생약학회지 Kor. J. Pharmacogn. 45(1) : (2014) Lipopolysaccharide 로유도된 RAW cells 에서동규자오일의항염증효과 오성화 1 최수연 1 이상화 2 김동석 3 박성민 1 * 1 뉴메디온기술연구소, 2 서원
|
|
- 무송 빈
- 4 years ago
- Views:
Transcription
1 생약학회지 Kor. J. Pharmacogn. 45(1) : (2014) Lipopolysaccharide 로유도된 RAW cells 에서동규자오일의항염증효과 오성화 1 최수연 1 이상화 2 김동석 3 박성민 1 * 1 뉴메디온기술연구소, 2 서원대학교친환경바이오소재및식품센터, 3 서원대학교외식산업학과 The Anti-inflammatory Effects of Malva verticillata L. Oil Induced by Lipopolysaccharide with RAW cells Seong-Hwa Oh 1, Soo-Yeon Choi 1, Sang-Hwa Lee 2, Dong-Seok Kim 3 and Sung-Min Park 1 * 1 R&D Center, NewMedion Corporation, Wolgok-Ri, Cheongwon-Gun , Korea 2 Department of Food Service Industry, and Bio Organic Material and Food Center, Seowon University, Cheongju-city , Korea 3 Department of Food Service Industry, Seowon University, Cheongju-city , Korea Abstract Atopic dermatitis (AD) were caused by localized hypersensitivity reaction to an allergen. Therefore, to reduce inflammatory response of AD had been developed that natural extracts and oils with anti-inflammatory activities. This study were investigated that anti-inflammatory effects of Malva verticillata L. oil induced by LPS with RAW cells. We measured to production of NO and expression of COX-2, inos, TNF-α by RT-PCR. The Malva verticillata L. oil had decreased the production of NO (p<0.05) and the mrna level of inos in concentration dose dependent manner. In conclusion, this study have shown here may be of help to understand the action mechanism of the anti-inflammatory and we hope that Malva verticillata L. oil used in skin diseases such as AD. Key words Malva verticillata L., Natural oil, Anti-inflammatory, inos, Nitric Oxide 현재지구상에는약 80,000 여개의화학물질들이상업적으로사용되고있고, 사용량과그수가날로증가하고있는추세이다. 이러한화학물질의사용증가로인해삶의질이많이향상되었으나, 이로인해아토피와같은면역및알레르기성질환관련환자의수가날로증가하고있는실정이다. 이와관련하여화학물질의사용을배제하거나함량을조절하려는움직임이있으나이또한쉽지않은게현실이다. 많은연구자들이면역학적인문제에항히스타민제, 스테로이드제와같은항염관련물질을치료제로사용하고있으나, 반복적으로사용하였을때내성의문제점, 피부의부작용등의문제점들이보고되고있다. 1,2) 면역학적질환들의대부분은어린아이들에게서소양감과건조증등의아토피병변으로발생하는데, 특히심한소양감으로인해병변을반복적으로긁게하여찰상과태선화등의 2 차오염을일으키면서질환을더악화시키게된다. 3) * 교신저자 ( ) : moon@newmedion.com (Tel): 일반적으로아토피질환의원인은 T림프구의면역학적이상이나백혈구의비면역학적이상으로추정되어진다. 4) 면역학적반응으로 T림프구외에대식세포역시관여한다. 대식세포 (macrophage) 는병원체에반응을하여염증반응이일으키는데, Tumor necrotic factor-α (TNF-α), Interleukin-6 (IL-6), Interleukin-1β (IL-1β) 와같은전염증성 cytokine (pro-inflammatory cytokine) 을생성한다. 또는 Inducible nitric oxide synthase (inos) 에의해생성되는 Nitric oxide (NO) 와 Cyclooxygenase-2 (COX-2) 에의해서생성되는 Prostaglandin E 2 (PGE 2 ) 등의염증유발인자들이생성된다. 5-8) LPS에의한자극으로대식세포에서분비되는다량의 TNFα는대식세포와호중구를활성화시켜산화제, 단백질분해효소, IL-1 및 IL-6등을분비하게하며, 혈관내피세포의투과성을증가시켜부종을조장하고항응고작용을일으키는문제점이보고되어있다. 9-13) 최근에많은연구자들이아토피개선의목적으로소양감개선이나염증개선, 부종억제및피부보습등에초점을 23
2 24 Kor. J. Pharmacogn. 맞춰연구를진행하고있다 ) 우선, 피부보습의문제점을해결하기위해히알루론산, 베타-글루칸, 세라마이드및콘드로이친설페이트와같은보습제를이용하거나천연오일을이용하는연구가진행되어왔다. 염증문제를해결하기위해항염효과를갖는천연물과천연오일에대한연구가지속적으로진행되고있다. 특히, 아로마에센셜오일의항염효과에대해많은연구가진행되었는데, 지구상에약 300여종의오일이인체에사용가능한것으로알려져있다. 어떠한천연오일들이효과가있는지구체적인연구가진행되지는못하였다 ) 따라서천연오일에대한연구는피부보습과항염효과를동시에해결할수있기때문에많은관심이집중되고있는실정이다. 한편본연구에사용된동규자 (Malva verticillata L.) 는아욱과에속한 1년생풀인아욱의종자로, 맛이달고찬성질이며단백질과지방이많다. 장을부드럽게하여배변활동에도움을주며모유를잘나오도록하는효능이있다. 20,21) 한방에서동규자는분비나배설을원활하게하는약재로사용한다. 최근의연구에따르면동규자의잎인동규엽에는항염성분이있으며면역기능증강효능및저혈당증해소등에대한효과도보고된바있다. 22,23) 그러나동규자오일에대한연구는전무한실정이다. 본연구에서는동규자를이용하여천연오일을비화학적방법으로추출하여오일 (M.V. oil) 을제조하였고, 이에대한항염효능평가를실시함으로써아토피및피부염의증상완화에도움을주는오일을제시하고자하였다. 재료및방법 실험재료 Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin (PS), phosphate buffered saline (PBS) 는 WelGENE (Daegu, Korea) 에서구입하였고, Ham's Nutrient Mixture F-12 (F- 12), Trypsin-EDTA는 Gibco (BRL, Rockville, MD) 에서구입하였다. Trypan blue는 Sigma chemical Co. (St. Louis, MO) 에서구입하였다. Trizol은 invitrogen (Carlsbad, CA) 에서구입하였으며, dimethyl sulfoxide (DMSO), MeOH, EtOH, chloroform, isopropanol, Agarose, Ethidiumbromide (EtBr), Tris은 DAEJUNG (Gyeonggi-do, Korea) 에서구입하였다. 동규자오일 (M.V. oil) 추출 시료는건조된동규자 ( 아욱의종자, Malva verticillata L.), 500 g을초고압장치 (TFS- 10L, TOYO KOATSU Co., LTD, Tokyo, Japan) 를이용하여최적조건으로선택한 60 o C, 100 MPa의압력을이용하여 24시간동안전처리한후, 착유기 (Oil LOVE, NATIONAL ENG CO., LRD, Seoul, Korea) 로착유하여 400 mesh에여과하였다. 오일의산가변화측정 산가는 AOCS 방법 (AOCS Official Method Cd 3a-63) 을참고하여측정하였다. 21) 유지시료 5ml에 50 ml의유기용매를넣은후충분히용해시키고, 2~3방울의지시약 1% phenolpthalein 용액을첨가하여 0.1 N-KOH 용액으로적정하였다. 엷은분홍색을띄는지점을종말점으로하였다. 세포배양 생쥐대식세포 (mouse macrophage, RAW 264.7) 을사용하였다. RAW cells는 ACTT (Manassas, VA) 에서구매하여 10% FBS가첨가된 DMEM을이용하여배양하였다. 배양된세포는 phosphate buffer saline 완충용액 (0.1 M PBS, ph 7.4) 을이용하여 3회세척하였다. Trypsin- EDTA 를사용하여세포를 culture dish 바닥에서완전히떼어내었다. 10% FBS가첨가된배지 10 ml에세포부유액을약 10 µl를취하여동량의 trypan blue와혼합한후약 10 µl 를취하여 Hemocytometer에 200배의배율로세포수를계수하였다. 세포수는보통 10회를반복하여헤아린다음평균값으로계산하였다. 각세포들은 37 o C, 5% CO 2, full humidity 조건으로배양하였다. MTT assay를이용한세포생존율측정 RAW cells를 cells/well 농도로 96-well plate에접종한후 24시간동안 37 o C 인큐베이터에서안정화시켰다. M.V. oil 을 250 ppm, 125 ppm, 62.5 ppm의농도로각각처리하였다. 3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide (MTT) 시약을이용해세포독성의유무를확인하기위해 24시간뒤에 MTT solution을처리하였다. 2시간뒤에시료를제거한후, DMSO 150 µl를각 well 마다첨가하여형성된 formazan을녹인후 540 nm에서흡광도를측정, 분석하였다. RT-PCR 을이용한염증유전자확인 RAW cells 을 cells/well의농도로 35 mm culture dish에접종하였다. 10 µg/ml의농도로 LPS를처리하고동시에 M.V. oil 를 250 ppm, 125 ppm, 62.5 ppm의농도로처리하였다. 24 시간후에배지를제거하고, Trizol을이용해 RNA isolation 하였다 (the manufacturer s instruction을참고 ). RNA isolation 후충분히건조시키고 diethylpyrocarbonate (DEPC) treated water로 re-dissolve하였다. BioRad iscript cdna Synthesis Kits (Hercules, CA) 를이용해 cdna를합성하였다. Primer 는 NCBI에서확인후 Bioneer (Daejon, Korea) 에서주문제작하였고, Table I에나타내었다. Taq-polymerase (Geneall, Seoul, Korea) 로유전자증폭을실시하였고, denaturation 95 o C, elongation 72 o C에서진행하였다. 생산물은 2% argarose gel에서전기영동하였고, EtBr로염색하여 GelDoc (Vilber lourmat, France and Delta2d, Decodon, Germany) 확인하였다. 자료분석및통계처리 각각의실험은통계를위해서 3번이상수행하였고, Graphpad prism으로통계분석하였다.
3 Vol. 45, No. 1, Table I. Primer sequence of inflammatory gene Gene Sequence Length Product size (bp) NCBI ID TNF-α forward 3'- TACCTTGTCTACTCCCAGGTTCTCTTC -5' NM_ reverse 3'- AGAGCAATGACTCCAAAGTAGACCTG -5' 26 inos forward 3'- TAGTTTCCAGAAGCAGAATGTGACC -5' NM_ reverse 3'- CCAAGACTCTAAATCGGATCTCTCTC GAPDH forward 3'- TCAAGCTCATTTCCTGGTATGACA -5' NM_ reverse 3'- TGGGTGGTCCAGGGTTTCTTAC -5' 20 결과및고찰 오일의산가변화 오일은열이가해지거나공기에노출또는시간이오래지나면자연스럽게산화된다. 이것을산패 (ranxidity) 라고하는데이는불포화지방산의이중결합이끊어지면서생기는현상으로 alcohol, hyperoxide, free fatty acid, carbonyl 및 thiobarbituric acid 가형성되면서, 불쾌한냄새와맛이난다. 산패된오일의지방성분인 hyperoxide 는생체내에서 DNA 의손상을유발시키며, 노화를촉진하고, 활성산소를발생시켜암이나백혈병, 심장병, 동맥경화, 고혈압이나아토피성피부염을일으키며각종면역계질환의원인이된다. 따라서산가변화는오일의안정도에매우중요한요인이다. 22) 오일의산가변화에대한측정결과 M.V. oil 은 0.03 이하로기존에알려진 olive oil( 산가 1 이하 ) 과비교하였을때매우우수한산가를확인하여안정성이매우뛰어난것을확인할수있었다. 세포독성 MTT assay 를통한 M.V. oil 의농도에따른세포독성을확인한결과최대 250 ppm 농도까지세포독성이일어나지않았음을확인하였다. 이로써 M.V. oil 은세포에매우안전한것으로여겨진다. RT-PCR 을이용한염증사이토카인발현억제효과 외부의요인으로인해염증반응을일으키는면역글로불린외에대식세포역시면역에있어서중요한세포이다. 내독소인 LPS 에의해염증반응을일으키는데이를이용하여세포단계에서항염증실험을실시한다. 생쥐의대식세포인 RAW cells 에내독소인 LPS 를 10 µg/ml 농도로처리하여염증메커니즘을유도시켜염증매개사이토카인인 TNF-α 와 inos 의발현을증가시키고, 각농도의 M.V. oil Fig. 1. Cells cytotoxicity of M.V. oils in RAW cells. The cells were evaluated toxicity of M.V. oil at dependant of concentration. Fig. 2. M.V. oils were evaluated to expressed pro-inflammatory cytokine by RT-PCR. The result were demonstrated expression of pro-inflammatory cytokines with M.V. oil. The images were presented that PCR products were performed gel-electrophoresis (A). The graph was quantified band of inos cytokine expression (B). (*p<0.05, ***p<0.005, compared to LPS)
4 26 Kor. J. Pharmacogn. 억제시켰으며, NO 의발현양을 91.13% 까지억제하는효과를확인할수있었다. M.V. oil 은염증을유발하는다양한사이토카인중 NO 와 inos 을조절하는메커니즘으로항염효과를갖는것을확인할수있었다. 따라서 M.V. oil 은항염효과를갖는천연오일로염증성피부질환에사용할만한소재로여겨진다. 사 사 Fig. 3. M.V. oils were measured NO expression in RAW cells. RAW cells were induced NO contents by LPS. NO contents were evaluated by Greiss agents and measured absorbance at 405 nm. (***p<0.005, compared to LPS) 을처리하여사이토카인이억제되는정도를확인하였다. Fig. 2 에서는 M.V. oil 을각 250 ppm, 125 ppm, 62.5 ppm 의농도로처리하여, 각각 RNA 를추출하여 mrna 수준에서 COX-2, inos, TNF-α 의발현량을 RT-PCR 로비교하였다. 모든실험군은 house keep gene 인 GAPDH 로비교정량한결과동규자의 inos 발현을현저하게억제했음을확인할수있었다. 밴드의정량을수행한결과 250 ppm 농도의 M.V. oil 에서 LPS 에의해서유도된 inos 발현을 control 에비해약 32% 의억제율을확인하였다. 반면염증관련사이토카인인 COX-2 와 TNF-α 의발현량의차이는없었다. M.V. oil 은 COX-2 와 TNF-α 의발현을조절하지는못하나 inos 의발현량을조절함으로염증반응에관여하여항염효능을지니는것으로사료된다. M.V. oil 의 Nitric Oxide 발현억제효과 RAW cells 은 mouse 의대식세포로서내독소인 LPS 의처리후일차적인반응으로 NO 를생성하게된다. NO 를생성함으로써염증의다음반응들이순차적으로일어나게된다. NO 의생성을유도시킨후 M.V. oil 을처리하여 NO 의생성량을측정하였다. Fig. 3 에서 10 µg/ml LPS 만처리하였을때의 NO 의양에비해 M.V. oil 을같이처리하였을때 125 ppm 의농도일때 NO 가최대 91.13% 까지저해효과가있는것으로확인하였다. 결 동규자는아욱의종자로오일에대한효능연구, 특히항염효과에대한연구는전무한실정이다. 본연구에서, M.V. oil 을초고압으로전처리하여착유한것으로 250 ppm 농도까지세포의독성이나타나지않았으며, 염증을유발하는사이토카인중 inos 의발현량을 mrna level 에서약 32% 론 본연구의산업통상자원부의서원대학교친환경바이오소재및식품지역혁신센터 (RIC) 2012 년사업의연구비지원에의해수행되었습니다. 인용문헌 1. Ha, J. S., Jung, H. J., Byun, H. J., Yoon, C. S., Kim, Y. H., Oh, I. B., Lee, J. H. and Ha, K. C. (2011) Evaluation of Atopy and Its Possible Association with Indoor Bioaerosol Concentrations and Other Factors at the Residence of Children. J. Environ Health Sci. 37: Ponvert, C. (2012) Allergic and non-allergic hypersensitivity to non-opioid analgesics, antipyretics and nonsteroidal antiinflammatory drugs in children: epidemiology, clinical aspects, pathophysiology, diagnosis and prevention. Arch. Pediatr. 19: Hunziker, T. (1997) Atopic dermatitis. Schweiz Med Wochenschr. 127: Hanifin, J. M. and Chan, S. (1988) Biochemical and immunologic mechanisms in atopic dermatitis: new targets for emerging therapies. J. Am. Acad. Dermatol. 41: Han, S. and Lee, J. H. (2013) Capillarisin inhibits inos, COX-2 expression, and proinflammatory cytokines in LPSinduced RAW macrophages via the suppression of ERK, JNK, and NF-kappaB activation. Immunopharmacol. Immunotoxicol. 35: Neuman, M. G. and Nanau, R. M. (2011) In vitro anti-inflammatory effects of hyaluronic acid in ethanol-induced damage in skin cells. J. Pharm. Pharm. Sci. 14: Shao, D. Z. and Lin, M. (2008) Platonin inhibits LPS-induced NF-kappaB by preventing activation of Akt and IKKbeta in human PBMC. Inflamm. Res. 57: Song, C. and Zhang, Y. (2013) Acute and subacute IL-1beta administrations differentially modulate neuroimmune and neurotrophic systems: possible implications for neuroprotection and neurodegeneration. J. Neuroinflammation 10: Tsai, M. L. and Lin, C. C. (2011) Antimicrobial, antioxidant, and anti-inflammatory activities of essential oils from five selected herbs. Biosci Biotechnol. Biochem. 75: Yoon, W. J. and Kim, S. S. (2009) Abies koreana essential oil inhibits drug-resistant skin pathogen growth and LPS-
5 Vol. 45, No. 1, induced inflammatory effects of murine macrophage. Lipids 44: Yoon, W. J. and Kim, S. S. (2009) Cryptomeria japonica essential oil inhibits the growth of drug-resistant skin pathogens and LPS-induced nitric oxide and pro-inflammatory cytokine production. Pol. J. Microbiol. 58: Lee, D. H., Sohn, D. S., Cho, D. Y., Kim, Y. Y. and Kim, Y. H. (2010) Anti-inflammatory and Anti-oxidant Effects of Sophora flavescens Root Extraction in Lipopolysaccharideactivated Raw Cells. Kor. J. Med. Mycol. 15: Kwak, J. H. and Kim, I. H. (1974) Studies on the Anti-inflammatory Activity of Caragana chamlagu Roots. Kor. J. Pharmacogn. 5: Umezu, T. (2012) Evaluation of the effects of plant-derived essential oils on central nervous system function using discrete shuttle-type conditioned avoidance response in mice. Phytother. Res. 26: Warnke, P. H. and Becker, S. T. (2009) The battle against multi-resistant strains: Renaissance of antimicrobial essential oils as a promising force to fight hospital-acquired infections. J. Craniomaxillofac. Surg. 37: Lim, H. S., Kim, J. H., Ha, H. K., Seo, C. S. and Shin, H. K. (2012) Comparative Study of the Anti-inflammatory Effects of Menthae Herba from Korea and China. Kor J Pharmacogn. 43: Jaenson, T. G. and Garboui, S. (2006) Repellency of oils of lemon eucalyptus, geranium, and lavender and the mosquito repellent MyggA natural to Ixodes ricinus (Acari: Ixodidae) in the laboratory and field. J. Med. Entomol. 43: Minaiyan, M. and Ghannadi, A. R. (2011) Effects of extract and essential oil of Rosmarinus officinalis L. on TNBSinduced colitis in rats. Res. Pharm. Sci. 6: Szabo, M. A. and Varga, G. Z. (2011) Inhibition of quorumsensing signals by essential oils. Phytother. Res. 24: Choi. J. W., Seong. N. S. and Lee. Y. J.(2006) Effects of Malvae Semen and Abutili Semen on Anti-oxidation Activities. The Korea Journal of Herbology 21: Seo. B. I. (2012) A philological study on poisoning and side effects of Malvae Semen. The Journal of Heahgan Oriental Medical Acidemy 10: Tomoda, M., Asahara, H., Gonda, R. and Takada, K. (1992) Constituents of the seed of Malva verticillata. VIII. Smith degradation of MVS-VI, the major acidic polysaccharide, and anti-complementary activity of products. Chem. Pharm. Bull. 40: Shimizu, N., Asahara, H., Tomoda, M., Gonda, R. and Ohara. N. (1991) Constituents of seed of Malva verticillata. VII. Structural features and reticuloendothelial system-potentiating activity of MVS-I, the major neutral polysaccharide. Chem. Pharm. Bull. 39: A.O.C.S. Cd 3a-63. (1988) Official Methods and Recommended Practicies of the American Oil Chemists' Society, 3rd Edition. 25. Kim, W. S. and Lee, S. J. (2000) Studies on the Electrochemical Properties for Rancidity of Linoleic Acid. Korean J. Food and Nutr. 13: ( 접수 ; 심사 ; 게재확정 )
α α α α α
α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를
More informationJournal of Life Science 2011, Vol. 21. No μ μ
Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationuntitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
More informationÀÇÇа�ÁÂc00Ì»óÀÏ˘
Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy
More information012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
More informationγ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
More information139~144 ¿À°ø¾àħ
2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,
More informationStatistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
More information( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information???춍??숏
Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY
More informationLumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
More information(....).hwp
sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial
More information농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다 년 2 월 11 일 - 1 -
농림수산식품부장관귀하 이보고서를 팥의대사성질환개선및기능성규명 에관한연구의최종보고서로제출 합니다. 2013 년 2 월 11 일 - 1 - 연구기관명 : 부산대학교 연구책임자 : 정명호 연구원 : 손용해 연구원 : 장민경 - 2 - Ⅰ. 제목 팥의대사성질환개선및기능성규명 Ⅱ. 연구개발의목적및필요성 팥의대사성질환개선소재발굴과그기능성을과학적으로증명하기위해, 팥의당뇨,
More informationMHC T cell Receptor Antigen Antigen-presenting cell Antigen-reactive T cell CD28 B7 Activation (proliferation Cytokine production Cytotoxicity) Antigen-presenting cell Antigen-reactive T cell Dormant State
More information환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010
11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More information04_이근원_21~27.hwp
1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More informationA Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer
More information01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
More information12이문규
Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental
More informationMicrosoft Word - 04-김택중.doc
J. Exp. Biomed. Sci. 2010, 16(2): 91~95 Anti-inflammatory Properties of Meso-dihydroguaiaretic Acid in Lipopolysaccharide-induced Macrophage Yong-Jae Kim *, Yeo-Jin Kang * and Tack-Joong Kim Division of
More information개최요강
55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]
More information<31382D322D3420BDC5B1D4C8AF5FB3EDB9AE28C3D6C1BEBABB292E687770>
醫 史 學 제18권 제2호(통권 제35호) 2009년 12월 Korean J Med Hist 18ː57 72 18ː173-188 Dec. Dec. 2009 2009 C 大 韓 醫 史 學 會 ISSN ISSN 1225 505X 1225-505X 지방병 연구와 식민지배 : 1927년 영흥 및 해남지역 에메틴 중독사건을 중심으로 신 규 환* 1. 머리말 2. 일제의
More information-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.
1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -
More information율촌 인쇄.xps
플라보노이드리나린배당체의염증제어능탐색 김우기경희대학교식품생명공학과 1. 서론 1.1. 연구배경 만성염증성질환의치료및완화를위하여전통적으로괴곽( 회화나무) 추출물을사용하여왔으나, 그효과물질및작용기작에대한규명은미흡한실정이다. 일부연구에서는플라보노이드류인 리나린(Linarin) 및그배당체가괴곽에다량존재하며다양한생리활성을나타냄이보고되었으나, 항산화능을비롯한일반적플라보노이드류의분석연구에집중되어왔다.
More information경제통상 내지.PS
CONTENTS I 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 II 38 39 40 41 42 43 III 46 47 48 49 50 51 52 53 54 55 56 57 58 59 IV 62 63 64 65 66 67 68 69 V
More information°æÁ¦Åë»ó³»Áö.PDF
CONTENTS I 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 II 38 39 40 41 42 43 III 46 47 48 49 50 51 52 53 54 55 56 57 58 59 IV 62 63 64 65 66 67 68 69 V
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 33(3): 155-160 (2018) http://dx.doi.org/10.7841/ksbbj.2018.33.3.155 ISSN 1225-7117 / eissn 2288-8268 Research Paper 제주산애기수영추출물의항염증효과 양은진 1, 현광희
More information목차 1. 서론 줄기세포의간세포분화능평가시고려사항 간세포분화능평가시험법 분
세포치료제시험정보집 7 줄기세포치료제의 간세포분화능평가시험 2015. 4. 30. 식품의약품안전평가원 차세대줄기세포기반제제평가연구사업단 목차 1. 서론 --------------------------------------------- 1 2. 줄기세포의간세포분화능평가시고려사항 --------------- 2 3. 간세포분화능평가시험법 -----------------------------
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More informationMicrosoft Word - Genolution RNAi Manual.doc
1 Ⅵ. G-Fectin (transfection reagent) RNAi transfection 전용 reagent. Transfection 전 과정 10분 이내 완료. 24시간 후 gene silencing 확인 가능. 우수한 transfection 효율 낮은 toxicity. sirna와 shrna, mirna에 모두 적용 가능. 가격 : 150,000
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information5
26 3 (2005 9 ) J Korean Oriental Med 2005;26(3):55-65 The Effcects of Psoraleae fructus Extract on Melanin Synthesis of B16 Melanoma Cells Jae-Ho Chung, Hyung-Sik Seo Dept. of Ophthamology, Otolaryngology
More information878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu
한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales
More information[00]_목차.hwp
Korean J. Plant Res. 27(5):439-446(2014) http://dx.doi.org/10.7732/kjpr.2014.27.5.439 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article Murine Macrophage RAW 264.7 세포에서구실잣밤나무추출물의항염증효과
More information- 2 -
- 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22
More information232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특
한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province
More informationKorean J. Plant Res. 31(2): (2018) Print ISSN Online ISSN Original Research Artic
Korean J. Plant Res. 31(2):117-123(2018) https://doi.org/10.7732/kjpr.2018.31.2.117 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article 박수빈 1, 송훈민 1,3, 김하나 1, 박광훈 2, 손호준 2, 엄유리 2, 박지애
More information학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici
학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and
More information달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있
대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준
More informationA Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran
More informationJournal of Educational Innovation Research 2017, Vol. 27, No. 2, pp DOI: : Researc
Journal of Educational Innovation Research 2017, Vol. 27, No. 2, pp.251-273 DOI: http://dx.doi.org/10.21024/pnuedi.27.2.201706.251 : 1997 2005 Research Trend Analysis on the Korean Alternative Education
More informationTHE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)
THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method
More informationAnalysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
More information<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>
Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12
More informationisrael-내지-1-4
israel-내지-1-4 1904.1.1 12:49 AM 페이지1 mac2 2015. 11 Contents S T A T E O F I S R A E L 8 Part I Part II Part III Part IV Part V Part VI Part VII Part VIII 9 S T A T E O F I S R A E L 10 Part I Part
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 3, pp DOI: * Strenghening the Cap
Journal of Educational Innovation Research 2018, Vol. 28, No. 3, pp.27-43 DOI: http://dx.doi.org/10.21024/pnuedi.28.3.201809.27 * Strenghening the Capacity of Cultural Arts Required in Special Education
More information( )Kjhps043.hwp
Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,
More information(01) hwp
Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of
More informationAnalyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
More informationKISEP Otology Korean J Otolaryngol 2000;43: 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants
KISEP Otology Korean J Otolaryngol 2000;43:136-42 마우스대식세포주에서항산화제및 Dexamethasone 이유발형산화질소합성효소발현과산화질소생성에미치는효과 강준명 여상원 이흥엽 장기홍 서병도 Effect of Antioxidants and Dexamethasone on inducible Nitric Oxide Synthase
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More informationA 617
Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus
More information?
http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More informationCrt114( ).hwp
cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information<5B313132385D32303039B3E220C1A634B1C720C1A632C8A320B3EDB9AEC1F628C3D6C1BE292E687770>
디지털 영상에서의 자막추출을 이용한 자막 특성 분석에 관한 연구 이세열 * 요약 본 연구는 방송 프로그램 제작에 있어서 중요한 역할을 담당하고 있는 영상 자막의 특성과 영상 커 뮤니케이션 기능적인 관점에서 나타나고 있는 현상을 살펴본다. 다양한 방송 프로그램에서 활용되고 있는 디지털 영상 자막의 기능은 단순하게 간략한 정보를 전달하는 기능적인 역할을 수행하였다.
More informationChapter 26
11 주 RNA 합성 11.1 DNA-dependent synthesis of RNA: Bacteria에서의 transcription l RNA polymerase (5 subunits로구성 : 2α, β, β, σ) l 효소에의한 RNA 합성의특징 - Complementary sequence to template DNA - RNA chain의합성방향 : 5
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More informationRAW264.7 대식세포에서 장대나물 추출물의 Nitric oxide 및 Prostaglandin E 2생성 저해효과 의해 활성화되어, 염증성 사이토카인, nitric oxide (NO)와 prostaglandine 2 (PGE 2 )를 생성함으로써 통증, 부종, 기능
Korean J. Plant Res. 28(5):568-573(2015) http://dx.doi.org/10.7732/kjpr.2015.28.5.568 Print ISSN 1226-3591 Online ISSN 2287-8203 Original Research Article RAW264.7 대식세포에서 장대나물 추출물의 Nitric oxide 및 Prostaglandin
More information16_이주용_155~163.hwp
사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin
More informationAbstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,
More information(
317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More information00....
Fig. 1 2.5%. 51.5%, 46.0%,.. /, Table 1 (U.V.; Ultraviolet 10-400 nm)/ (NIR; Near Infrared 700 nm - 5 µm) ( TiO 2, WO 3, ZnO, CeO, ATO, Sb 2O 3-ZnO, ITO.) (400 nm - 780 nm). /. Fig. 1.. 23 Table 1. / /
More information16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
More information44-4대지.07이영희532~
A Spatial Location Analysis of the First Shops of Foodservice Franchise in Seoul Metropolitan City Younghee Lee* 1 1 (R) 0 16 1 15 64 1 Abstract The foodservice franchise is preferred by the founders who
More information서강대학교 기초과학연구소대학중점연구소 심포지엄기초과학연구소
2012 년도기초과학연구소 대학중점연구소심포지엄 마이크로파센서를이용한 혈당측정연구 일시 : 2012 년 3 월 20 일 ( 화 ) 14:00~17:30 장소 : 서강대학교과학관 1010 호 주최 : 서강대학교기초과학연구소 Contents Program of Symposium 2 Non-invasive in vitro sensing of D-glucose in
More information???? 1
The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More information10 (JLS_150240).hwp
Journal of Life Science 2016 Vol. 26. No. 3. 338~345 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2016.26.3.338 Antioxidant and Anti-inflammatory Effects of Extracts
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More information11¹Ú´ö±Ô
A Review on Promotion of Storytelling Local Cultures - 265 - 2-266 - 3-267 - 4-268 - 5-269 - 6 7-270 - 7-271 - 8-272 - 9-273 - 10-274 - 11-275 - 12-276 - 13-277 - 14-278 - 15-279 - 16 7-280 - 17-281 -
More information±èÇ¥³â
533 Fig. 1. Dead zone. Nine echoes are positioned 2-10 mm below the scan surface with 1 mm distance. All nine echoes are clearly visualized. 534 Fig. 2. Vertical and horizontal measurement. 10 cm distance
More information1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
More information- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α
More information09È«¼®¿µ5~152s
Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information서론 34 2
34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of
More informationDBPIA-NURIMEDIA
Korean Society for Biotechnology and Bioengineering Journal 32(4): 335-341 (2017) http://dx.doi.org/10.7841/ksbbj.2017.32.4.335 ISSN 1225-7117 / eissn 2288-8268 Research Paper 염증성사이토카인의발현억제를통한홍해삼추출물의항염증효과및아토피개선효과
More information전용]
A Study of select the apropos processing mechanical method by the presume of transformation of teeth s surface degree ABSTRACT This study has been tried to select the apropos processing method by the
More information1406-469호-11
THE DAEGU MEDICAL ASSOCIATION NEWS THE DAEGU MEDICAL ASSOCIATION NEWS THE DAEGU MEDICAL ASSOCIATION NEWS THE DAEGU MEDICAL ASSOCIATION NEWS THE DAEGU MEDICAL ASSOCIATION NEWS THE DAEGU MEDICAL ASSOCIATION
More information<30372EC0CCC0AFC1F82E687770>
산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,
More information황지웅
Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic
More information패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer
READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz
More information歯 PDF
* * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More information?덉씠?꾩썐 1
2014 10 04 06 10 2013. 12 2014. 1 2 3 9 10 Contents 12 22 26 04 05 2014. 10 2014. 10 06 07 2014. 10 08 09 052)241-1241 10 11 2014. 10 Medical Column 052)241-1332 12 13 2014. 10 Medical Column 052)241-1250
More information?덉씠?꾩썐 1
2014 08 04 06 12 2013. 12 2014. 1 2 3 3 4 7 7 07 Contents 18 20 28 2014. 08 04 05 06 07 2014. 08 052)241-1231 08 09 2014. 08 052)241-1255 2014. 08 10 11 Medical Column 052)241-1241 12 13 2014. 08 Medical
More information?덉씠?꾩썐 1
2020 The No.1 Hospital in South - East Korea by 2020 1 2 3 2015 04 08 Contents 10 14 30 04 05 2015 2015 06 07 052)241-1344 08 09 2015 Medical Column 10 11 2015 052)241-1250 12 13 2015 052)241-1235 Medical
More information