<312E20BEC6B9CCB3EBBBEA20BCF6BCDBC3BC2DBCB1BBFDB4D4B1B3C1A42E687770>

Size: px

Start display at page:

Download "<312E20BEC6B9CCB3EBBBEA20BCF6BCDBC3BC2DBCB1BBFDB4D4B1B3C1A42E687770>"

여원 남궁
5 years ago
Views:

1 Kor J Oral Maxillofac Pathol 2006 ; 30(1) : 1-8 아미노산수송체 LAT1 RNA interference에의한사람구강편평세포암종 KB 세포의성장억제 김창현, 홍주영, 양준기, 조현우, 김지혜, 홍민기, 신용우, 김도경 * 조선대학교치과대학구강생물학연구소, NURI project ABSTRACT The Effect of RNA Interference of Amino Acid Transporter LAT1 on the Cell Growth in the KB Human Oral Squamous Cell Carcinoma Chang-Hyun Kim, Joo Young Hong, Joon Ki Yang, Hyun Woo Cho, Jihye Kim, Minki Hong, Yong Woo Shin, Do Kyung Kim * Oral Biology Research Institute, NURI project, Chosun University College of Dentistry, Gwangju , Korea Amino acid transporters are essential for the growth and proliferation in all living cells. Among the amino acid transporters, the system L amino acid transporters are the major nutrient transport system responsible for the Na+-independent transport of neutral amino acids including several essential amino acids. The L-type amino acid transporter 1 (LAT1) is over-expressed to support cell growth in malignant tumors. The double stranded RNA-mediated RNA interference (RNAi) analysis can be in a wide variety of eukaryotes to induce the sequence-specific inhibition of gene expression. In this study, we examined the effect of LAT1 short interfering RNA (sirna) on cell growth using sirna of LAT1 in the KB human oral squamous cell carcinoma. In the RT-PCR analysis and western blot analysis, the sirna of LAT1 inhibited expressions of LAT1 mrna and protein. The uptake of [ 14 C]L-leucine was inhibited by sirna of LAT1. In the MTT assay, the sirna of LAT1 inhibited the growth of the KB cells in the time-dependent manner, indicating that the growth inhibition of KB cell by the sirna of LAT1 is induced by the blocking of neutral amino acid transport mediated by LAT1. These results suggest that the transport of neutral amino acids including several essential amino acids into the KB human oral squamous cell carcinoma is mediated mainly by LAT1. Further, the LAT1 would be a new target for the inhibition of cancer cell growth. Key words : LAT1, sirna, KB cells, Anti-cancer therapy I. 서론 살아있는모든세포는성장과분화를위해아미노산을요구한다. 아미노산이세포내의단백질, 효소, 호르몬, 신경전달물질의합성및단백질합성의기질이되는역할을하고 *Correspondence:Do Kyung Kim, Department of Oral Physiology, Chosun University College of Dentistry #375 Seosuk-dong, Dong-gu, Gwangju , Korea, Tel: , kdk@chosun.ac.kr 본논문은교육인적자원부누리사업국고보조금으로수행한과제임 (2005). 있기때문이다. 세포내에서필요한아미노산은세포막에위치하고있는아미노산수송체 (amino acid transporter) 를통해세포내로공급되는데아미노산수송체는그들이수송하는아미노산의특성에따라각각중성, 염기성및산성아미노산수송체로분류된다 1). 아미노산수송계 L은 Na+-비의존적으로중성아미노산을수송하는세포막단백질이다. 또한종양세포를포함한대부분의세포에서중성아미노산의주경로가되는아미노산수송체로알려져있으며 1,2), 상피세포의기저막측에존재하여

2 소장과신세뇨관의상피세포를통한중성아미노산흡수에중요한기능을한다고알려져있다 1) 년 Kanai 등에의해아미노산수송계 L의첫번째아형인 L-type amino acid transporter 1(LAT1) 이 rat C6 glioma 세포에서클로닝되었다 3). LAT1 은세포막을 12회관통하는단백질로서 Na+-비의존적으로 leucine, isoleucine, valine, phenylalanine, tyrosine, methionine, tryptophan 및 histidine 같은구조가큰중성아미노산을수송하는특징을가지고있다 3-5). 또한 LAT1은 4F2 heavy chain(4f2hc) 이라는세포막을 1회관통하는막단백질과 disulfied bond로결합하고있는 heterodimer 형단백질이며, LAT1 이기능을수행하기위해서는보조인자 4F2hc의존재가필수적이라는것이보고되었다 3,4,6-8). 보조인자인 4F2hc가모든정상조직에서발현이되는것과대조적으로 LAT1은뇌, 비장, 태반, 정소등발현하는부위가제한되어있다 3,4). 뿐만아니라 LAT1은악성종양세포에서과발현되며, 종양세포의계속되는성장에중요한역할을한다고보고되었다 3,4,9,10). LAT1 의클로닝후에 LAT1과구조적으로관련이있는아미노산수송계 L의두번째아형인 L-type amino acid transporter 2(LAT2) 가클로닝되었다 11-14). LAT2는구조적으로 LAT1과매우유사하며, Na+- 비의존적으로다수의필수아미노산을포함하는중성아미노산을수송한다. LAT1 이구조가큰중성아미노산만을수송하는특징을보이는반면, LAT2 는구조에관계없이중성아미노산을모두수송하는넓은기질특이성을지니고있다 12-14). 아미노산수송체 LAT1과 LAT2의특성을살펴보면아미노산수송계 L, 특히종양세포에서과발현되는 LAT1의조절을통해종양세포성장억제를위한하나의방법을제시할수있다. 종양세포에서 LAT1의활성을억제하여세포내중성아미노산의고갈을유도한다면종양세포성장억제를유도할수있을것으로사료된다. RNA interference(rnai) 란 short interfering RNA (sirna) 를이용하여특정유전자의발현을억제하는방법으로, 이중가닥 RNA(dsRNA) 가 dicer 에의해절단되어 21~23개의뉴클레오타이드의생성을통한단백질발현의억제를의미한다. 1998년 Andrew 등 15) 이예쁜꼬마선충 (Caenorhabditis elegans) 을이용한실험에서외부의이중가닥 RNA (double-stranded RNA) 를예쁜꼬마선충에게주입했을때, 상보적인세포내부의 mrna 와의간섭을통한단백질합성이억제된다는것을확인하여 RNAi 의존재를최초로증명하였다 16). RNAi 과정은크게 dicer enzyme 에의해긴이중가닥 RNA 를 sirna 로자르는과정과, 잘려진 sirna 가 RNA-induced silencing complex와결합한후세포내상보적인 mrna 에결합하는과정으로이루어진다. 이때 sirna 에의해 mrna 는절단되어특정유전자및단백질의발현이감소되게된다 17-19). 본연구의목적은중성아미노산수송체 LAT1 sirna 를이용한 RNAi 방법을통하여 LAT1 유전자와단백질발현을저해시켜사람구강편평세포암종 KB 세포성장과의상관관계를밝히고자한다. II. 재료및방법 1. 실험재료및세포실험에사용한사람구강편평세포암종 KB 세포는 American Type Culture Collection (ATCC, Rockille, MD, USA) 에서분양받아, 성장배지 (MEM + 5% FBS + 1% NEAA) 하에서배양하였다. Human LAT1 의 RNAi를위한 RNA 단편 (sirna) 은 Proligo(Boulder Location, Colorado, USA) 에주문제작하였고 (Table 1), 세포내로도입을위해 Oligofectamin(Invitrogen Life Technologies, Carlsbad, CA, USA) 을사용하였다. [ 14 C]L-leucine 은 Perkin Elmer Life Science Inc.(Boston, MA, USA) 로부터구입하여사용하였고, 아미노산및기타시약들은 analytical grade 를구입하여사용하였다. Affinity-purified anti-lat1 및 4F2hc는 Kumamoto Immunochemical Laboratory, Transgenic Inc.(Kumamoto, Japan) 로부터제공받아사용하였다 4,21). Oligo Table 1. LAT1 sirna sequence for LAT1 gene silencing LAT1 sense strand sirna LAT1 antisense strand sirna Sequence (5 3) GGAACAUUGUGCUGGCAUUTT AAUGCCAGCACAAUGUUCCTT 2. KB 세포의 seeding과 LAT1 sirna transfection KB 세포를 6 well plate 에 1 X 105cells/well 로 seed하여 8시간배양한후, FBS 가없는배지로바꾸었다. 다시 6 시간을배양하고, LAT1 의발현을저해시킬수있는최소농도인 sirna 60 pm(table 1) 을세포내로도입시켰다 18,22). 3. Total RNA 추출과역전사-중합효소연쇄반응 (RT-PCR) LAT1 sirna를세포내로도입한후, 시간별로 TRI 2

3 REAGENT kit(molecular Research Center, Inc., Ohio, USA) 를이용하여 total RNA 를추출한후, 자외선분광기 (UV spectrometer) 를이용하여 260nm에서흡광도를측정, 추출된 RNA의농도를계산하였다. cdna 를합성하기위하여 5μg의 total RNA 를 reverse-transcriptase(invitrogen Life Technologies, Carlsbad, CA, USA) 와 oligo(dt) primer를이용하여 42 에서 60분간역전사반응을시행하였다. 합성된 cdna 를 GAPDH 및 LAT1의 primer(table 2) 를이용하여중합효소연쇄반응 (PCR) 을시행하였다. PCR 반응조건은 94 에서 10분, 변성 (denaturation) 반응을 94 에서 30초, 결합 (annealing) 반응을 54~55 에서 30초, 중합 (extension) 반응을 72 에서 1분간 30주기를반복하고마지막중합반응은 72 에서 10분간연장하여반응시켰다. Primer 의 Tm 값을고려하여 LAT1의결합반응온도는 5 5, GAPDH 의결합반응온도는 54 로시행하였다. RT-PCR후 1.5% agarose gel 에서전기영동하여각각의 PCR product를확인하였다. 4. Western blot analysis KB 세포에서 LAT1 단백의발현을확인하기위하여 western blotting 방법을이용하였다. KB 세포에 protein lysis buffer(1% NP-40, 50mM Tris-Cl(pH 7.4), 120mM NaCl, 10mM EDTA, 5mM AEBSF, 100mM leupeptin, 2μg / ml aprotinin) 를넣어얼음위에서 10분간반응시킨후, Dounce homogeniger에옮겨 10회 stroke 하여세포를용해시켰다. 세포용해물을 20,000 g에서 10분간원심분리하고, 상층액을회수하여단백질을정량하였다. KB 세포의단백질 30μg을 5μl의 SDS-PAGE sample buffer(60mm Tris-HCl(pH 6.8), 2% SDS, 25% glycerol, 14.4mM 2-mercaptoethanol, 0.1% Bromophenol blue) 에넣고 3 분간 100 에서변성시킨후, SDS-polyacrylamide gel에 2시간전기영동을시행한다음 gel을 XCell IITM Blot Module(Invitrogen Life Technologies, Carlsbad, CA, USA) 에서 1시간동안 PVDF membrane에이동시켰다. Membrane 은 5% fat-free dry milk-pbst buffer(pbs, 0.05% Tween-20) 에서 4 에서 18시간동안 blocking 한후, PBST buffer로 5분간 3회세척하였다. Affinity-purified human anti-lat1 은 5% fat-free dry milk-pbs buffer 에 500배희석하였으며, 이용액에 membrane 을넣어 1시간 30분동안반응시킨후, PBST 용액에서 5분간격으로 3회세척하였다. Membrane 을 horseradish peroxidase conjugated-secondary antibody 용액에넣고상온에서 1시간동안반응시킨후, PBST 용액에서 5분간격으로 3회세척하고 Enhanced chemiluminescence(ecl) detection kit(amersham Life Sciences, Arlington Heights, IL, USA) 를사용하여 X-ray 필름 (Amersham Life Sciences, Arlington Heights, IL, USA) 에감광하였다. 5. Uptake 실험 KB 세포에 LAT1 sirna 를도입한후 LAT1의수송특성을조사하기위해 Kim 등 20) 의방법을이용하여아미노산 uptake 실험을시행하였다. 배양된 KB 세포를수집하여 24 well plate 에 1 X 105cells/well 로 seed 한후, LAT1 sirna 를도입하여각각의시간대별로 uptake를시행하였다. 세포배양 plate의성장배지를제거한뒤, Na+-free uptake 용액 (125mM choline-cl, 4.8mM KCl, 1.3mM CaCl2, 1.2mM MgSO4, 25mM HEPES, 1.2mM KH2PO4, 5.6mM glucose, ph 7.4) 을이용하여 3회세척한후 37 에서 10분간전배양하였다. 그후, 용액을 [ 14 C]L-leucine 이존재하는 uptake 용액으로교체하여 1분배양시켰으며, 반응의정지를위해 4 의같은용액으로 3회세척하였다. 세포를 0.1N NaOH 에녹여세포안으로 uptake 되어진방사능을 liquid scintillation spectrometry 로측정하였으며, 측정된방사능을 pmol/mg protein/min 으로산출하였다. 각결과의재현성을확인하기위하여 2회이상반복실험을시행하여결과를산출하였다. Table 2. Primer sequence for PCR Primer Name Sequence (5 3 ) PCR Product (bp) GAPDH (sense) GAPDH (antisense) LAT1 (sense) LAT1 (antisense) TGCATCCTGCACCACCAACT CGCCTGCTTCACCACCTTCG TTCATCGCAGTACATCGTGG CCCAGGTGATAGTTCCCGAA

4 A A B B Fig. 1. The effect of LAT1 sirna on the expression of LAT1 mrna in KB human oral squamous cell carcinoma. A, Agarose gel electrophoresis of RT- PCR product from KB cells (536 bp ; LAT1, 350 bp ; GAPDH). B, The percentage of LAT1 expression was calculated as a ratio of LAT1 sirna treated cells and untreated control cells. Lane 1:KB cells treated with 0 pm LAT1 sirna for 4 hrs. Lane 2:KB cells treated with 60 pm LAT1 sirna for 4 hrs. Lane 3:KB cells treated with 0 pm LAT1 sirna for 8 hrs. Lane 4:KB cells treated with 60 pm LAT1 sirna for 8 hrs. Lane 5:KB cells treated with 0 pm LAT1 sirna for 12 hrs. Lane 6:KB cells treated with 60 pm LAT1 sirna for 12 hrs. Lane 7:KB cells treated with 0 pm LAT1 sirna for 16 hrs. Lane 8:KB cells treated with 60 pm LAT1 sirna for 16 hrs. 6. MTT assay KB 세포에서 LAT1 sirna 에의한세포성장억제효과를관찰하기위하여 KB 세포에 LAT1 sirna 를도입한후, MTT assay 를시행하였다. 성장배지하에서배양된 KB 세포를수집하여 24 well plate 에 seed(1 103 cells/well) 하고, seeding 24시간후 LAT1 sirna 를도입하여, 각각의시간별로 MTT assay 를시행하였다. MTT assay 는 KB 세포에 MTT 용액을 37 에서 4시간처리한후, MTT 용액을제거하고 0.01N HCl 이함유된 isopropanol 로녹여내어 570nm 에서흡광도를측정하였다. 7. 통계학적검정모든실험성적은 mean±sem 으로나타내었고, 각실험군간의유의성검정은 ANOVA 후에 Student's t-test를하였다. Fig. 2. Time-dependent effect of LAT1 sirna on the expression of LAT1 protein by western blot analysis in KB cells. A Western blot analyses were performed on the membrane fractions prepared from KB cells in the presence of 2-mercaptoethanol using anti-lat1 antibodys. For LAT1, 40 kda -protein band detected. B, The percentage of LAT1 protein expression was calculated as a ratio of LAT1 sirna treated cells and untreated control cells. III. 결과 1. KB 세포에서 LAT1 sirna에의한아미노산수송체 LAT1의발현저해 KB 세포에 LAT1 sirna 를도입한후, LAT1 의발현정도를조사 비교하기위하여각각의 primer(table 2) 를이용하여 RT-PCR analysis 를시행하였으며, 그결과를이미지분석계를이용한 video-based densitometry 방법으로발현정도를수치로변환시켰다 (Fig. 1). KB 세포에 LAT1 sirna 도입 8시간부터 LAT1의 mrna 발현이현저하게감소하는것을관찰할수있었으며, 12시간에는 LAT1 mrna 발현이완전하게억제되는것을관찰할수있었다 (Fig. 1). 16시간이후에서는 LAT1 mrna 발현이되고있는것을확인할수있었으며, 이는 LAT1 sirna 단편들이소진되어더이상기능을하지못한결과라사료된다. 4

5 Fig. 3. The time-dependent inhibition of [ 14 C]L -leucine uptake by LAT1 sirna in KB cell. The [ 14 C]L-leucine uptake (10 μm) was measured for 1 min in the Na+-free uptake solution in the presence of LAT1 sirna 60 pm and expressed as a percentage of control L-leucine uptake in the absence of LAT1 sirna. Each data point represents the mean±sem for five experiments. **p<0.01 vs. control and ***p<0.001 vs. control. KB 세포에 LAT1 sirna 를도입한후, LAT1 단백질발현정도를확인하기위해 western blot analysis 를시행하였다. LAT1 sirna 도입 12시간후부터 LAT1의단백질발현이감소하는것을확인할수있었다 (Fig. 2). 2. KB 세포에서 LAT1 sirna에의한 [14C]L-leucine 수송억제 KB 세포에 LAT1 sirna를도입한후, L-leucine 수송특성을조사하기위하여, [ 14 C] 가표지된 L-leucine(10μM) uptake를 LAT1 sirna 60pM 존재하에서시행하였다. KB 세포내로 LAT1 sirna 를도입한후, 37 에서 [ 14 C] L-leucine 10 μm 이함유된 uptake 용액을이용하여 uptake 를시행한결과, LAT1 sirna 60pM 은 [ 14 C]L-leucine 10μM 의 uptake를시간-의존적으로억제하였다 (Fig. 3). 3. KB 세포에서 LAT1 sirna에의한세포성장억제 KB 세포에서 LAT1 sirna 에의한세포독성효과를조사하기위하여, 각세포에 LAT1 sirna 를도입한후 MTT assay를시행하였다. KB 세포에 4시간부터 16시간까지LAT1 sirna 60pM 을투여한결과, KB 세포의성장억제는 LAT1 sirna 처리시간에의존적임을확인할수있었다 (Fig. 4). LAT1 sirna 처리 8시간군부터통계적인의의및뚜렸한세포성장억제효과를볼수있었다 (Fig. 4). Fig. 4. The effect of LAT1 sirna on viability of KB cells. KB cells treated with 60 pm LAT1 sirna for 4~16 hours. The cell viability was determined by MTT assay. IV. 고찰 본연구에서중성아미노산수송체 LAT1 sirna 의사람구강편평세포암종 KB 세포성장에미치는영향을조사하였다. KB 세포에 LAT1 sirna 를도입한후, RT-PCR 기법을이용하여 LAT1 mrna 의발현을분석한결과, LAT1 의 mrna 발현이저해되는것을볼수있었다 (Fig. 1). Western blot 기법을이용한분석에서도 LAT1 단백질의발현이저해되는것을확인할수있었다 (Fig. 2). 본실험결과는 MDA- MB-231 사람유방암세포에서 RNAi를이용하여암세포이동에관련이있는 Hsp27 mrna의발현이저해되었다는결과 21) 와유사하였다. 따라서 KB 세포에서도중성아미노산수송에중요한 LAT1 mrna 와단백질의발현은 LAT1 sirna 절편에의해저해되었다는것을알수있었다. 한편, RNAi 의영향으로 KB 세포에서 LAT1의발현이억제됨에따라세포내중성아미노산의수송이실제억제되고있는지를확인하기위하여, 실험적으로가장많이사용되는 L-leucine 의 uptake 실험을시행하였다. KB 세포에서 L-leucine uptake는 LAT1 sirna 단편에의해통계적으로유의하게차단되었다 (Fig. 3). 본결과로서 KB 세포에서 LAT1의 sirna 에의해중성아미노산을수송하는 LAT1 단백질의발현이저해되고있다는것을확인할수있었으며, 결론적으로 LAT1의발현이저해되면세포내중성아미노산수송은억제가된다는것을확인할수있었다. RNAi 의영향으로 LAT1 mrna 와단백질의발현저해그 5

6 리고세포내중성아미노산의수송이억제되었다. 이러한세포내변화가세포성장에는어떠한영향을미치는지에대해알아보기위해 MTT assay 를시행하였다. 세포성장억제효과를위한 MTT 분석에서 LAT1 sirna 는시간의존적으로 KB 세포의성장을억제하였다 (Fig. 4). 이는시간과농도의존적으로종양세포의성장을억제시키는항암효과를지닌여러화합물들 ([6]-paradol, norcantharidin, baccatin 등 ) 에서의연구결과22-24) 와일치하는것이다. KB 세포에서는아미노산수송체 LAT1이과발현되며이를통해중성아미노산이수송되어세포성장및증식이이루어진다 26). 그러나 KB 세포에 LAT1 sirna 를도입하면, LAT1 의발현은저해가되고, 세포성장에필수적인필수아미노산을포함하는중성아미노산들의세포내고갈이유도됨으로서 KB 세포성장의억제가유도되는것으로사료된다. 결론적으로, 사람구강편평세포암종 KB 세포에서아미노산수송체 LAT1의발현저해는세포성장에필수적인 L-leucine 등중성아미노산들의세포내고갈을유도함으로서 KB 세포성장의억제를유도하는것으로사료된다. 또한본실험의결과로 LAT1의연구에 KB 세포의유용성의제시및 LAT1 억제제인 LAT1 sirna 를이용하여구강암세포의성장억제에관한또하나의방향을제시할수있을것으로사료된다. V. 결론사람구강편평세포암종 KB 세포에서아미노산수송체 LAT1 sirna 의세포성장억제에미치는효과를밝히기위하여, RT-PCR 분석, western blot 분석, uptake 분석및 MTT 분석을시행하여다음과같은결과를얻었다. 1. KB 세포에서 LAT1 sirna 는 LAT1의 mrna 와단백질의발현을저해하였다. 2. KB 세포에서 LAT1 sirna 는 L-leucine 수송을시간 -의존적으로억제시켰다. 3. KB 세포에서 LAT1 sirna 는세포성장억제를유도하였다. 4. KB 세포에서 LAT1 sirna 는세포성장에필수적인필수아미노산을포함한중성아미노산들의세포내고갈을유도함으로서세포성장억제를유도하였다. 본연구의결과로사람구강편평세포암종 KB 세포에서다 수의필수아미노산을포함한중성아미노산을수송하는 LAT1 의발현저해는 KB 세포성장의억제를유도하는것으로사료된다. 또한본실험의결과로 LAT1 sirna 를이용하여구강암세포의성장억제에관한또하나의방향을제시할수있을것으로사료된다. V. 참고문헌 1. Christensen HN. Role of amino acid transport and countertransport in nutrition and metabolism. Physiol Rev 1990; 70: Silbernagl S. Renal transport of amino acids. Klin Wochenschr. 1979; 57: Kanai Y, Segawa H, Miyamoto K, Uchino H, Takeda E, Endou H. Expression cloning and characterization of a transporter for large neutral amino acids activated by the heavy chain of 4F2 antigen (CD98). J Biol Chem 1998; 273: Yanagida O, Kanai Y, Chairoungdua A, Kim DK, Segawa H, Nii T, Cha SH, Matsuo H, Fukushima J, Fukasawa Y, Tani Y, Taketani Y, Uchino H, Kim JY, Inatomi J, Okayasu I, Miyamoto K, Takeda E, Goya T, Endou H. Human L-type amino acid transporter 1 (LAT1): characterization of function and expression in tumor cell lines. Biochim Biophys Acta 2001; 1514: Uchino H, Kanai Y, Kim do K, Wempe MF, Chairoungdua A, Morimoto E, Anders MW, Endou H. Transport of amino acid-related compounds mediated by L-type amino acid transporter 1 (LAT1): insights into the mechanisms of substrate recognition. Mol Pharmacol 2002; 61: Mastroberardino L, Spindler B, Pfeiffer R, Skelly PJ, Loffing J, Shoemaker CB, Verrey F. Amino-acid transport by heterodimers of 4F2hc/ CD98 and members of a permease family. Nature 1998; 395: Pfeiffer R, Spindler B, Loffing J, Skelly PJ, Shoemaker CB, Verrey F. Functional heterodimeric amino acid transporters lacking cysteine residues involved in disulfide bond. FEBS Lett 6

7 1998; 439: Nakamura E, Sato M, Yang H, Miyagawa F, Harasaki M, Tomita K, Matsuoka S, Noma A, Iwai K, Minato N. 4F2 (CD98) heavy chain is associated covalently with an amino acid transporter and controls intracellular trafficking and membrane topology of 4F2 heterodimer. J Biol Chem 1999; 274: Sang J, Lim YP, Panzica M, Finch P, Thompson NL. TA1, a highly conserved oncofetal complementary DNA from rat hepatoma, encodes an integral membrane protein associated with liver development, carcinogenesis, and cell activation. Cancer Res 1995; 55: Wolf DA, Wang S, Panzica MA, Bassily NH, Thompson NL. Expression of a highly conserved oncofetal gene, TA1/E16, in human colon carcinoma and other primary cancers: homology to Schistosoma mansoni amino acid permease and Caenorhabditis elegans gene products. Cancer Res 1996; 56: Kanai Y, Endou H. heterodimeric amino acid transporters: molecular biology and pharmacological relevance. Curr Drug Metab 2001; 57: Verrey F, Meier C, Rossier G, Kuhn LC. Glycoprotein-associated amino acid exchangers: broadening the range of transport specificity. Pflugers Arch 2000; 440: Pineda M, Fernandez E, Torrents D, Estevez R, Lopez C, Camps M, Lloberas J, Zorzano A, Palacin M. Identification of a membrane protein, LAT-2, that co-expressed with 4F2 heavy chain, an L-type amino acid transport activity with broad specificity for small large zwitterionic amino acids. J Biol Chem 1999; 274: Segawa H, Fukasawa Y, Miyamoto K, Takeda E, Endou H, Kanai Y. Identification and functional characterization of a Na+-independent neutral amino acid transporter with broad substrate selectivity. J Biol Chem 1999; 274: Andrew F, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double strand RNA in Caenorhabditis elegans. Nature 2000; 391: Zamore PO, Tuschl T, Sharp PA, Bartel DP. RNAi Double-stranded RNA directs the ATPase -dependent cleavage of mrna at 21 to 23 nucleotide intervals. Cell 2000; 100: Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates posttranscriptional gene silencing in Drosophila cells. Nature 2000; 404: Bernstein E, Caudy A, Hammond SM, Hannon, GJ. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001; 409: Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Thomas T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2000;411: Kim DK, Kanai Y, Choi HW, Tangtrongsup S, Chairoungdua A, Babu E, Tachampa K. Anzai N, Iribe Y, Endou H. Characterization of the system L amino acid transporter in T24 human bladder carcinoma cells. Biochim Biophys Acta 2002: 1565: Kim DK, Yoon JH, Jeon JE, Lee SH. Expression and functional characterization of neutral amino acid transporter in Hep2 human head and neck squamous cell carcinoma. Int J Oral Biol 2004; 29: Shin KD, Lee MY, Shin DS, Lee SK, Son KH, Koh SH, Pail YK, Kwon BM, Han DC. Blocking tumor cell migration and invasion with biphenyl isoxazole derivative KRIBB3, a synthetic molecule that inhibits Hsp27. Int J Oral Biol 2005; in press. 23. Keum YS, Kim J, Lee KH, Park KK, Su고 YJ, Lee JM, Lee SS, Yoon Jh, Joo SY, Cha IH, Yook JI. Induction of apoptosis and caspase-3 activation by chemorpreventive [6]-paradol and structurally related compounds in KB cells. Cnacer Lett. 2002; 177:

8 24. Miller MC 3rd, Johnson KR, Willingham MC, Fan W. Apoptic cell death induced by baccatin III, a precursor of paclitaxel, may occur without G(2)/ M arrest. cancer cemoyher pharmacol. 1999; 44: Kok SH, Hong CY, Kuo MY, Lee CH, Lee JJ, Lou Iu, et al: Comparison of norcantharidin cytotoxic effects on oral cancer cells and normal buccal keratinocytes. Oral Oncol ;39: Yoon JH, Kim IJ, Kim H, Kim HJ, Jeong MJ, Ahn SG, Kim SA, Lee CH, Choi BK, Kim JK, Jung KY, Lee SU, Kanai Y, Endou H, Kim DK. Amino acid transport system L is differently expressed in human normal oral keratinocytes and humal oral cancer cells. Cancer Lett 2004; 222:

α α α α α

α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를