생약학회지 Kor. J. Pharmacogn. 45(1) : (2014) Lipopolysaccharide 로유도된 RAW cells 에서동규자오일의항염증효과 오성화 1 최수연 1 이상화 2 김동석 3 박성민 1 * 1 뉴메디온기술연구소, 2 서원

Size: px

Start display at page:

Download "생약학회지 Kor. J. Pharmacogn. 45(1) : (2014) Lipopolysaccharide 로유도된 RAW cells 에서동규자오일의항염증효과 오성화 1 최수연 1 이상화 2 김동석 3 박성민 1 * 1 뉴메디온기술연구소, 2 서원"

무송 빈
5 years ago
Views:

1 생약학회지 Kor. J. Pharmacogn. 45(1) : (2014) Lipopolysaccharide 로유도된 RAW cells 에서동규자오일의항염증효과 오성화 1 최수연 1 이상화 2 김동석 3 박성민 1 * 1 뉴메디온기술연구소, 2 서원대학교친환경바이오소재및식품센터, 3 서원대학교외식산업학과 The Anti-inflammatory Effects of Malva verticillata L. Oil Induced by Lipopolysaccharide with RAW cells Seong-Hwa Oh 1, Soo-Yeon Choi 1, Sang-Hwa Lee 2, Dong-Seok Kim 3 and Sung-Min Park 1 * 1 R&D Center, NewMedion Corporation, Wolgok-Ri, Cheongwon-Gun , Korea 2 Department of Food Service Industry, and Bio Organic Material and Food Center, Seowon University, Cheongju-city , Korea 3 Department of Food Service Industry, Seowon University, Cheongju-city , Korea Abstract Atopic dermatitis (AD) were caused by localized hypersensitivity reaction to an allergen. Therefore, to reduce inflammatory response of AD had been developed that natural extracts and oils with anti-inflammatory activities. This study were investigated that anti-inflammatory effects of Malva verticillata L. oil induced by LPS with RAW cells. We measured to production of NO and expression of COX-2, inos, TNF-α by RT-PCR. The Malva verticillata L. oil had decreased the production of NO (p<0.05) and the mrna level of inos in concentration dose dependent manner. In conclusion, this study have shown here may be of help to understand the action mechanism of the anti-inflammatory and we hope that Malva verticillata L. oil used in skin diseases such as AD. Key words Malva verticillata L., Natural oil, Anti-inflammatory, inos, Nitric Oxide 현재지구상에는약 80,000 여개의화학물질들이상업적으로사용되고있고, 사용량과그수가날로증가하고있는추세이다. 이러한화학물질의사용증가로인해삶의질이많이향상되었으나, 이로인해아토피와같은면역및알레르기성질환관련환자의수가날로증가하고있는실정이다. 이와관련하여화학물질의사용을배제하거나함량을조절하려는움직임이있으나이또한쉽지않은게현실이다. 많은연구자들이면역학적인문제에항히스타민제, 스테로이드제와같은항염관련물질을치료제로사용하고있으나, 반복적으로사용하였을때내성의문제점, 피부의부작용등의문제점들이보고되고있다. 1,2) 면역학적질환들의대부분은어린아이들에게서소양감과건조증등의아토피병변으로발생하는데, 특히심한소양감으로인해병변을반복적으로긁게하여찰상과태선화등의 2 차오염을일으키면서질환을더악화시키게된다. 3) * 교신저자 ( ) : moon@newmedion.com (Tel): 일반적으로아토피질환의원인은 T림프구의면역학적이상이나백혈구의비면역학적이상으로추정되어진다. 4) 면역학적반응으로 T림프구외에대식세포역시관여한다. 대식세포 (macrophage) 는병원체에반응을하여염증반응이일으키는데, Tumor necrotic factor-α (TNF-α), Interleukin-6 (IL-6), Interleukin-1β (IL-1β) 와같은전염증성 cytokine (pro-inflammatory cytokine) 을생성한다. 또는 Inducible nitric oxide synthase (inos) 에의해생성되는 Nitric oxide (NO) 와 Cyclooxygenase-2 (COX-2) 에의해서생성되는 Prostaglandin E 2 (PGE 2 ) 등의염증유발인자들이생성된다. 5-8) LPS에의한자극으로대식세포에서분비되는다량의 TNFα는대식세포와호중구를활성화시켜산화제, 단백질분해효소, IL-1 및 IL-6등을분비하게하며, 혈관내피세포의투과성을증가시켜부종을조장하고항응고작용을일으키는문제점이보고되어있다. 9-13) 최근에많은연구자들이아토피개선의목적으로소양감개선이나염증개선, 부종억제및피부보습등에초점을 23

2 24 Kor. J. Pharmacogn. 맞춰연구를진행하고있다 ) 우선, 피부보습의문제점을해결하기위해히알루론산, 베타-글루칸, 세라마이드및콘드로이친설페이트와같은보습제를이용하거나천연오일을이용하는연구가진행되어왔다. 염증문제를해결하기위해항염효과를갖는천연물과천연오일에대한연구가지속적으로진행되고있다. 특히, 아로마에센셜오일의항염효과에대해많은연구가진행되었는데, 지구상에약 300여종의오일이인체에사용가능한것으로알려져있다. 어떠한천연오일들이효과가있는지구체적인연구가진행되지는못하였다 ) 따라서천연오일에대한연구는피부보습과항염효과를동시에해결할수있기때문에많은관심이집중되고있는실정이다. 한편본연구에사용된동규자 (Malva verticillata L.) 는아욱과에속한 1년생풀인아욱의종자로, 맛이달고찬성질이며단백질과지방이많다. 장을부드럽게하여배변활동에도움을주며모유를잘나오도록하는효능이있다. 20,21) 한방에서동규자는분비나배설을원활하게하는약재로사용한다. 최근의연구에따르면동규자의잎인동규엽에는항염성분이있으며면역기능증강효능및저혈당증해소등에대한효과도보고된바있다. 22,23) 그러나동규자오일에대한연구는전무한실정이다. 본연구에서는동규자를이용하여천연오일을비화학적방법으로추출하여오일 (M.V. oil) 을제조하였고, 이에대한항염효능평가를실시함으로써아토피및피부염의증상완화에도움을주는오일을제시하고자하였다. 재료및방법 실험재료 Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin (PS), phosphate buffered saline (PBS) 는 WelGENE (Daegu, Korea) 에서구입하였고, Ham's Nutrient Mixture F-12 (F- 12), Trypsin-EDTA는 Gibco (BRL, Rockville, MD) 에서구입하였다. Trypan blue는 Sigma chemical Co. (St. Louis, MO) 에서구입하였다. Trizol은 invitrogen (Carlsbad, CA) 에서구입하였으며, dimethyl sulfoxide (DMSO), MeOH, EtOH, chloroform, isopropanol, Agarose, Ethidiumbromide (EtBr), Tris은 DAEJUNG (Gyeonggi-do, Korea) 에서구입하였다. 동규자오일 (M.V. oil) 추출 시료는건조된동규자 ( 아욱의종자, Malva verticillata L.), 500 g을초고압장치 (TFS- 10L, TOYO KOATSU Co., LTD, Tokyo, Japan) 를이용하여최적조건으로선택한 60 o C, 100 MPa의압력을이용하여 24시간동안전처리한후, 착유기 (Oil LOVE, NATIONAL ENG CO., LRD, Seoul, Korea) 로착유하여 400 mesh에여과하였다. 오일의산가변화측정 산가는 AOCS 방법 (AOCS Official Method Cd 3a-63) 을참고하여측정하였다. 21) 유지시료 5ml에 50 ml의유기용매를넣은후충분히용해시키고, 2~3방울의지시약 1% phenolpthalein 용액을첨가하여 0.1 N-KOH 용액으로적정하였다. 엷은분홍색을띄는지점을종말점으로하였다. 세포배양 생쥐대식세포 (mouse macrophage, RAW 264.7) 을사용하였다. RAW cells는 ACTT (Manassas, VA) 에서구매하여 10% FBS가첨가된 DMEM을이용하여배양하였다. 배양된세포는 phosphate buffer saline 완충용액 (0.1 M PBS, ph 7.4) 을이용하여 3회세척하였다. Trypsin- EDTA 를사용하여세포를 culture dish 바닥에서완전히떼어내었다. 10% FBS가첨가된배지 10 ml에세포부유액을약 10 µl를취하여동량의 trypan blue와혼합한후약 10 µl 를취하여 Hemocytometer에 200배의배율로세포수를계수하였다. 세포수는보통 10회를반복하여헤아린다음평균값으로계산하였다. 각세포들은 37 o C, 5% CO 2, full humidity 조건으로배양하였다. MTT assay를이용한세포생존율측정 RAW cells를 cells/well 농도로 96-well plate에접종한후 24시간동안 37 o C 인큐베이터에서안정화시켰다. M.V. oil 을 250 ppm, 125 ppm, 62.5 ppm의농도로각각처리하였다. 3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide (MTT) 시약을이용해세포독성의유무를확인하기위해 24시간뒤에 MTT solution을처리하였다. 2시간뒤에시료를제거한후, DMSO 150 µl를각 well 마다첨가하여형성된 formazan을녹인후 540 nm에서흡광도를측정, 분석하였다. RT-PCR 을이용한염증유전자확인 RAW cells 을 cells/well의농도로 35 mm culture dish에접종하였다. 10 µg/ml의농도로 LPS를처리하고동시에 M.V. oil 를 250 ppm, 125 ppm, 62.5 ppm의농도로처리하였다. 24 시간후에배지를제거하고, Trizol을이용해 RNA isolation 하였다 (the manufacturer s instruction을참고 ). RNA isolation 후충분히건조시키고 diethylpyrocarbonate (DEPC) treated water로 re-dissolve하였다. BioRad iscript cdna Synthesis Kits (Hercules, CA) 를이용해 cdna를합성하였다. Primer 는 NCBI에서확인후 Bioneer (Daejon, Korea) 에서주문제작하였고, Table I에나타내었다. Taq-polymerase (Geneall, Seoul, Korea) 로유전자증폭을실시하였고, denaturation 95 o C, elongation 72 o C에서진행하였다. 생산물은 2% argarose gel에서전기영동하였고, EtBr로염색하여 GelDoc (Vilber lourmat, France and Delta2d, Decodon, Germany) 확인하였다. 자료분석및통계처리 각각의실험은통계를위해서 3번이상수행하였고, Graphpad prism으로통계분석하였다.

Vol. 45, No. 1, 2014 25 Table I. Primer sequence of inflammatory gene Gene Sequence Length Product size (bp) NCBI ID TNF-α forward 3'- TACCTTGTCTACTCCCAGGTTCTCTTC -5' 27 302 NM_013693.

3 reverse 3'- CCAAGACTCTAAATCGGATCTCTCTC -5 26 GAPDH forward 3'- TCAAGCTCATTTCCTGGTATGACA -5' 20 223 NM_008084.

3 Vol. 45, No. 1, Table I. Primer sequence of inflammatory gene Gene Sequence Length Product size (bp) NCBI ID TNF-α forward 3'- TACCTTGTCTACTCCCAGGTTCTCTTC -5' NM_ reverse 3'- AGAGCAATGACTCCAAAGTAGACCTG -5' 26 inos forward 3'- TAGTTTCCAGAAGCAGAATGTGACC -5' NM_ reverse 3'- CCAAGACTCTAAATCGGATCTCTCTC GAPDH forward 3'- TCAAGCTCATTTCCTGGTATGACA -5' NM_ reverse 3'- TGGGTGGTCCAGGGTTTCTTAC -5' 20 결과및고찰 오일의산가변화 오일은열이가해지거나공기에노출또는시간이오래지나면자연스럽게산화된다. 이것을산패 (ranxidity) 라고하는데이는불포화지방산의이중결합이끊어지면서생기는현상으로 alcohol, hyperoxide, free fatty acid, carbonyl 및 thiobarbituric acid 가형성되면서, 불쾌한냄새와맛이난다. 산패된오일의지방성분인 hyperoxide 는생체내에서 DNA 의손상을유발시키며, 노화를촉진하고, 활성산소를발생시켜암이나백혈병, 심장병, 동맥경화, 고혈압이나아토피성피부염을일으키며각종면역계질환의원인이된다. 따라서산가변화는오일의안정도에매우중요한요인이다. 22) 오일의산가변화에대한측정결과 M.V. oil 은 0.03 이하로기존에알려진 olive oil( 산가 1 이하 ) 과비교하였을때매우우수한산가를확인하여안정성이매우뛰어난것을확인할수있었다. 세포독성 MTT assay 를통한 M.V. oil 의농도에따른세포독성을확인한결과최대 250 ppm 농도까지세포독성이일어나지않았음을확인하였다. 이로써 M.V. oil 은세포에매우안전한것으로여겨진다. RT-PCR 을이용한염증사이토카인발현억제효과 외부의요인으로인해염증반응을일으키는면역글로불린외에대식세포역시면역에있어서중요한세포이다. 내독소인 LPS 에의해염증반응을일으키는데이를이용하여세포단계에서항염증실험을실시한다. 생쥐의대식세포인 RAW cells 에내독소인 LPS 를 10 µg/ml 농도로처리하여염증메커니즘을유도시켜염증매개사이토카인인 TNF-α 와 inos 의발현을증가시키고, 각농도의 M.V. oil Fig. 1. Cells cytotoxicity of M.V. oils in RAW cells. The cells were evaluated toxicity of M.V. oil at dependant of concentration. Fig. 2. M.V. oils were evaluated to expressed pro-inflammatory cytokine by RT-PCR. The result were demonstrated expression of pro-inflammatory cytokines with M.V. oil. The images were presented that PCR products were performed gel-electrophoresis (A). The graph was quantified band of inos cytokine expression (B). (*p<0.05, ***p<0.005, compared to LPS)

4 26 Kor. J. Pharmacogn. 억제시켰으며, NO 의발현양을 91.13% 까지억제하는효과를확인할수있었다. M.V. oil 은염증을유발하는다양한사이토카인중 NO 와 inos 을조절하는메커니즘으로항염효과를갖는것을확인할수있었다. 따라서 M.V. oil 은항염효과를갖는천연오일로염증성피부질환에사용할만한소재로여겨진다. 사 사 Fig. 3. M.V. oils were measured NO expression in RAW cells. RAW cells were induced NO contents by LPS. NO contents were evaluated by Greiss agents and measured absorbance at 405 nm. (***p<0.005, compared to LPS) 을처리하여사이토카인이억제되는정도를확인하였다. Fig. 2 에서는 M.V. oil 을각 250 ppm, 125 ppm, 62.5 ppm 의농도로처리하여, 각각 RNA 를추출하여 mrna 수준에서 COX-2, inos, TNF-α 의발현량을 RT-PCR 로비교하였다. 모든실험군은 house keep gene 인 GAPDH 로비교정량한결과동규자의 inos 발현을현저하게억제했음을확인할수있었다. 밴드의정량을수행한결과 250 ppm 농도의 M.V. oil 에서 LPS 에의해서유도된 inos 발현을 control 에비해약 32% 의억제율을확인하였다. 반면염증관련사이토카인인 COX-2 와 TNF-α 의발현량의차이는없었다. M.V. oil 은 COX-2 와 TNF-α 의발현을조절하지는못하나 inos 의발현량을조절함으로염증반응에관여하여항염효능을지니는것으로사료된다. M.V. oil 의 Nitric Oxide 발현억제효과 RAW cells 은 mouse 의대식세포로서내독소인 LPS 의처리후일차적인반응으로 NO 를생성하게된다. NO 를생성함으로써염증의다음반응들이순차적으로일어나게된다. NO 의생성을유도시킨후 M.V. oil 을처리하여 NO 의생성량을측정하였다. Fig. 3 에서 10 µg/ml LPS 만처리하였을때의 NO 의양에비해 M.V. oil 을같이처리하였을때 125 ppm 의농도일때 NO 가최대 91.13% 까지저해효과가있는것으로확인하였다. 결 동규자는아욱의종자로오일에대한효능연구, 특히항염효과에대한연구는전무한실정이다. 본연구에서, M.V. oil 을초고압으로전처리하여착유한것으로 250 ppm 농도까지세포의독성이나타나지않았으며, 염증을유발하는사이토카인중 inos 의발현량을 mrna level 에서약 32% 론 본연구의산업통상자원부의서원대학교친환경바이오소재및식품지역혁신센터 (RIC) 2012 년사업의연구비지원에의해수행되었습니다. 인용문헌 1. Ha, J. S., Jung, H. J., Byun, H. J., Yoon, C. S., Kim, Y. H., Oh, I. B., Lee, J. H. and Ha, K. C. (2011) Evaluation of Atopy and Its Possible Association with Indoor Bioaerosol Concentrations and Other Factors at the Residence of Children. J. Environ Health Sci. 37: Ponvert, C. (2012) Allergic and non-allergic hypersensitivity to non-opioid analgesics, antipyretics and nonsteroidal antiinflammatory drugs in children: epidemiology, clinical aspects, pathophysiology, diagnosis and prevention. Arch. Pediatr. 19: Hunziker, T. (1997) Atopic dermatitis. Schweiz Med Wochenschr. 127: Hanifin, J. M. and Chan, S. (1988) Biochemical and immunologic mechanisms in atopic dermatitis: new targets for emerging therapies. J. Am. Acad. Dermatol. 41: Han, S. and Lee, J. H. (2013) Capillarisin inhibits inos, COX-2 expression, and proinflammatory cytokines in LPSinduced RAW macrophages via the suppression of ERK, JNK, and NF-kappaB activation. Immunopharmacol. Immunotoxicol. 35: Neuman, M. G. and Nanau, R. M. (2011) In vitro anti-inflammatory effects of hyaluronic acid in ethanol-induced damage in skin cells. J. Pharm. Pharm. Sci. 14: Shao, D. Z. and Lin, M. (2008) Platonin inhibits LPS-induced NF-kappaB by preventing activation of Akt and IKKbeta in human PBMC. Inflamm. Res. 57: Song, C. and Zhang, Y. (2013) Acute and subacute IL-1beta administrations differentially modulate neuroimmune and neurotrophic systems: possible implications for neuroprotection and neurodegeneration. J. Neuroinflammation 10: Tsai, M. L. and Lin, C. C. (2011) Antimicrobial, antioxidant, and anti-inflammatory activities of essential oils from five selected herbs. Biosci Biotechnol. Biochem. 75: Yoon, W. J. and Kim, S. S. (2009) Abies koreana essential oil inhibits drug-resistant skin pathogen growth and LPS-

5 Vol. 45, No. 1, induced inflammatory effects of murine macrophage. Lipids 44: Yoon, W. J. and Kim, S. S. (2009) Cryptomeria japonica essential oil inhibits the growth of drug-resistant skin pathogens and LPS-induced nitric oxide and pro-inflammatory cytokine production. Pol. J. Microbiol. 58: Lee, D. H., Sohn, D. S., Cho, D. Y., Kim, Y. Y. and Kim, Y. H. (2010) Anti-inflammatory and Anti-oxidant Effects of Sophora flavescens Root Extraction in Lipopolysaccharideactivated Raw Cells. Kor. J. Med. Mycol. 15: Kwak, J. H. and Kim, I. H. (1974) Studies on the Anti-inflammatory Activity of Caragana chamlagu Roots. Kor. J. Pharmacogn. 5: Umezu, T. (2012) Evaluation of the effects of plant-derived essential oils on central nervous system function using discrete shuttle-type conditioned avoidance response in mice. Phytother. Res. 26: Warnke, P. H. and Becker, S. T. (2009) The battle against multi-resistant strains: Renaissance of antimicrobial essential oils as a promising force to fight hospital-acquired infections. J. Craniomaxillofac. Surg. 37: Lim, H. S., Kim, J. H., Ha, H. K., Seo, C. S. and Shin, H. K. (2012) Comparative Study of the Anti-inflammatory Effects of Menthae Herba from Korea and China. Kor J Pharmacogn. 43: Jaenson, T. G. and Garboui, S. (2006) Repellency of oils of lemon eucalyptus, geranium, and lavender and the mosquito repellent MyggA natural to Ixodes ricinus (Acari: Ixodidae) in the laboratory and field. J. Med. Entomol. 43: Minaiyan, M. and Ghannadi, A. R. (2011) Effects of extract and essential oil of Rosmarinus officinalis L. on TNBSinduced colitis in rats. Res. Pharm. Sci. 6: Szabo, M. A. and Varga, G. Z. (2011) Inhibition of quorumsensing signals by essential oils. Phytother. Res. 24: Choi. J. W., Seong. N. S. and Lee. Y. J.(2006) Effects of Malvae Semen and Abutili Semen on Anti-oxidation Activities. The Korea Journal of Herbology 21: Seo. B. I. (2012) A philological study on poisoning and side effects of Malvae Semen. The Journal of Heahgan Oriental Medical Acidemy 10: Tomoda, M., Asahara, H., Gonda, R. and Takada, K. (1992) Constituents of the seed of Malva verticillata. VIII. Smith degradation of MVS-VI, the major acidic polysaccharide, and anti-complementary activity of products. Chem. Pharm. Bull. 40: Shimizu, N., Asahara, H., Tomoda, M., Gonda, R. and Ohara. N. (1991) Constituents of seed of Malva verticillata. VII. Structural features and reticuloendothelial system-potentiating activity of MVS-I, the major neutral polysaccharide. Chem. Pharm. Bull. 39: A.O.C.S. Cd 3a-63. (1988) Official Methods and Recommended Practicies of the American Oil Chemists' Society, 3rd Edition. 25. Kim, W. S. and Lee, S. J. (2000) Studies on the Electrochemical Properties for Rancidity of Linoleic Acid. Korean J. Food and Nutr. 13: ( 접수 ; 심사 ; 게재확정 )

α α α α α

α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를