Microsoft Word doc

Transcription

1

2 의학박사학위논문 결장직장암에서 Bone Morphogenetic Protein 2 유전자의후향적변이에관한연구 The Study of Epigenetic Alteration of the Bone Morphogenetic Protein 2 in Human Colorectal Cancer 2007 년 2월 인하대학교대학원의학과 ( 외과학전공 ) 구지회 1

3 의학박사학위논문 결장직장암에서 Bone Morphogenetic Protein 2 유전자의후향적변이에관한연구 The Study of Epigenetic Alteration of the Bone Morphogenetic Protein 2 in Human Colorectal Cancer 2007 년 2월 지도교수김경래이논문을박사학위논문으로제출함인하대학교대학원의학과 ( 외과학전공 ) 구지회 2

4 목 차 국문요약... 4 Abstract List oft ables List of Figures 9 서론.. 11 연구대상및방법 결과 21 고찰.. 27 결론.. 31 참고문헌 Tables Figures.. 42 감사의글

5 국문요약 BMP2 ( Bone morphogenetic proteins 2) 는 TGF-β (transforming growth factor-β) 의한종류로써세포의증식에중요한역할을하는것으로알려져있다. 최근연구에서외부적인 BMP-2는위장관의정상및암세포를포함한여러종류의세포주에서항증식작용을하는것으로보고되고있다. 저자는인간의결장직장암에서의 BMP-2의변이여부를확인하기위하여인하대학교외과학교실에서결장직장암으로진단받고수술이시행된환자 40예의정상및암조직세 포와 6 예의결장직장암세포주의 RNA 를역전사중합효소연쇄반 응을이용하여분석하였다. 대상환자의평균연령은 64.7세이었으며, 남자는 25예 (62.5%) 이었고, 여자는 15예 (37.5%) 이었다. 이들중결장암환자는 18예 (45%) 이었고직장암환자는 22예 (55%) 이었다. 조직학적분화도는고분화형이 6예 (15%), 중등도분화형 31예 (77.5%), 저분화형 2예 (5%), 점액성암 1예 (2.5%) 이었다. 정상결장직장조직 40예에서는 BMP-2의감소가나타나지않았으며, 결장직장암 40예중 13예 (33%) 와결장직장암세포주 6예중 3예 (50%) 에서 BMP-2의발현이감소되었다. 남자 25예중 8예 (32.%) 에서 BMP-2발현감소를보였고, 여자 15예중 5예 (33.3%) 에서발현감소를보였다. 결장암 18예중 BMP-2의발현감소는 5예 (27.8%) 에서보였으며, 직장암 22예중 8예 (36.4%) 에서발현감소를보였다. 40예의결장직 4

6 장암세포와세포주각각 60% 와 50% 에서 BMP-2 유전자의 CpG island에서메틸화를확인하였으며, BMP-2 유전자의발현이감소된결장직장암세포 13예모두를포함하고있었다. 그러나, 임상병리학적요소들과암조직세포의 BMP-2 발현정도에는통계적인연관성없었다. 본연구에서메틸화특이적중합효소연쇄반응기법에의한 BMP-2의 CpG island 메틸화는결장직장암발생에있어서중요한역할을함을알수있었다. 그러므로, BMP-2 유전자의메틸화의이상변이에의한 BMP-2 유전자발현의소실또는감소는결장직장암발생과연관되어있다고추측된다. 5

7 Abstract Bone morphogenetic proteins (BMPs), are members of the transforming growth factor-beta family and play an important role in the cellular growth. Recently, it was reported that exogenous bone morphogenetic protein (BMP)- 2 acted as an antiproliferative agent in a variety of cell lines, including normal and cancerous gastric cell lines. To determine whether BMP-2 is altered in human colorectal cancer, we analyzed 40 colorectal cancer diagnosed and treated by Inha University Hospital and 6 colorectal cancer cell lines by reverse transcription-pcr for expression of BMP-2. Thirteen of 40 colorectal cancer (33%) and three of 6 colorectal cancer cell lines (50%) revealed the decreased expression of BMP-2. According to stage, the rate of decreased expression of BMP-2 were 0%(0/7) in stage I, 42.1%(8/19) in stage II, 28.6%(2/7) in stage IIIa, 33.3%(2/6) in stage IIIb and 100%(1/1) in stage IV. According to histologic grade, the rate of the decreased expression of BMP-2 were 33.3%(2/6) in well differentiated, 32.2%(10/21) in moderately differentiated, 50%(1/2) in poorly differentiated, and 0%(0/1) mucinous type. According to location of the cancer, the rate of decreased expression of BMP- 2 were 27.8%(5/18) in colon cancer and 36.4%(8/22) in rectal cancer. We identified the methylation in CpG island of BMP-2 gene, 60% in colorectal 6

8 cancer cell and 50% in colorectal cancer cell lines, the 13 cases depressed or lost BMP-2 gene was involved. But there was no significantly correlation between the clinicopathologic factors and the loss or decrease of BMP-2 expression. Epigenetic silencing through DNA methylation is one of the key steps during carcinogenesis. In this study, we found, through analysis by the methylation-specific polymerase chain reaction technique, CpG island methylation of the BMP-2 promoter region in colorectal cancer. Thus, aberrant BMP-2 methylation and the resultant loss of BMP-2 expression may be related to colorectal carcinogenesis. 7

9 List of Tables Table 1. Summary of bone morphogenetic protein 2 primer sequence, annealing temperatures ( ).38 Table 2. Clinicopathological characteristics of the patients (N = 40)..39 Table 3-1. The correlation between histopathologic factors and the loss of the expression of Bone morphogenetic protein 2 in colorectal cancer cell Table 3-2. The correlation between histopathologic factors and the loss of the expression of Bone morphogenetic protein 2 in colorectal cancer cell

10 List of Figures Fig. 1. The action mechanism of bone morphogenetic proteins-2 (BMP-2)...42 Fig. 2. Chemical reaction of bisulfate treatment for DNA methylation analysis Fig. 3. Bone morphogenetic protein 2 expression in colorectal Cancer.44 Fig. 4. Bone morphogenetic protein 2 expression in colorectal cancer cell lines. 45 Fig. 5. Schematic representation of the human bone morphogenetic protein Fig. 6. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell

11 Fig. 7. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell lines. 48 Fig. 8. RT PCR analysis after treatment with 5-aza-2 -. Deoxycytidine

12 서 론 Bone morphogenetic protein (BMP)-2 는 Transforming growth factor-β (TGF-β) 계통의한종류로서생체내에서정상골조직이이외의장소에서연골및골생성을하는기능을가진것으로알려져있다 (1). TGF-β와유사하게 BMPs는특이적인 type I과 type II serine-threonine kinase 수용체 (Bone morphogenetic protein receptor, BMPR) 를통하여작 용하는것으로알려져있다. II 형수용체와 BMP-2 의 결합은수용 체복합체의올리고화를유도하여 I 형수용체의인산화를일으킨후신호단백질인 Smad1, Smad5와 Smad8로신호를전달한다 (2). 여러연구에서 Smad1은 BMPR 신호의표적으로써많은연구가이루어지고있는데, BMPR에의해 Smad1이인산화가되면 Smad4 와이형중합체를형성하고핵안으로들어가서전사인자의역할을하게된다 (3)(Fig.1). BMP-2는과거에는골조직이외의장소에서골형성에관여하거나또는전립선암, 유방암등의골전이에관여하는것으로연구되어왔으나, 최근에는정상소화기관내의세포에서도 BMP-2 발현이확인되었다. 특히인체의정상대장세포내에서도높게발현되고있으며, 세포내에서앞서설명한기전을통하여세포의 apoptosis와분화를촉진하며, 세포의증식을억제하는것으로알려져있다. 또한가 11

13 족성용종증환자의선종내에서 BMP-2의소실을보이고있고이러한소실은가족성용종증에서의암발생과연관되어있는것으로알려져있다. 이러한 BMP-2 유전자의역할은결장직장암에서암억제유전자로써의가능성을제시하고있다 (4). 그러나아직까지결장직장암의발생과 BMP-2 유전자와의연관성에관한연구는미미한실정이다. 메틸화에의한 genomic DNA의후향적변이는몇몇의암억제유전자의유전자기능의소실에있어서중요한역할을하고있다. 거의모든유핵세포에서의 DNA 메틸화는정상적으로 CpG dinucleotide내의 cytosine 잔기에서발생한다 (5). 이러한형태의변이는전사요소의결합을방해하여직접적으로유전자의발현을억제하거나, methyl-cpgbinding protein(mecp2) 과 histone deacetylase로구성된복합체를유도함으로써간접적으로유전자의발현을억제한다 (6). 유전적인변이와 더불어, CpG islands 촉진구역내의 DNA 과메틸화는암억제유전자 의억제성전사를야기하기때문에암발생과정의한단계로써많 이연구되고있다. 이러한후향적변이는여러암세포에서다양한 빈도로발견되고있다. 특히결장직장암의발생기전인선종 - 암화 과정중 초기선종의단계에서메틸화가관찰되고있다 (7,8). 이러한 메틸화는여러암종류에서비특이적으로발생한다고알려져있었 으나, 최근에는암종류에따라특이적으로발생하기도한다고알려 12

14 지고있다 (9). 저자는본연구를통하여인간의결장직장암조직에서의 BMP-2 유전자의발현여부를확인하고이들과결장직장암의임상병리학적요인들과의상호연관관계에대해알아보고자하였으며, 메틸화에의한 BMP-2의발현여부에관하여연구하였다. 13

15 연구대상및방법 1. 연구대상 본연구는 2005 년 12 월부터 2006 년 7 월까지인하대병원외과학 교실에서결장직장암으로진단받고, 수술당시근치적절제술을 시행받은 40 예를대상으로하였다. 대상환자의평균연령은 64.7 세로 29 세부터 83 세까지의연령분포를보였으며남자는 25 예, 여 자 15 예이었다. 2. 실험방법 (1) 세포주와조직검출 본연구는 6 예의인간결장직장암세포주 (SW480, SW620, HCT116, LOVO, DLD-1, LS174T) 와 40 예의결장직장암환자의정상조직과 암조직을가지고이루어졌다. 모든정상및암조직은수술직후 해부병리과의도움으로 채취되었으며, 이러한조직의채취및전 연구과정은임상시험심사위원회의승인아래환자의자발적인동의 14

16 를얻어시행되었다. (2) 세포배양 인간결장직장암세포주 SW480, SW620, HCT116, LOVO, DLD-1, LS174T은 (Korean Cell Line Bank) 37 C에서 RPMI 1640 (Life Technologies, Inc.) 배양액에 10% (v/v) heat-inactivated bovine calf serum (Life Technologies, Inc.) 와 1:100 dilution of a penicillin-streptomycinfungizone solution (Life Technologies, Inc.) 을첨가한후사용하였다. (3) DNA 추출 암세포와정상세포에서 DNA 및 RNA를분리하였다. 이를위해조직을 digestion buffer (50mM Tris HCl, ph 8.5, 1mM EDTA, 0.5% Tween 20, 400μg proteinase K) 가들은 1.5ml Eppendorf tube에넣어 55 에서 24 시간부란하였다. 부란후 proteinase K의활성을억제하기위하여 97 에서 5분간처리하였고그후phenol/chloroform으로 DNA를추출하였다. 추출과정은 % sodium sarcosin의 buffer-saturated phenol 을 300μl씩시료에넣어 vortex시켜 homogenous emulsion을만든후 3500g로원심분리하였다. 그후상층액을깨끗한 Eppendorf tube에 15

17 옮긴후 300 μl의 chloroform isoamyl alcohol 을첨가하여 vortex 로잘 섞어 3500g로원심분리하였고, 이과정을 3회반복하였다. 그후상층액을새 tube에옮긴후 1/10 volume의 3M sodium acetate와 2X volume의 100% ethanol을첨가하여조심스럽게섞은후 -70 에 1시간방치하여 DNA를침전시켰다. 그후 3500g로 5분간원심분리한후상층액을버리고침전물을 70% cold ethanol로수세후재원심분리하여 DNA를침전시키고 DNA pellet을공기중에건조시킨후멸균증류수로용해시켰다. 추출한 DNA의순도는 spectrophotometer 로 260nm와 280nm의파장에서수치를읽어이수치의비 260/280가 1.8 이상인 DNA를시료로사용하였고순도가이수치이하인경우에는 phenol/chloroform 추출을다시하였다. 이렇게추출한 DNA는 1% agarose gel에전기영동하여 DNA를확인하였다. (4) RNA 추출 Total RNA 는 Acid-Guanidinium thiocyanate Chloroform (AGPC) extration 방법을응용한 TRIZOL reagent 를이용하여분리하였다. 분리된 RNA 는 Spectrophotometer 를사용하여 RNA mode (260 과 280 nm) 에서 정량하였다. 16

18 (5) 역전사중합효소반응 ( Reverse Transcriptase - Polymerase Chain Reaction, RT-PCR ) 합성된 cdna 로부터 RT-PCR 를이용한분석 : 역전사반응후 1st strand cdna 를각 1µl 씩취하여 1 x Tag Buffer, dntp(10mm) 와 각각 의 primer 쌍과 1.25 unit Taq DNA polymerase를섞어 PCR을수행하였다. PCR 은 Perkin-Elmer thermal Cycler (GeneAmp PCR system, PerkinElmer Life Science) 을사용하였고온도조건은 94 C 에서 30초, 56 C 에서 30초 70 C 에서 1분의조건으로 30회반복하였다. (6) BMP-2 유전자의메틸화분석 ( Methylation Analysis of BMP-2 gene ) 50μl용액중 1μg의 DNA를최종농도 0.2M의 NaOH용액으로 37 에서 10분간처리하여 DNA를변성시겼다. 그후 urea/sodium bisulfite로 DNA를변환시키기위하여 50ml의 Falcon tube에 7.5g의 urea(analytical grade, BDH) 를넣고여기에 10ml의증류수를첨가하여 vortex하면서녹였다. 여기에실온에서 7.6g의 sodium metabisulfite(sigma) 를넣고증류수 20ml로용해시키면서 vortex하여 17

19 녹이면서용액의 ph를 10M NaOH로 5.0으로조절하였다. 이렇게만든 urea/sodium bisulfite용액과hydroquinone을변성시킨 DNA에최종농도가각각 5.36M, 3.44M 및 0.5mM되도록 DNA 용액 22.2μl, urea/sodium bisulfite 208μl및 10mM의신선한 hydroquinone용액 12 μl씩혼합하였다. 그후혼합용액을 0.5ml의 Polymerase Chain Reaction(PCR) tube 에넣고 55 에서 15 분, 이어서 95 에서 30 초반 응시키는과정을 20회반복하였다. 이러한과정이끝난 modified DNA는 WizardDNA purification resin(promega, Madison, WI, USA) 으로정제후다시 NaOH(final concentration 0.3M) 로실온에서 5분간처리후 ethanol로침전시켜멸균증류수로녹였다. (7) 메틸화특이적중합효소연쇄반응 (Methylation-Specific Polymerase Chain Reaction, MSP) PCR 반응을위한 primer는인간의 BMP-2 유전자의 promoter/exon 1 부위중일부를증폭하도록설계하여사용하였다. DNA의 nucleotide 중메틸화된 cytosine을관찰하기위하여 DNA를 urea/sodium bisulfite 로화학반응시켜메틸화된 cytosine과메틸화가되지않은 cytosine 이 uracil로변환되는것으로메틸화의여부를알수있으며이렇게처리된 DNA를 PCR로증폭함으로 uracil로변환된 cytosine은 PCR산 18

20 물에서 thymidine으로치환된것을알수있다 (Fig2). PCR증폭에쓰이는 primer set는 BMP-2U (Bone morphogenetic protein unmethylated), CpG island의 cytosine에메틸화된 DNA를특이적으로증폭할수있도록제작된 primer BMP-2M (Bone morphogenetic protein methylated), CpG island에메틸화가안된 DNA를증폭할수있도록제작된 BMP-2U primer등을각각사용하였다 (Table 1.). 반응은 20μl의반응으로 1x PCR buffer에 dntp 각각 250mM, 각각의 primer 10pM, DNA/modified DNA 50ng, 1.25mM MgCl2, Taq polymerase 0.5U들을넣어반응시켰고반응조건은 95 에서 5분반응후 95 에서 30초, 65 에서 30초, 72 에서 30초반응시키고이과정을 35회반복하였다. 그후 72 에서 5분연장한후반응을종결하였다. 이렇게반응시켜얻은 PCR 산물은 1% agarose gel에전기영동하여확인하였다. 19

21 3. 통계처리 BMP-2 발현의감소에따른다른임상병리학적인자와의연관성 비교는 chi-square test 를통해검증하였고 p 값이 0.05 미만인경우 통계적으로유의한관련성이있는것으로판정하였다. 20

22 결 과 환자의임상병리학적특성 대상환자의평균나이는 64.7±11.4세이었으며최저 29세최고 83 세이었다. 남자는 25예 (62.5%) 여자 15예 (37.5%) 로남녀비는 1.67:1 이었고, 결장암이 18예 (45%) 이었으며, 직장암은 22예 (55%) 이었다. 이들의수술전암태아성항원 (carcinoembryonic antigen, CEA) 농도는 21.4ng/ml 이었고, 수술후 CEA 는 6.7ng/ml 이었다. 종양의분화도 에따라구분한결과고분화형이 6예 (15%), 중등도분화형 31예 (77.5%), 저분화형 2예 (5%), 점액성암 1예 (2.5%) 이었다. 27예 (67.5%) 에 서는대장직장주위림프절전이가없었으나 13예 (32.5%) 에서주위 림프절전이가있었으며이들의평균림프절수는 4.8개 (1개-18개) 이 었다. TNM 병기로는 Stage I 7예 (17.5%), Stage II 19예 (47.5%), Stage IIIa 7예 (17.5%), Stage IIIb 6예 (15%) 그리고 Stage IV 1예 (2.5%) 이었 다 (Table 2). 21

23 결장직장암에서의 BMP-2의발현 40예의결장직장암환자에서 BMP-2 mrna 발현을 RT-PCR을통해분석하였다. 40예의정상조직모두에서 BMP-2 mrna가발현되었으나, 결장직장암조직 40예중 13예 (32.5%) 에서 BMP-2 mrna 발현이감소되거나소실됨을보였다 (Fig. 3). 결장직장암세포주에서의 BMP-2의발현 결장직장암세포주 6예중 3예 (50%) 에서 BMP-2 mrna 발현의감소를보였다. SW480, LOVO, 와 DLD-1에서 BMP-2 mrna의양성발현을보였으나, SW620, HCT116, LS174T에서는 BMP-2 mrna가발현되지않거나아주약한발현을보였다 (Fig. 4). 22

24 결장직장암세포와세포주에서의 BMP-2의메틸화분석 메틸화특이적중합효소연쇄반응 (Methylation specific polymerase chain reaction, MSP) 를시행하기앞서 BMP-2 유전자의 CpG islands를분석하였다. 분석결과 4개의 CpG islands를발견하였으며, 3번째 CpG islands를중심으로탈메틸화를확인하기위한 MSP를시행하였다 (Fig. 5). urea/sodium bisulfite로처리시킨정상조직은모두 BMP-2U primer로증폭되었으며종양조직의 DNA는 BMP-2M primer로는 40예중 24예 (60%) 에서증폭이확인되었다 (Fig.6). 증폭된 24예는 RT-PCR에서 BMP-2의발현이저하된 13예모두를포함하였다 (No. 4, 8, 9, 16, 24, 27, 29, 30, 32, 34, 38, 52, 62). 또한결장직장암세포주의경우총 6예중 3예인 SW480, SW620, HCT116에서메틸화가확인되었으며이중 SW620과 HCT116에서는 BMP-2의발현이소실된세포주였다 (Fig. 7).. 23

25 탈메틸화에의한 BMP-2 유전자발현의효과 메틸화에의한 BMP-2 발현조절을확인하기위해본연구진은 BMP-2의 mrna의발현이억제되어있는결장직장암세포주인 HCT-116 세포주에 BMP-2 유전자발현을탈메틸화시약인 5-aza-2 - deoxycytidine (1µM) 처리후역전사중합효소반응으로분석한결과 BMP-2의발현이유도됨을관찰하였다 (Fig. 8). 따라서 CpG 메틸화에의한 BMP-2 유전자발현이조절됨을시사해준다. 24

26 BMP-2 발현감소에따른임상병리학적인자와의연관성 남자의경우 25 예중 8 예에서 (32.0%) 에서 BMP-2 발현이감소되었 고, 여자에서는 15 예중 5 예 (33.3%) 에서감소하였다. 상행, 횡행, 하행및구불결장을포함한결장암 조직 18 예중 5 예 (27.8%) 에서 BMP-2의발현이감소되었고직장암조직에서는 22예중 8예 (36.4%) 에서감소되었다. 술전 CEA 수치에따른 BMP-2 발현감소는 CEA의수치가정상범위내에있었던 30예중 9예 (30.0%) 에서나타났고, 정상범위보다높았던 10예중 4예 (40%) 에서감소를나타내었다조직학적분화도에따른 BMP-2 발현감소는고분화분화암에서 6 예중 2예 (33.3%), 중등도분화암에서 31예중 10예 (32.2%), 저분화암에서 2예중 1예 (50%) 에서나타났으며, 점액성암에 1예에서는 BMP-2의감소가나타나지않았다. 종양이점막하층에국한된 T1 병변 2 예와 고유근층에국한된 T2 병변 5예에서는 BMP-2 발현의감소가나타나지않았으나, 고유근층을넘어서점막하까지침윤된 T3 에서는 31예중 11예 (35.3%) 에서, 장막을투과하거나타장기혹은조직에직접적으로침윤된 T4 에서는 2예모두에서 BMP-2 발현의감소가나타났다. 주위림프절전이유무에따른 BMP-2 발현의감소는 림프절전이 25

27 가없는경우 27예중 9예 (33.3%) 에서, 림프절전이가있는경우 13 예중 4예 (30.8%) 에서나타났다.. 병기에따른 BMP-2 발현의감소는 I기 7예에서는보이지않았으나, II기 19예중 8예 (42.1%), IIIa기 7예중 2예 (28.6%), IIIb기 6예중 2예 (33.3%) 그리고 IV기 1예중 1예 (100%) 에서발현의감소를보였다. BMP-2 발현의소실과결장직장암의임상병리학적요인들과의연관성에관하여알아보았으나각요인들과 BMP-2 발현정도와는통계적으로상호연관성을보이지는않았다 (Table 3). 26

28 고 찰 암의발생은암관련유전자의기능적인변이를포함한여러단계를거쳐서발생한다고알려져있다. 이러한과정들에는촉진자의메틸화나유전자전반에걸친저메틸화와같은후향적인변이뿐만아니라돌연변이이형성의소실을포함하는유전적현상들이있다 (7,8). 과거많은연구들의결과로결장직장암발생과정에대한기전이제시되고있는데, 먼저약 70 80% 정도의결장직장암에서 5번장완염색체내의 APC (adenomatous polyposis coli) 유전자의소실이나돌연변이로설명되며, 이러한예로 K-ras 암유전자의점돌연변이, 암억제유전자로알려진 18번장완염색체내의 DCC 와 SMAD4 유전자의소실또는 17번단완염색체의 p53 유전자의소실등이있다 (10-12). 다른기전으로는전체결장직장암의약 10 15% 를차지하고있는유전성비용종증결장직장암 (Hereditary nonpolyposis colorectal cancer) 증후군에서나타나는 DNA 복제실수 교정유전자인 hmsh2, hmlh1, hpms1 의돌연변이에의해결장직장 암의발생한다고제시되고있다 (13). 본연구는지금껏결장직장암 의암유전자로알려진앞서설명한유전자들이외에 BMP-2 유전 자와결장직장암과의연관성을알아보고자하였다. 최근연구들은 위장관을포함한여러장기의암발생에있어서 BMP signaling 과의 27

29 연관성을제시하였다. 먼저시험관내에서의 rhbmp-2 는전립선암, 위암, 결장암세포에서항증식작용을하는것으로알려졌으며, 두 번째로는전립선암과결장암등에서 BMP-2 발현이감소되나정상 결장직장세포에서는 BMP-2 의발현이높다고보고하고있고 (4), 세 번째로는 BMPRI 와 Smad4 에서의돌연변이는소아성용종증 (Juvenile Polyposis) 과연관되어있음을 보고하고있으며, 이러한환자 들은위장관암의발생위험성이있다 (21). 본연구에서도총 40예의정상결장직장세포전체에서는 BMP-2 유전자가발현되었으나, 결장직장암세포와 6예의결장직장암세포주에서는각각 32.5% 와 50% 의낮지않은비율로 BMP-2 유전자의감소또는소실을나타내었다. 이러한결과로볼때향후에도많은연구가필요하겠지만 BMP-2 유전자도암억제유전자로알려진 p53, DCC, APC 유전자와같이결장직장암발생에있어서억제유전자로써의가능성이있다. 암억제유전자의 CpG island내에서이상적인메틸화는억제유전자의기능의소실을야기하며, 이는암발생기전을설명하는중요한기전중의하나로연구되고있다 (14-20). 결장직장암발생의유전자모델로알려진선종 - 암화과정 단계에서 의메틸화의변화는암유전자나암억제유전자의변이를가져오 고특히촉진구역내의 CpG island 의과메틸화는교정유전자뿐만아 니라억제유전자의소실을초래한다 (22-24). 본연구에서는결장직 28

30 장암세포 60% 에서메틸화를확인하였으며, 이는결장직장암에서의메틸화를연구한다른연구의결과들과유사하였으며 (25-27), 특히 BMP-2 유전자의발현이감소되거나소실된 13예모두에서메틸화가발생하였다. 또한메틸화에의해 BMP-2 유전자발현이소실된세포주 HCT116에탈메틸화시약인 5 -aza-2 -deoxycytidine 으로처리하였을때메틸화가발생하지않고 BMP-2 유전자의발현이나타났으며이러한결과는다른연구에서도확인할수있었다 (28,29). 이는 CpG 메틸화에의한 BMP-2 유전자발현이조절됨을시사해준다. 이러한결과로볼때 BMP-2 유전자의발현이소실되거나감소된 결장직장암에서는 BMP-2 CpG islands 의메틸화가나타나며, BMP-2 유전자가높게발현되는세포에서는 CpG islands 메틸화가나타나지않음을알수있었다. 그러므로, 결장직장암세포에서의 BMP-2 유전자발현의소실은 BMP-2 유전자촉진자의메틸화와강한연관이있으며, 즉 BMP-2 유전자는다른결장직장암억제유전자들과유사하게결장직장암세포와배양된결장직장암세포주에서메틸화를통하여억제되어지는것으로생각된다. 본연구에서 BMP-2 유전자발현감소여부와임상병리학적인자들간의상호연관관계를알아보았으나통계학적으로의의는없었다. 이는본연구가적은수를대상으로시행되었고단기간에이루어진통계학적인오류를포함시켜야하겠지만, 결장직장암의발생에 29

31 있어서메틸화에의한유전자의변이는선종-암화과정의여러단계에서산발적으로발생하는것으로알려져있고 (30), 또한다른암유전자와예후와연관된임상병리학적인자들간의관계에대해서는명확히밝혀진바가없다 (31,32). 그러므로, BMP-2 유전자발현의소실여부와결장직장암의예후와연관된여러임상병리학적인자들간의상호관계를확인하기위해서는향후많은대상을통한연 구와함께 결장직장암세포내에서의작용기전에대한연구가필 요할것으로여겨진다. 30

32 결 론 저자는본연구에서결장직장암환자의정상결장직장조직과암 조직에서 BMP-2 유전자발현정도를비교하였을때 정상조직에서 BMP-2 유전자가 40예모두에서발현이되었고암조직 40예중 13 예에서발현감소가있었음을확인할수있었고, 이러한유전자발현감소에 CpG island의메틸화가관여함을확인할수있었다. 그러므로 BMP-2 유전자도다른암억제유전자들과유사하게결장직장암발생과정에있어서하나의억제유전자로써기능을가지고있으리라추측되나, 향후 BMP-2 유전자발현의억제를가져오는 CpG island 메틸화의발생원인과결장직장암의선종암화과정중어느단계에서메틸화가발생하는가에대한연구는지속되어야하겠다. 31

33 참고문헌 1. von Bubnoff, A. and Cho, K. W. Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev Biol, 239: 1-14, Heldin, C. H., Miyazono, K., and ten Dijke, P. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature, 390: , Liu, F., Hata, A., Baker, J. C., Doody, J., Carcamo, J., Harland, R. M., and Massague, J. A human Mad protein acting as a BMP-regulated transcriptional activator. Nature, 381: , Hardwick, J. C. H., Van Den Brink, G. R., Bleuming, S. A., Ballester, I., Van Den Brande, J. M. H., Keller, J. J., Offerhaus, G. J. A., Van Deventer, S. J. H., and Peppelenbosch, M. P. Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. Gastroenterology, 126: , Jones, P. A. and Baylin, S. B. The fundamental role of epigenetic events in cancer. Nat Rev Genet, 3: ,

34 6. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J., and Wolffe, A. P. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet, 19: , Farber E. Cancer development and its natural history. A cancer prevention perspective. Cancer, 62(Supple.8): , Cairns J. Mutation selection and the natural history of cancer. Nature, 255: , Costello, J. F., Fruhwald, M. C., Smiraglia, D. J., Rush, L. J., Robertson, G. P., Gao, X., Wright, F. A., Feramisco, J. D., Peltomaki, P., Lang, J. C., Schuller, D. E., Yu, L., Bloomfield, C. D., Caligiuri, M. A., Yates, A., Nishikawa, R., Su Huang, H., Petrelli, N. J., Zhang, X., O'Dorisio, M. S., Held, W. A., Cavenee, W. K., and Plass, C. Aberrant CpG-island methylation has non-random and tumour-type-specific patterns. Nat Genet, 24: , Lengauer C, Kinzler KW, Vogelstein B, Genetic instability in colorectal cancer. Nature, 386: , Thiagalingam S, Lengauer C, Leach FS Evaluation of candidate tumor suppressor gene on chromosome 18 in colorectal cancer. Nat. Genet, 13: ,

35 12. Nigro JM, Baker SJ, Preisinger AC.,Mutations in the p53 gene occur in divers human tumor types. Nature, 342: , Lothe RA, Peltomaki P, Meling GI, Genomic instability in colorectal cancer: relationship to clinicopathological variables and family history. Cancer Res, 53: , Issa, J. P., Vertino, P. M., Wu, J., Sazawal, S., Celano, P., Nelkin, B. D., Hamilton, S. R., and Baylin, S. B. Increased cytosine DNAmethyltransferase activity during colon cancer progression. J Natl Cancer Inst, 85: , Wu, J., Issa, J. P., Herman, J., Bassett, D. E., Jr., Nelkin, B. D., and Baylin, S. B. Expression of an exogenous eukaryotic DNA methyltransferase gene induces transformation of NIH 3T3 cells. Proc Natl Acad Sci U S A, 90: , Issa, J. P., Ottaviano, Y. L., Celano, P., Hamilton, S. R., Davidson, N. E., and Baylin, S. B. Methylation of the oestrogen receptor CpG island links ageing and neoplasia in human colon. Nat Genet, 7: , Issa, J. P. and Baylin, S. B. Epigenetics and human disease. Nat Med, 2: ,

36 18. Herman, J. G., Merlo, A., Mao, L., Lapidus, R. G., Issa, J. P., Davidson, N. E., Sidransky, D., and Baylin, S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res, 55: , Issa, J. P., Baylin, S. B., and Herman, J. G. DNA methylation changes in hematologic malignancies: biologic and clinical implications. Leukemia, 11 Suppl 1: S7-11, Toyota, M., Ho, C., Ahuja, N., Jair, K. W., Li, Q., Ohe-Toyota, M., Baylin, S. B., and Issa, J. P. Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification. Cancer Res, 59: , Howe, J. R., Bair, J. L., Sayed, M. G., Anderson, M. E., Mitros, F. A., Petersen, G. M., Velculescu, V. E., Traverso, G., and Vogelstein, B. Germline mutations of the gene encoding bone morphogenetic protein receptor 1A in juvenile polyposis. Nat Genet, 28: , Esteller M, Spark A, Toyota M. Analysis of adenomatous polyposis coli promoter hypermethylation in humna cancer. Res, 60: , Toyota M, Ohe-Toyota M, Ahuja N, Issa JP. Distinct genetic profiles in colorectal tumor with ir without the CpG island methylation phenotype. 35

37 Proc. Natl. Acad. Sci. USA, 97: , Paz MF, Fraga MF, Avila S. A systematic profiles of DNA methylation in human cancer cell lines. Cancer Res, 63: , Toyota, M., Ahuja, N., Ohe-Toyota, M., Herman, J. G., Baylin, S. B., and Issa, J. P. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A, 96: , Park SJ, Rashid A, Lee JH, Kim SG, Hamilton SR, Wu TT. Frequent CpG island methylation in serrated adenomas of the colorectum. Am J Pathol, 162: , Bariol C, Suter C, Cheong K. The relationship between hypomethylation and CpG island methylation in colorectal neoplasia. Am J Pathol, 162: , Li H, Myeroff L, Kasturi L Krumroy L, Schwarts S, Willson JK, Stanbridge E, Casey G, Markowitz S. Chromosomal autonomy of hmlh1 methylation in colon cancer. Oncogene, 21: , Suter CM, Norris N, Ku SL, Cheong KF, Tomlinson I, Ward RL. CpG island methylation is a common finding in colorectal cancer. Br J Cancer, 88: , Kim HC, Rho SA, Ga IH, Kim JS, Chang SY, Kim JC. CpG island methylation as an early event during adenoma progression in carcinogenesis of sporadic colorectal cancer. Gastroenterol, 20: ,

38 31. Ogunbiyi OA, Goodfellow PJ, Herfarth K. Conformation that chromosome 18q allelic loss in colon cancer is a prognostic indicator. J Clin Oncol, 16: , Martinez-Lopez E, Abad A, Font A. Allelic loss on chromosome 18q as a prognostic marker in stage II colorectal cancer. Gastroenterol, 114: ,

39 Table 1. Summary of BMP-2 primer sequence, annealing temperatures ( ). Forward primer (5-3 ) Reverse primer (5-3 ) BMP-2U ATGGTTGTTTTGAGTTATGGGTTGT CTTAAAAACCAACACCCAAAAAACACA 58 BMP2M GGTTGTTTCGAGTTATGGGTAGC ACCAACGCCCGAAAAAACGCG 58 RT-PCR CCTAAGGAGGACGACAGCAC GAGACCGCAAGTCCGTCTAAG 52 BMP-2U; Bone morphogenetic protein-2 unmethylated BMP-2M; Bone morphogenetic protein-2 methylated 38

40 Table 2. Clinicopathological characteristics of the patients (N=40) Age 64.7 ± 11.4 Sex Male 25 (62.5%) Female 15 (37.5%) Location Colon 18 (45%) Rectum 22 (55%) CEA Level (ng/ml) Pre-Op 21.4 Post-Op 6.7 Histologic Grade Well Differentiated 6 (15%) Moderately 31 (77.5%) Poorly 2 (5%) Mucinous 1 (2.5%) AJCC Stage I 7 (17.5%) II 19 (47.5%) IIIa 7 (17.5%) IIIb 6 (15%) IV 1 (2.5%) CEA, carcinoembryonic antigen, Pre-op; pre-operation, Post-op; post operation, AJCC; American Joint Committee on Cancer 39

41 Table The correlation between histopathologic factors f and the loss of the expression of BMP-2 in colorectal cancer cell BMP-2 Variable Expression Loss p-value No. of Patients 27 (67.5%) 13 (32.5%) Sex Male 17 (68.0%) 8 (32.0%) Female 10 (66.7%) 5 (33.3%) Location Colon 13 (72.2%) 5 (27.8%) Rectum 14 (63.6%) 8 (36.4%) Pre-op CEA (ng/nl) Normal 21 (70.0%) 9 (30.0%) Abnormal 6 (60.0%) 4 (40.0%) Histologic grade Well 4 (66.7%) 2 (33.3%) Moderated 21 (67.8%) 10 (32.2%) Poorly 1 (50.0%) 1 (50.0%) Mucinous 1 (100%) 0 (0%) BMP-2: Bone morphogenetic protein-2, Pre-op: pre operation, CEA: Carcinoembryonic antigen, 40

42 Table 3-2. The correlation between clinicopathologic factors and the loss of the expression of BMP-2 in colorectal cancer cell BMP-2 Variable Expression Loss p-value Tumor Depth T1 2 (100%) 0 T2 5 (100%) 0 T3 20 (64.7%) 11 (35.3%) T4 0 (0%) 2 (100%) Lymph Node Negative 21 (70.0%) 9 (30.0%) Positive 6 (60.0%) 4 (40.0%) Stage I 7 (100%) 0 (0%) II 11 (57.9%) 8 (42.1%) IIIa 5 (71.4%) 2 (28.6%) IIIb 4 (66.7%) 2 (33.3%) IV 0 (0%) 1 (100%) BMP-2; Bone morphogenetic protein 2 41

43 Figure 1. The action mechanism of bone morphogenetic proteins-2 (BMP-2). BMPR; Bone morphogenetic protein receptor 42

44 1) Unmethylated DNA 2) Methylated DNA Figure 2. Chemical reaction of bisulfate treatment for DNA methylation analysis. 43

45 Figure 3. BMP-2 expression in colorectal cancer. The BMP-2 mrna expression level was examined by RT PCR in 40 colorectal cancer cell lines. β-actin expression was used as an internal loading control for RT PCR. The cycle numbers for BMP-2 and β-actin were 30 and 25, respectively. BMP-2: Bone Morphogenetic Prptein -2 N: normal, C: cancer 44

46 SW480 SW620 HCT116 LOVO DLD-1 LS174T BMP-2 β-actin Figure 4. BMP-2 expression in colorectal cancer cell lines. The BMP-2 mrna expression level was examined by RT PCR in six colorectal cancer cell lines. β-actin expression was used as an internal loading control for RT PCR. The cycle numbers for BMP-2 and β-actin were 30 and 25, respectively. BMP-2; Bone Morphogenetic Prptein-2 45

47 Figure 5. Schematic representation of the human BMP-2 genes. Arrows denote the locations of the distal (at 1) and proximal (at 735) transcription start sites; the lower panel shows a schematic representation of the human BMP-2 gene (GenBank Accession No. AL035668). An arrow indicates the transcription start site. Boxes indicate exons, including coding (black) and non-coding (white) regions. Vertical bars show CpG sites. Black arrows below the CpG sites indicate the regions subjected to MSP and bisulfite sequencing (BS). 46

48 Figure 6. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell. Lanes; U, unmethylated alleles; M, methylated alleles. 47

49 Figure 7. Methylation specific polymerase chain reaction (MSP) analyses of the CpG island methylation status of the Bone morphogenetic protein-2 promoter region in colorectal cancer cell lines samples. Lanes; U, unmethylated alleles, M; methylated alleles. 48

50 Figure 8. RT PCR analysis after treatment with 5-aza-2 - Deoxycytidine (5-aza). Bone morphogenetic protein-2 (BMP-2) gene expression was reactivated after treatment with 5-aza-20-deoxycytidine in HCT-116 cell lines. b-actin was amplified as in internal control (30 cycles of PCR). - and + denote with and without 5-aza-20-deoxycytidine treatment, respectively. U; Unmethylated alleles, M; Methylated alleles. 49

51 감사의글 부족한점이많은논문을완성하도록지도편달을아끼지않으신김경래지도교수님께진심으로감사드리며, 심사과정에서많은조언을해주셨던신용운교수님, 오승택교수님, 오재환교수님, 장준혁교수님께도진심으로감사드립니다. 실험을시작할수있도록도와주신최인호교수님과선배로서옆에서힘이되주신최선근교수님께도감사드립니다. 오늘의제가있기까지항상격려와사랑을베풀어주신부모님과사랑하는나의아내와아들에게감사의말을전합니다. 끝으로무사히논문을마칠수있도록도와주시고관심을보여주신모든분들게감사드립니다. 저자씀 50