생명정보가 DNA에서 RNA로전달된다는분자생물학분야의
Kaes017.hwp
갑상선의 Poorly Differentiated (Insular) Carcinoma Insular Carcinoma: An Aggressive Subtype of Differentiated Thyroid Neoplasms Seok-Jin Nam, M.D., Sang-Dal Lee, M.D., Hal-lin Park, M.D., Young-Ryun Oh, M.D.
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
Endofest-Korea(초록집-8월).hwp
The Korean Journal of Gastrointestinal Endoscopy Room A 신생폴립을설명하는암화경로와대책 박동일 성균관대학교의과대학강북삼성병원소화기내과 Carcinogenesis Pathway for the Newly Developed Polyp and Coutermeasures Dong Il Park, M.D., Ph.D. Department
내시경 conference
부울경소화기내시경학회 6월집담회 고신대학교복음병원소화기내과전임의서광일 F/63 CASE C.C) epigastric pain for 2 wks P. I) 2014.04.16 EGD at LMC adm via OPD for further evaluation. P. Hx) CASE HTN/DM/Hepatitis/Tbc (+/+/-/-) S. Hx) N-S ROS)
388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR
6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7
- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
( )Jksc057.hwp
직장암환자의전직장간막절제술의 예측인자분석 : 불완전절제와절제시간에영향을미치는인자에관한연구 Analysis of Factors Affecting the Degree of Difficulty in Total Mesorectal Excision for Rectal Cancer: Investigation of the Factors Affecting Incomplete
120304강신용
Clinical Features and Prognostic Factors Influencing Long-term Survival in pt2 Gallbladder Carcinoma Patients Purpose: The prognosis of gallbladder carcinoma is unfavorable, and the depth of invasion,
Y 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는 DNA를
Code RR180A - 연구용 - Bacterial 16S rdna PCR Kit 사용설명서 v201011da 미생물분류는형태적특징, 생리 생화학적성질과상태, 화학분류학적성질과상태등을이용하여구분하는것이일반적이지만, 이와같은방법을이용하면많은시간을필요로한다. 또한분류가힘든경우나, 정확하지못한결과를얻는경우도있다. 최근미생물분류에도분자생물학적인방법을이용하여, 미생물이가지고있는
Jksvs019(8-15).hwp
Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The
1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
Cloning
Takara 와함께하는 Cloning 2014-11-13 다카라코리아바이오메디칼 목차 Cloning 이란? Cloning Flow Chart Cloning DNA / RNA 추출 High Fidelity PCR 제한효소 /ligation/e.coli 형질전환 Clone 확인 이것만은꼭!!! 2 Cloning 이란? Clone 세포나개체의증식에의해서생긴유전적으로동일한세포군
서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정
Chapter 14 유전정보 (Genetic Information) A + G = C + T 일정 ( 샤가프룰 ] - Watson & Crick(1953년 ) : double helix model of DNA( 이중나선구조 ) 제시 1. 유전정보의전달경로 DNA 상의정보를 RNA로옮겨주는과정 ex) retrovirus 2. DNA Replication ( 유전자복제
노영남
Purpose: Delayed massive hemorrhages from pseudoaneurysm rupture of the peripancreatic large arteries, after pancreaticoduodenectomy, are fatal. We reviewed the clinical course and outcome of bleeding
한국 출산력의 저하 요인에 관한 연구
가족계획실천율 가족계획실천자 세 유배우부인 조출생률 년간 총출생아수 연앙인구수 일반출산율 년간 총출생아수 가임연령 여자연앙인구수 합계출산율 세 연령층 여성이 출산한 출생아수 세 연령층 여성의 연앙인구수 즉 합계출산율 합 6 계 출 산 율 5 4 3 2 1 1960 1973 1977 1981 1985 1989 1993 1997 2001
황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>
Outline 2012. 1. 30 CS4HS 생물정보학 생물정보학및암정보의학 맟춤의학과생물정보학 김선 서울대학교컴퓨터공학부생물정보연구소생물정보학협동과정 유전체학, 후생유전체학을이용한암연구와맟춤의학 1 2 Central Dogma in Biology PART1. 생물정보학 http://en.wikipedia.org/wiki/central_dogma_of_molecular_biology
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
Abstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
지원연구분야 ( 코드 ) LC0202 과제번호 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 소속위암연구과직위책임연구원
지원연구분야 ( 코드 ) LC0202 과제번호 1110550 창의과제프로그램공개가능여부과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부실용화공개 ( 공개, 비공개 ) ( 국문 ) 연구과제명 과제책임자 세부과제 ( 영문 ) 구분 1 2 3 소속위암연구과직위책임연구원 성명류근원전공외과 세부과제명 세부과제책임자 성명 소속 ( 직위 ) 전공 총연구기간 2011
untitled
대한내과학회지 : 제 71 권부록 3 호 2006 거치상선종에서발생한대장의점액성선암 2 예 부산대학교의과대학내과학교실 정효진 김태오 김광하 허정 강대환 송근암 조몽 =Abstract= Two cases of colonic mucinous adenocarcinoma originating from serrated adenomas Hyo Jin Jung, M.D.,
Minimally invasive parathyroidectomy
2013. 2. 2 대한간암연구학회 7차 심포지움 및 학술대회 Indication and Clinical Outcomes of Metachronous HCC Metastasectomy Shin Hwang Division of Liver Transplantation and Hepatobiliary Surgery, Department of Surgery, Asan
<30322EBABBB9AE2E687770>
대한내과학회지 : 제 79 권부록 2 호 2010 청람연구비결과보고 대장암발생과정에서 Prostaglandin 의조절기전규명및암예방약제의반응성표지자로 15-hydroxyprostaglandin dehydrogenase의역할 울산대학교의과대학내과학교실 명승재 서 론 2. 병리조직학적분석 (Histopathologic analysis) 과제는인체에서대장암병기의각단계에서
- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
- 혈액내대장종양표지자확립제 3 세부과제 : 저질량대사체의분석용기기로 MALDI-TOF/TOF를이용하여대장암을진단할수있는방법을연구하였음. Training set으로정상 203명, 대장암 277명, 유방암 136명, 림프종 51명, 위암 86명의 serum을이용하여대장암을진단할수있는식을생성함. Validation set으로정상, 대장암, 유방암, 림프종, 위암,
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
MHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
Jkbcs042.hwp
Invasive Ductal Carcinoma Arising from Axillary Accessory Breast Tae Wan Kim, Sang Wook Kang, Ji Young Park 2, Seung Sang Ko 1, Min Hee Hur 1, Hae Kyung Lee 1, Sung Soo Kang 1, and Jee Hyun Lee 1 Department
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현
원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함
(49-54)Kjhps004.hwp
Biliary Cystadenoma and Cystadenocarcinoma of the Liver Jae Hoon Lee, M.D., Dong Ho Choi, M.D. 1, Kyeong Geun Lee, M.D., Hwon Kyum Park M.D. and Kwang Soo Lee, M.D. Department of Surgery, College of Medicine,
기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
<30352EB0A3BAB4B8AE2E687770>
The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and
Kbcs002.hwp
Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,
최근연구소식 Molecular and Cellular Biology News 최근의연구동향을이해할수있도록몇편의논문을요약하여하나의주제로소개합니다. TGF-β 신호전달경로의새로운조절기전 Watanabe Y, Itoh S, Goto T, Ohnishi E, Inamitsu
최근연구동향을이해할수있도록몇편논문을요약하여하나주제로소개합니다 GF- 신호전달경로새로운조절기전 Watanabe Y Itoh S Goto Ohnishi E Inamitsu M Itoh F Satoh K Wiercinska E Yang W Shi L anaka A Nakano N Mommaas AM Shibuya H en Dijke P Kato M 2010) MEPAI
ºÎÁ¤¸ÆV10N³»Áö
case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads
조기 위암 집담회 부산대학교 병원 CASE
부산대학교병원 CASE PRESENTATION 전임의이현정 2013.10.02 CASE PRESENTATION F/79 C.C) Epigastric soreness P.I) 2011년 4월외부병원시행한 EGD 상병변보여본원의뢰됨 P.Hx) HT / DM / Hepa / Tbc - / - / - / - S.Hx) smoking (-), alcohol (-) F.Hx)
review
J Korean Soc Coloproctol: Vol. 25, No. 2, 129-38, 2009 DOI: 10.3393/jksc.2009.25.2.129 REVIEW 대장암에서유전자불안정성의임상적의의 이강영 연세대학교의과대학외과학교실 Genomic Instability in Colorectal Cancer; from Bench to Bed Kang Young
Crt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
슬라이드 1
EVENT 퀴아젠인기상품연말특별가전 200203 Top Taq DNA Polymerase (250U) 90,000 72,000 200205 Top Taq DNA Polymerase (1000U) 331,000 281,350 200403 Top Taq Master Mix Kit(250U) 104,000 83,200 201203 Taq DNA Polymerase
27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability
27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제
untitled
측방발육형종양의병리학적및분자생물학적특성 국립암센터병리과 장희진 서 론 소화기계의표재성종양은발육형태상크게용종형과비용종형으로나누고있으나, 내시경학적으로비용종형은다시편평형과궤양형으로나누며, 편평형은다시표면융기형, 표면편평형, 표면함몰형으로세분하고있다. 1 대장점막의표재성병변중 94% 가용종형또는표면융기형으로, 나머지유형은 6% 미만으로보고되고있다. 2 Kudo는편평형의종양중장벽을기준으로수직방향이아닌수평방향,
Very low-risk Low-risk Intermediate-risk High-risk Appendiceal mucinous tumours Mucinous adenoma Mucinou
I. Workshop 결과에대한설문조사결과 A. 종양의행태 (behavior) 코드부여에이견이있는소화기계암에대한설문조사결과 Organ or Subject Stomach Colon Diagnosis 응답자수 ( 총 240 명 ) Low grade adenoma/dysplasia 230 10 0 1 2 3 6 무응답 High grade adenoma/dysplasia
http://www.kbc.go.kr/pds/2.html Abstract Exploring the Relationship Between the Traditional Media Use and the Internet Use Mee-Eun Kang This study examines the relationship between
DBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
( )Ksgoc hwp
원저 부인종양제 18 권제 2 호 2007 Vol. 18, No. 2, June, 2007 성균관대학교의과대학삼성서울병원산부인과학교실고옥진 최철훈 김태중 김우영 이경미 최정주 이정원 김병기 이제호 배덕수 목적 : 본연구는자궁경부포암에서염색체 3p 종양억제유전자인 FHIT의과메틸화와이형접합소실, 그리고이들의상관관계를분석하고자하였다. 연구방법 :37개의자궁경부암과각각의정상조직에서
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR -
Surpass the limit of Polymerase Chain Reaction (PCR) PCR Enzyme Guide High Fidelity PCR 효소 범용적인 PCR 효소 특수목적을위한 PCR 효소 - Epigenetics - Multiplex PCR - Direct PCR High Fidelity PCR 효소 - NGS targeted sequencing,
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
Study on the Improvement of Management System through Analysis of golf semi- market: Focus on Physical Education Facility Act Ji-Myung Jung 1, Ju-Ho Park 2 *, & Youngdae Lee 3 1 Korea Institute of Sport
untitled
ORIGINAL ARTICLE pissn: 2384-3799 eissn: 2466-1899 Int J Thyroidol 2018 November 11(2): 123-129 https://doi.org/10.11106/ijt.2018.11.2.123 갑상선종양에서 메틸화와 BRAF 유전자변이에관한연구 고려대학교의과대학이비인후 - 두경부외과학교실 오경호, 정광윤,
1-7.hwp
Journal of Genetic Medicine 2009;6:1-7 1 1) 인체 암의 DNA 메틸화 변화 서울의대 병리학교실, 서울대 암연구소 후성유전학실, BK21 의생명과학 연구사업단 권 형 주 강 경 훈 DNA Methylation changes in Human Cancers Department of Pathology, Cancer Research
PowerPoint 프레젠테이션
여성암지키미 대장암지키미 Green Cross Genome Items Internal use only, not for distribution! 1 한국인의암유병률 비호지킨림프종기타암 담낭및기타담도 췌장암 2% 2% 18% 4% 2% 전립선암 7% 유방암 8% 간암 폐암 10% 갑상선암 19% 위암 15% 대장암 13% Internal use only, not
암센터뉴스레터1
CANCER HOSPITAL News News Letter For Yonsei University Gangnam Severance Hospital http://gs.iseverance.com 2012.06.21 2012.08.16 2012.09.19 2012.10.04 2012.10.25 CONTENTS 2012.07.27 2012.10.06 2012.11.06
연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진
연구보고서화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) - 실험동물을이용한고감도발암성확인기법의검증 - 임경택 김수진 요약문 i ii 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 iii iv 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인 (II) 요약문 v vi 화학물질노출에의한유전자돌연변이 ( 발암 ) 의조기확인
Kjhps016( ).hwp
Surgical Extent and Types in Pancreatic Cancer Song Cheol Kim, M.D. Department of Surgery, Ulsan University College of Medicine & Asan Medical Center, Seoul, Korea Pancreatic cancer continues to pose a
Wnt and other signalings
Wnt and other signalings 발생은진화적으로하등동물부터인간까지보전되어있는여러가지 signaling에의해적절한때, 적절한장소에서이들의 target genes의발현을통하여조절되어지는것으로알려져있다. 대표적으로발생동안에중요하다고알려진신호로는 Wnt singaling과 TGF-βs, activins 그리고 BMPs와같이크게세가지 families로나뉠수있는
DNA 와그역할 (DNA and Its Role in Heredity) 박영홍 인제대학교의과대학생화학교실 11.1 유전자가 DNA라는증거 11.2 DNA의구조 11.3 DNA 복제 11.4 DNA 손상 (error) 의복구 11.5 DNA 구조와
DNA 와그역할 (DNA and Its Roe in Heredity) 2017. 05. 18 박영홍 인제대학교의과대학생화학교실 11.1 유전자가 DNA라는증거 11.2 DNA의구조 11.3 DNA 복제 11.4 DNA 손상 (error) 의복구 11.5 DNA 구조와복제지식의활용 1 11.1 유전자가 DNA 라는증거 1869 년 Miescher 의실험 : Nucein
Microsoft PowerPoint - 김미영
암세포의위험한여행 한국과학기술원 김미영 강의개요 전이란무엇인가? 전이는어떤과정을통해진행될까? 전이예측방법은어떤것들이있을까? Cancer ( 악성종양 ) US South Korea 질병사망률질병사망률 1. 심장병 26% 1. Cancer 26.7% 2. Cancer 23% 2. 뇌출혈 12.7% 3. 뇌출혈 5.6% 3. 심장병 7.9% >20,000 환자가악성종양에의해매일사망함
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
Site-Specific Factor 2 - Clinical Assessment of Regional Lymph Nodes (Colon, Appendix, Rectum) 자료원 : 영상보고서, 이용가능한신체검사지 ( 외과적관찰또는림프절조직검사는포함하지않는다.) 이필드의
Colon, Appendix, Rectum Site-Specific Factor 1 and Site-Specific Factor 3 - CEA Interpretation and CEA Lab Value (Colon, Appendix, Rectum) 자료원 : 임상실험보고서, 병리보고서나세포학보고서, H&P, 수술기록지, 협의진단기록지, 퇴원요약지다른이름 :
슬라이드 1
Real Time PCR 목차 1. PCR 및 Real Rime PCR 원리 2. Real Time PCR 검출방법 3. Real Time PCR 정량방법 4. Takara Real Time PCR 시약 5. 금일실험내용 Polymerase Chain Reaction Taq DNA Polymerase - Thermostable DNA polymease from
<28BCF6BDC320323031352D31332920B0E6B1E2B5B520C1F6BFAABAB020BFA9BCBAC0CFC0DAB8AE20C1A4C3A520C3DFC1F8C0FCB7AB5FC3D6C1BE2830312E3036292E687770>
수시과제 2015-13 경기도 지역별 여성일자리 정책 추진 전략 연구책임자 : 최 윤 선 (본원선임연구위원) : 남 승 연 (본원연구위원) 연 구 지 원 : 이 상 아 (본원위촉연구원) 연 구 기 간 : 2015. 9 ~12 2015 발 간 사 여성 일자리는 사회 내 여성과 남성간의 차이를 좁히고 개개인의 삶을 윤택하게 만드는 중요 한 부분입니다. 이에 정부는
서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012
11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.
Microsoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
untitled
대한소아소화기영양학회지 : 제 10 권제 2 호 2007 증례 뇌수모세포종및가족성선종성용종증으로발현한 Turcot 증후군 1 예 성균관대학교의과대학삼성서울병원소아과학교실, * 진단병리과학교실 정수인ㆍ서정민ㆍ이지혁ㆍ이해정ㆍ이지현ㆍ성기웅ㆍ송혜정 * ㆍ최연호 Medulloblastoma and Familial Adenomatous Polyposis in a 24-year-old
A 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
<342EBEC8BCBABFAD2CB9DAC7E2C1D82E687770>
大 韓 癩 學 會 誌 : 第 41 卷, 第 1 號 2008 Korean Leprosy Bulletin, Vol. 41, No. 1, June, 2008 마비성 하안검 외반증에 대한 lateral tarsal strip의 재조명 안성열 성형외과의원 1), 제일병원 피부과 2) 안성열 1), 박향준 2) - Abstract - Reappraisal of the
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
04조남훈
Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
35 1 Journal of the Korean Society of Health Information and Health Statistics Volume 35, Number 1, 2010, pp ) 1) 2) 1) 1) Cadherin-1 (CDH1) po
35 1 Journal of the Korean Society of Health Information and Health Statistics Volume 35, Number 1, 2010, pp. 1 15 1) 1) 2) 1) 1) Cadherin-1 (CDH1) polymorphism and the risk of colorectal cancer: A meta-analysis
연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
Δ Epidermal growth factor receptor (EGFR) is well established target for cancer treatment and EGFR tyrosine kinase (TK) inhibitors such as gefinitib and elotinib have been developed as anti-cancer drugs.