untitled

Size: px
Start display at page:

Download "untitled"

Transcription

1 J Dent Hyg Sci Vol. 15, No. 2, 2015, pp RESEARCH ARTICLE 치과대학임상시뮬레이션실습실치과용유니트수계의세균오염도조사 윤혜영ㆍ이시영 강릉원주대학교치과대학구강미생물학교실및구강과학연구소 Bacterial Contamination of Dental Unit Water Systems in a Student Clinical Simulation Laboratory of College of Dentistry Hye Young Yoon and Si Young Lee Department of Oral Microbiology, College of Dentistry, Research Institute of Oral Science, Gangneung-Wonju National University, Gangneung , Korea The water supplied from dental unit water systems (DUWS) in dentistry may be heavily contaminated with bacteria and thus may be a potential source of infection for both practice staff and patients. The aim of this study was to evaluate the level of heterotrophic bacteria and to confirm the presence of opportunistic pathogens from DUWS in student clinical simulation laboratory of college of dentistry. Water samples were collected from 36 ultrasonic scalers in student clinical simulation laboratory. The levels of heterotrophic bacteria in water samples were quantified by counting colony forming units (CFUs) on R2A agar media. In addition, opportunistic pathogens were detected by using the polymerase chain reaction (PCR) method. The mean CFUs were 16,095 CFU/ml for water samples and all of water samples exceeded current American Dental Association recommendations of 200 CFU/ml. Pseudomonas species and non-tuberculous Mycobacterium species were detected in the one sample and two samples, respectively, among the 36 water samples by the PCR with specific primers for these bacteria. Our study indicated that DUWS in student clinical simulation laboratory can cause potential infection in students and participants. This study suggested the dental unit water line management and wearing personal protective equipment in student clinical simulation laboratory will be needed to reduce bacterial contamination. Key Words: Biofilms, Dental infection control, Polymerase chain reaction, Water microbiology, Water quality 서론 치과용유니트수계 (dental unit water system, DUWS) 에서는수관 (waterline) 을통하여치과용유니트 (dental chair unit, DCU) 와연결된고속핸드피스, 초음파치석제거기, air-water syringe 등에물을분배한다. DUWS의물은구강소독후세척, 치석제거, 그리고치아절삭등치과치료중다양한용도로사용된다. 치과치료과정에서 DUWS 물은환자의구강에접촉되기때문에음용수와같은수준으로깨 끗해야만한다. 미국질병관리본부 (Center for Disease Control) 에서는치과치료에사용하는물의종속영양세균 (heterotrophic bacteria) 수를음용수와같은기준인 500 colony forming unit ( 세균집락형성단위, CFU)/ml 이하로유지해야함을강조하고있으며 1), 미국치과의사협회 (American Dental Association, ADA) 는 200 CFU/ml 이하로가능한한낮춰야한다고권고하고있다 2). 국내에서는치과치료를위해사용하는물을대상으로종속영양세균수의기준을정하지는않았지만, 환경부에서음용수의일반세균수가 100 Received: March 6, 2015, Revised: March 31, 2015, Accepted: March 31, 2015 ISSN (Print) / ISSN (Online) Correspondence to: Si Young Lee Department of Oral Microbiology, College of Dentistry, Research Institute of Oral Science, Gangneung-Wonju National University, 7 Jukheon-gil, Gangneung , Korea Tel: , Fax: , siyoung@gwnu.ac.kr Copyright 2015 by the Korean Society of Dental Hygiene Science This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 CFU/ml를넘지않을것을제시하고있다. 하지만이전의많은연구결과를보면대부분의치과에서사용하는 DUWS 물이권장하는기준에도달하지못하는것으로밝혀졌다 3-5). Williams 등 3) 의연구에서는 DUWS 물의세균오염도가최대 CFU/ml, Walker 등 6) 의연구에서는최대 CFU/ml, 그리고 Epstein 등 7) 의연구에서는최대 CFU/ml까지다양하게나타났다. 국내에서치과대학병원의 DCU를대상으로진행된 Lee 등 8) 의연구에서는최대 CFU/ml의세균오염도를보여주었고, 이오염도또한국내환경부에서권장하는음용수기준에는적합하지않은것을확인할수있다. 오염된 DUWS의물에는주로병원성이낮은종속영양세균이포함되어있지만, Pseudomonas species, Legionella species, 비결핵성 Mycobacterium species와같은기회감염성병원균도또한분리된다고보고되고있다 1,3,5,9-12). 기회감염성병원균은치과치료중오염된물의접촉이나혹은발생되는에어로졸흡입으로감염될수있으며, 면역력이저하된환자와노인에게는특히위험할수있다 1,13,14). Martin 14) 의연구에서오염된 DUWS의물을통해두명의암환자가 Pseudomonas aeruginosa에감염된사례가보고된바가있고, Oppenheim 등 15) 과 Fotos 등 16) 의연구에서는비치과종사군보다치과종사군에서 Legionella 항체가높고, 임상에서노출된시간이증가할수록 Legionella 감염의위험이증가한다는것을보여주었다. 이러한이유로 DUWS에서공급되는물은치과종사자와환자모두에게잠재적인감염의원인이될수있다 6). DUWS의미생물오염은학생들의임상실습을위해사용되는 DCU에서도일어날수있으며, 실습과정중물이나에어로졸을통해학생들과대상자들이기회감염성병원균에노출될가능성이있다. 하지만현재임상실습을위해사용되는 DCU를대상으로세균오염도를조사한연구를국내나국외에서찾아볼수없다. 본연구의목적은치과대학학생들의임상실습을위해사용되고있는시뮬레이션실의 DCU를대상으로 DCU의초음파치석제거기 (ultrasonic scaler) 에서배출되는물속종속영양세균의수준을평가하고기회감염성병원균인 Pseudomonas species, Legionella species, 비결핵성 Mycobacterium species의존재를분자생물학적방법을사용하여확인하는것이다. 연구대상및방법 1. 시료채취강릉원주대학교치과대학임상실습에사용되는시뮬레 이션실의 DCU 중 36개를대상으로하였다. 36개 DCU에서초음파치석제거기의한달사용빈도를조사하여, 1) 한달동안 1번도사용하지않은 DCU, 2) 1번이상 3번미만으로사용한 DCU, 3) 3번이상사용한 DCU로분류하였다. 각 DCU의초음파치석제거기에서물시료를 1 L씩멸균된유리병에수집하였다 17). 수집전다른세균오염요인을차단하기위해물이나오는입구와손잡이부분을 70% 에탄올로표면소독해주었다 18). 잔류염소를중화시키기위해채취한각시료에 10% sodium thiosulphate (Yakuri Pure Chemicals Co., Ltd, Kyoto, Japan) 용액을 1 ml씩넣어주었다 19). 이렇게채취한시료는바로실험실로옮겨졌다. 2. 세균배양 CFU/ml를조사하기위해시료를 1:1, 1:100으로희석하여 R2A agar 배지 (Becton; Dickinson and Company, Sparks, MD, USA) 에각각 2장씩 spiral plater (IUL, S.A., Barcelona, Spain) 를사용하여도말하였다. 도말한 R2A agar 배지를 24 o C에서 7일동안배양후세균의집락을 colony counter로계수하였다 20). 3. DNA 추출기회병원성세균의존재유무를 polymerase chain reaction (PCR) 방법을이용하여탐색하기위하여수집시료에서다음과같은방법으로전체세균을수집하고세균의 genomic DNA를얻었다. 수집한시료를 0.2 m 여과지 (Millipore, Billerica, MA, USA) 에통과시켜세균을모은후, 여과지를 0.15 mm 유리비드 7개와 1% phosphatebuffered saline 용액 10 ml가담긴멸균된플라스틱튜브에넣어서강하게와류시켰다 17). G-spin Genomic DNA Extraction Kit (Intron Biotechnology Inc., Seongnam, Korea) 를사용하여제조사의방법대로시료에서얻은세균으로부터 genomic DNA를추출하였다. 4. Polymerase chain reaction PCR 반응은 HotStart PCR Premix (Bioneer, Daejeon, Korea) 에추출한 genomic DNA와각세균에대한 forward/ reverse primer를각각넣어최종 20 l를만들어준후, 유전자증폭기 (GeneAMP PCR System 9700; Perkin Elmer, Waltham, MA, USA) 를사용하여증폭시켰다. 모든세균에항상존재하는 universal primer를사용하여추출한 genomic DNA 시료에서세균이제대로분리되고 genomic DNA를얻었는지를확인하였고, 기회감염성병원균인 Pseudomonas species, P. aeruginosa, Legionella species, 233

3 J Dent Hyg Sci Vol. 15, No. 2, 2015 Legionella pneumophila, 및비결핵성 Mycobacterium species의검출을위해각세균의특이적 primer를사용하였다 (Table 1) 21-24). Table 1에기록된방법으로 DNA를증폭한후, PCR 산물을 1.5% agarose gel에 1시간동안전기영동하고 ethidium bromide로염색후 ultraviolet transilluminator (Corebio, Seoul, Korea) 로유전자증폭유무를확인하였다. 5. 통계처리연구에사용된 DCU 에서초음파치석제거기의사용빈도 와 CFU/ml 사이를통계적으로분석하기위해통계프로그램인 IBM SPSS Statistics ver (IBM SPSS Inc., Armonk, NY, USA) 를사용하여일원배치분산분석 (oneway ANOVA) 으로유의성을확인한후, 각군별간의차이를확인하기위해 Scheffe의사후검정을실시하였다. 결과 1. CFU/ml 연구에사용된 DCU 의물시료를도말한모든 R2A agar Table 1. Primers and Polymerase Chain Reaction (PCR) Conditions References Target organism Product size (bp) Sequence (5-3 ) de Lillo et al. 21) Universal 1, AGAGTTTGATCMTGGCTCAG-3 5 -GGYTACCTTGTTACGACTT-3 Spilker et al. 22) Pseudomonas species GACGGGTGAGTAATGCCTA-3 5 -CACTGGTGTTCCTTCCTATA-3 Spilker et al. 22) P. aeruginosa GGGGGATCTTCGGACCTCA-3 5 -TCCTTAGAGTGCCCACCCG-3 Joly et al. 23) Legionella species AGGGTTGATAGGTTAAGAGC-3 5 -CCAACAGCTAGTTGACATCG-3 Joly et al. 23) L. pneumophila GCATTGGTGCCGATTTGG-3 5 -G[CT]TTTGCCATCAAATCTTTCTG AA-3 Briancesco et al. 24) Non-tuberculous Mycobacterium species ACCAACGATGGTGTGTCCAT-3 5 -CTTGTCGAACCGCATACCCT-3 PCR condition 34 cycle (94 o C 30 sec, 55 o C 30 sec, 72 o C 1 min), 25 cycle (94 o C 20 sec, 54 o C 20 sec, 72 o C 40 sec), 25 cycle (94 o C 20 sec, 58 o C 20 sec, 72 o C 40 sec), 95 o C 8 min, 45 cycle (95 o C 10 sec, 57 o C 10 sec, 72 o C 15 sec), 95 o C 8 min, 45 cycle (95 o C 10 sec, 57 o C 10 sec, 72 o C 15 sec), 45 cycle (94 o C 1 min, 64 o C 1 min, 72 o C 1 min), Fig. `1. Heterotrophic bacterial counts (counting colony forming unit, CFU/ml) in water samples of dental unit water system in student clinical simulation laboratory. The values are the means of measurements of CFUs and the error bars indicate standard deviations of the mean. 234

4 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 Fig. 2. Universal primers (A) were used to confirm the presence of bacteria in samples genomic DNA extracted. Detection of Pseudomonas species (spp.) (B) and non-tuberculous Mycobacterium spp. (C) with specific primers. Polymerase chain reaction products were electrophoresed on 1.5% agarose gel and stained with ethidium bromide. 배지에서세균군집을확인하였다. CFU/ml를측정한결과는 Fig. 1에정리하였다. 평균 CFU/ml는 16,095 CFU/ml (standard deviation [SD]=8,921) 로최대 39,920 CFU/ml, 최소 720 CFU/ml로나타났다. 초음파치석제거기를한달동안사용하지않은 DCU, 1 번이상 3번미만사용한 DCU, 3번이상사용한 DCU로나누었을때, 각군의평균 CFU/ml가각각 18,590 CFU/ml (SD=7,720/n=18), 20,070 CFU/ml (SD=9,400/n=8), 8,420 CFU/ml (SD=6,710/n=10) 로나타났다. 3개군의평균 CFU/ml는통계학적으로유의한차이를보였고 (one-way ANOVA, p<0.05), 3번이상사용한 DCU의평균 CFU/ml 가다른두군의평균 CFU/ml보다유의하게낮음을확인하였다 (p<0.05). 2. Polymerase chain reaction 분석 36개의 DCU에서얻은물시료중 1개의시료에서 Pseudomonas species가검출되었고, 2개의시료에서비결핵성 Mycobacterium species가검출되었다 (Fig. 2). Legionella species, L. pneumophila, P. aeruginosa는검출되지않았다 (results not shown). 고찰 연구에사용된 DCU에서수집한모든물시료의세균오염수준은국내환경부, ADA와미국질병관리본부에서권고하는수준을초과하였다. 우리의연구에서평균세균오염수준은 16,095 CFU/ml로, 49,700 CFU/ml의평균세균오염수준을나타낸 Williams 등 3) 의연구와평균 62,900 CFU/ml의세균오염수준을보여준 Epstein 등 7) 의연구결과보다는낮으며, 평균 2,900 CFU/ml의세균오염수준을보여준 Walker 등 6) 의연구결과보다는높았다. 연구에사용된 DCU를초음파치석제거기의사용빈도에따라 3개의군으로분류하였을때, 3개군의평균 CFU/ml는유의한차이를보였고, 사용빈도가가장높은군에서의평균 CFU/ml가유의하게낮았으며사용빈도가세균오염수준에영향을주는것을확인하였다. 다른학교실습실의 DCU도거의비슷한빈도로사용하므로, 세균오염수준또한본실험에서보여준결과와유사할것으로추정된다. DUWS에공급되는물의세균오염수준이낮은것에비해 DUWS에서배출되는물의세균오염수준이높은현상에대한원인으로연구자들은치과용유니트수관 (dental unit waterline, DUWL) 내면에형성된바이오필름을강조하고있다 3,4,25). DUWL과같은수생환경에서흔하게볼수있는바이오필름은수관내부표면에부착하여성장하는세균, 곰팡이, 바이러스등여러종으로이루어진복잡한미생물덩어리이다 26). 좁은구경의 DUWL과진료시간외물의긴정체시간은바이오필름이형성되기좋은환경을만들어준다 27,28). 이렇게형성된바이오필름은 DUWL 속에서미생물의성장이계속되도록도와준다 1,27,29,30). 이때문에바이오필름의형성을억제시키는것이물의미생물오염수준을감소시킬수있는것으로알려졌다. 사용빈도가높은군의세균오염도가낮았던이유는물의잦은사용이 DUWL에형성된바이오필름의성장을억제하는역할을했기때문으로추정된다. 기회감염성병원균중에는 Pseudomonas species, 비결핵성 Mycobacterium species가 36개의 DCU 중각각 1개 (1%) 와 2개 (5%) 의검출률을보였다. 요르단에서 DCU에서배출되는물을수집하여기회감염성병원균의존재를확인한결과, L. pneumophila와 P. aeruginosa의검출률이 86.7% 로높은기회감염성병원균오염수준을보였다 11,12). 또유럽국가들의치과의원 DCU를대상으로조사한연구에서 P. aeruginosa는스페인에서최대 10%, Legionella species와 L. pneumophila는덴마크에서각각 11%, 6%, 그리고 Mycobacterium species는 53% 의검출률을나타냈다 5). 기존연구들과우리연구가세균오염수준이나기회감염성병원균의검출률에서차이를보였다. 기존연구는치과의원에서사용되는 DCU를대상으로하였으나, 우리의연구에서는학생실습에사용되는 DCU를대상으로한것이검출률차이의한가지원인으로추정된다. 또한본실험에사용된 DCU는대형탱크하나에저장된상수도를전체유니트에공급하는시스템이고, 기존연구의대상치과의원에서는 DCU의개별적으로장치된독립적인저수통에물을저장하여사용하는시스템으로물을공급하는체계에서도차이를 235

5 J Dent Hyg Sci Vol. 15, No. 2, 2015 보였다. 하지만, DCU에물이공급되는체계별로세균오염수준을비교한 Walker 등 6) 의연구결과에의하면공급체계에따른세균오염수준은통계적으로유의하지않는것으로나타났다. 기존연구들과우리연구가보여준차이중, 결과에큰영향을미쳤을원인은국가별로상수도를처리하는과정이다르고상수도에포함된염소나다른화학물질들의농도차이로인해공급되는물자체가다르기때문으로추측된다. 그리고각치과별로다른 DUWL의소독주기와방법또한세균오염수준에큰영향을미쳤을것으로추측된다. 국내나국외에서발표된연구중학생실습을위해사용되는 DCU를대상으로세균오염실태를조사한연구가없고국내에는치과의원에서사용되는 DCU의오염도를조사한논문이드물기때문에적절한비교대상이되는논문을찾아볼수없어, 본연구와기존연구의오염수준이차이를보이는정확한원인을파악하기힘들다. 본연구에서실습을위해사용되는 DCU를대상으로연구를진행하였지만, 앞으로치과의원이나치과병원의 DCU를대상으로한여러연구가많이진행되어우리나라의자체적인기준과지침을제정하여야할것으로생각된다. 이러한기준을충족시키기위한근거기반의효율적인소독처리과정에관한폭넓은연구또한필요하며교육과정에서부터 DCU 수관관리를포함한치과감염관리에대한지도가비중있게이루어져야할것으로생각된다. 우리의연구는학생실습에사용되는 DCU도일반치과의원에서사용되는 DCU의오염수준이상의높은수준으로미생물에오염이되어있고, 그중에는기회성병원균도존재함을보여주었다. 본연구의결과는오염된물로인해일어날수있는잠재적감염의방지를위한실습전학생들의보호장비착용과실습후수관관리의필요성을알려준다. 요약 이연구는강릉원주대학교치과대학학생들의임상실습을위해사용되고있는 DCU에서배출되는물속종속영양세균의수준을평가하면서사용빈도에따른세균오염수준의차이를확인하고기회감염성병원균의존재를분자생물학적방법을사용하여확인하였다. 임상실습실에서사용되는 DCU 36개를대상으로초음파치석제거기에서물시료를수집하여평균 CFU/ml를조사하고초음파치석제거기의한달사용빈도에따라 DCU를세집단으로분류하여세균오염수준을비교하였다. 또한수집한물시료에서세균의 genomic DNA를추출한후 PCR 분석을통해기회감염성병원균의존재를확인한결과는다음과같다. 학생실습에 사용한 DCU에서수집한물시료의평균종속영양세균수준은 16,095 CFU/ml로 ADA에서권장하는 200 CFU/ml 이하의수준에적합하지않은것을확인하였다. 초음파치석제거기의한달사용빈도에따라 3집단으로나누어 CFU/ml 를조사하였을때, 초음파치석제거기를한달에 1번이상 3 번미만사용한 DCU에서평균 CFU/ml가 20,070 CFU/ml 로가장높게나타났으며, 3번이상사용한유니트는 CFU/ml 평균이 8,420 CFU/ml로가장적게나타났다. 3개군의 CFU/ml 차이는통계학적으로유의성이있는것을보여주었고 (p<0.05), 그중사용빈도가가장높은군에서유의하게낮은 CFU/ml를보여주었다. 치과에서사용하는 DCU에존재하는기회감염성병원균이학생실습에사용하는 DCU에서도분리되었다. 36개의 genomic DNA 시료중 1개의시료에서 Pseudomonas species가검출되었고, 2개의시료에서비결핵성 Mycobacterium species가검출되었다. 따라서학생실습용으로사용되는 DCU는학생들과대상자에게잠재적감염의원인이될수있으며, 실습전학생들의보호장비착용과실습후수관관리가필요하다. References 1. Kohn WG, Harte JA, Malvitz DM, et al.: Guidelines for infection control in dental health care settings J Am Dent Assoc 135: 33-47, Shearer BG: Biofilm and the dental office. J Am Dent Assoc 127: , Williams JF, Johnston AM, Johnson B, Huntington MK, Mackenzie CD: Microbial contamination of dental unit waterlines: Prevalence, intensity and microbiological characteristics. J Am Dent Assoc 124: 59-65, Uzel A, Cogulu D, Oncag O: Microbiological evaluation and antibiotic susceptibility of dental unit water systems in general dental practice. Int J Dent Hyg 6: 43-47, Walker JT, Bradshaw DJ, Finney M, et al.: Microbiological evaluation of dental unit water systems in general dental practice in europe. Eur J Oral Sci 112: , Walker JT, Bradshaw DJ, Bennett AM, Fulford MR, Martin MV, Marsh PD: Microbial biofilm formation and contamination of dental-unit water systems in general dental practice. Appl Environ Microbiol 66: , Epstein JB, Dawson JR, Buivids IA, Wong B, Le ND: The effect of a disinfectant/coolant irrigant on microbes isolated from dental unit water lines. Spec Care Dentist 22: , 236

6 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 Lee BM, Kim CW, Kim YS: A study on the microbial contamination of dental unit and ultrasonic scaler. J Korean Acad Prosthodont 36: 64-80, Schulze-Robbecke R, Feldmann C, Fischeder R, Janning B, Exner M, Wahl G: Dental units: an environmental study of sources of potentially pathogenic mycobacteria. Tuber Lung Dis 76: , Porteous NB, Redding SW, Jorgensen JH: Isolation of non-tuberculosis mycobacteria in treated dental unit waterlines. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 98: 40-44, Ma'ayeh SY, Al-Hiyasat AS, Hindiyeh MY, Khader YS: Legionella pneumophila contamination of a dental unit water line system in a dental teaching centre. Int J Dent Hyg 6: 48-55, Al-Hiyasat AS, Ma'ayeh SY, Hindiyeh MY, Khader YS: The presence of Pseudomonas aeruginosa in the dental unit waterline systems of teaching clinics. Int J Dent Hyg 5: 36-44, Dutil S, Veillette M, Meriaux A, Lazure L, Barbeau J, Duchaine C: Aerosolization of mycobacteria and legionellae during dental treatment: Low exposure despite dental unit contamination. Environ Microbiol 9: , Martin MV: The significance of the bacterial contamination of dental unit water systems. Br Dent J 163: , Oppenheim BA, Sefton AM, Gill ON, et al.: Widespread Legionella pneumophila contamination of dental stations in a dental school without apparent human infection. Epidemiol Infect 99: , Fotos PG, Westfall HN, Snyder IS, Miller RW, Mutchler BM: Prevalence of legionella-specific IgG and IgM antibody in a dental clinic population. J Dent Res 64: , Dallolio L, Scuderi A, Rini MS, et al.: Effect of different disinfection protocols on microbial and biofilm contamination of dental unit waterlines in community dental practices. Int J Environ Res Public Health 11: , Lin SM, Svoboda KK, Giletto A, Seibert J, Puttaiah R: Effects of hydrogen peroxide on dental unit biofilms and treatment water contamination. Eur J Dent 5: 47-59, Rice EW, Baird RB, Eaton AD, Clesceri LS: Standard methods for the examination of water and wastewater. 22ed. American Public Health Association, Washington DC, Karpay RI, Plamondon TJ, Mills SE: Comparison of methods to enumerate bacteria in dental unit water lines. Curr Microbiol 38: , de Lillo A, Ashley FP, Palmer RM, et al.: Novel subgingival bacterial phylotypes detected using multiple universal polymerase chain reaction primer sets. Oral Microbiol Immunol 21: 61-68, Spilker T, Coenye T, Vandamme P, LiPuma JJ: PCR-based assay for differentiation of Pseudomonas aeruginosa from other pseudomonas species recovered from cystic fibrosis patients. J Clin Microbiol 42: , Joly P, Falconnet PA, Andre J, et al.: Quantitative real-time legionella PCR for environmental water samples: Data interpretation. Appl Environ Microbiol 72: , Briancesco R, Semproni M, Della Libera S, Sdanganelli M, Bonadonna L: Non-tuberculous mycobacteria and microbial populations in drinking water distribution systems. Ann Ist Super Sanita 46: , Williams HN, Baer ML, Kelley JI: Contribution of biofilm bacteria to the contamination of the dental unit water supply. J Am Dent Assoc 126: , American Dental Association Council on Scientific Affairs: Dental unit water lines: approaching the year J Am Dent Assoc 130: , Coleman DC, O'Donnell MJ, Shore AC, Russell RJ: Biofilm problems in dental unit water systems and its practical control. J Appl Microbiol 106: , O'Donnell MJ, Boyle MA, Russell RJ, Coleman DC: Management of dental unit waterline biofilms in the 21st century. Future Microbiol 6: , Walker JT, Marsh PD: Microbial biofilm formation in DUWS and their control using disinfectants. J Dent 35: , Cobb CM, Martel CR, McKnight SA 3rd, Pasley-Mowry C, Ferguson BL, Williams K: How does time-dependent dental unit waterline flushing affect planktonic bacteria levels? J Dent Educ 66: ,

untitled

untitled J Dent Hyg Sci Vol. 15, No. 5, 2015, pp.659-665 http://dx.doi.org/10.17135/jdhs.2015.15.5.659 RESEARCH ARTICLE 치과용유니트수관물빼기 (Flushing) 가세균오염도감소에미치는영향 윤혜영ㆍ이시영 강릉원주대학교치과대학구강미생물학교실, 구강과학연구소 Effects of Flushing

More information

2) 소독제 본 연구에 사용한 소독제는 78% ethanol 스펀지와 1 : 100 으로 희석된 고준위 소독액 중 하나인 High level disinfectant (New Genn, England)이다. 2. 연구 방법 연구에 사용된 미생물학적 검사법은 식품의약품안전

2) 소독제 본 연구에 사용한 소독제는 78% ethanol 스펀지와 1 : 100 으로 희석된 고준위 소독액 중 하나인 High level disinfectant (New Genn, England)이다. 2. 연구 방법 연구에 사용된 미생물학적 검사법은 식품의약품안전 ISSN (print) 1226-8496 J Korean Acad Pediatr Dent 40(4) 2013 http://dx.doi.org/10.5933/jkapd.2013.40.4.268 The Effectiveness of Clinical Sterilization Methods in Dental Air/water Syringes Seyoung Shin,

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

untitled

untitled J Dent Hyg Sci Vol. 18, No. 2, 2018, pp.69-75 https://doi.org/10.17135/jdhs.2018.18.2.69 RESEARCH ARTICLE 치과용유니트수관에서분리한세균의부착및바이오필름형성능력 윤혜영ㆍ이시영 강릉원주대학교치과대학구강미생물학교실, 구강과학연구소 Adhesion and Biofilm Formation

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 5 : 1031~1039 May. 2015 정보보호 산업의 경제적 파급효과 및 기여도 분석 김방룡 1 홍재표 2* Economic

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re

(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

<31335FB1C7B0E6C7CABFDC2E687770>

<31335FB1C7B0E6C7CABFDC2E687770> 에너지기후변화교육 4(2):203~211(2014) 203 초등학교 교과서 에너지 단원의 탐구활동과 시각자료 기능 분석 사례 연구 신명경 권경필 * 경인교육대학교 Abstract : This study aimed to analyze energy related inquiry activity and visual materials in elementary textbook.

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

- iii - - i - - ii - - iii - 국문요약 종합병원남자간호사가지각하는조직공정성 사회정체성과 조직시민행동과의관계 - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - α α α α - 15 - α α α α α α

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

지난 2009년 11월 애플의 아이폰 출시로 대중화에 접어든 국내 스마트폰의 역사는 4년 만에 ‘1인 1스마트폰 시대’를 눈앞에 두면서 모바일 최강국의 꿈을 실현해 가고 있다

지난 2009년 11월 애플의 아이폰 출시로 대중화에 접어든 국내 스마트폰의 역사는 4년 만에 ‘1인 1스마트폰 시대’를 눈앞에 두면서 모바일 최강국의 꿈을 실현해 가고 있다 : * 30~40.,, 30~40 646.,..,.,.,,,.. * (2014) 30~40. :,, (120-728) 34 Tel : 02-300-0899, E-mail : hyhong@mju.ac.kr 2009 11 4 1 1, (2014) 2014 8 4,000. (, 2012).. (2013) 77.4%, 53.9%. 61.6%, 11.5%, 1% (,

More information

09권오설_ok.hwp

09권오설_ok.hwp (JBE Vol. 19, No. 5, September 2014) (Regular Paper) 19 5, 2014 9 (JBE Vol. 19, No. 5, September 2014) http://dx.doi.org/10.5909/jbe.2014.19.5.656 ISSN 2287-9137 (Online) ISSN 1226-7953 (Print) a) Reduction

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI: (NCS) Method of Con

Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp DOI:   (NCS) Method of Con Journal of Educational Innovation Research 2017, Vol. 27, No. 3, pp.181-212 DOI: http://dx.doi.org/10.21024/pnuedi.27.3.201709.181 (NCS) Method of Constructing and Using the Differentiated National Competency

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: * A Analysis of Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.99-117 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.99 2015 * A Analysis of the Characters and Issues about the 2015 Revised Social

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI: Awareness, Supports

Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp DOI:   Awareness, Supports Journal of Educational Innovation Research 2016, Vol. 26, No. 3, pp.335-363 DOI: http://dx.doi.org/10.21024/pnuedi.26.3.201612.335 Awareness, Supports in Need, and Actual Situation on the Curriculum Reconstruction

More information

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201

.,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;, 1995), () 65, 4 51, (,, ). 33, 4 30, (, 201 4 21.,,,.,,. 1, 2, 3, 4.,,,,,,.,,,,., ( ). 60-66,,,,,.. (Corresponding Author): / / 303 Tel: 063-220-2495/ E-mail: ikkim@jj.ac.kr .,,,,,,.,,,,.,,,,,, (, 2011)..,,, (, 2009)., (, 2000;, 1993;,,, 1994;,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;

,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006; ,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).

More information

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770>

<30345F283439372D353034295F313135375FC0CCB5BFC8F15FB5B5B7CEC5CDB3CEC0C720B0BBB1B8BACE20B0E6B0FCBCB3B0E8B0A120C5CDB3CE20B3BBBACEC1B6B8ED2E687770> J of Korean Tunn Undergr Sp Assoc 15(5)497-504(2013) eissn: 2287-4747 http://dx.doi.org/10.9711/ktaj.2013.15.5.497 pissn: 2233-8292 도로터널의 갱구부 경관설계가 터널 내부조명에 미치는 영향에 관한 연구 이미애 1 ㆍ이동희 2 * 1 아이라이트 대표이사 2

More information

슬라이드 1

슬라이드 1 CJ 2007 CONTENTS 2006 CJ IR Presentation Overview 4 Non-performing Asset Company Profile Vision & Mission 4 4 - & 4-4 - & 4 - - - - ROE / EPS - - DreamWorks Animation Net Asset Value (NAV) Disclaimer IR

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

1..

1.. Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :

More information

- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI: A study on Characte

Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp DOI:   A study on Characte Journal of Educational Innovation Research 2018, Vol. 28, No. 1, pp.381-404 DOI: http://dx.doi.org/10.21024/pnuedi.28.1.201803.381 A study on Characteristics of Action Learning by Analyzing Learners Experiences

More information

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: /

상담학연구,, SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / / Tel: / ,,. 164 -. SPSS 21.0., t,.,,,..,.,.. (Corresponding Author): / / 1 11 404 / Tel: 02-880-7636 / E-mail: dikimedu@snu.ac.kr ...,,, (, 2012),, (,,, 2012a, 2012b;,, 2011;, 2011;,, 2010). (, 2013;, 2012;, ;

More information

(5차 편집).hwp

(5차 편집).hwp (215), 54(1), 17-3 211 STEAM,.. STEAM, STEAM, 5~6 11.,., 5~6...,. (, 21)., 29. (,, 212). 211 STEAM * :, E-mail: njkwon@hanmail.net http://dx.doi.org/1.15812/ter.54.1.2153.17 (215), 54(1), 17-3,. (Arts)

More information

Effects of baseball expertise and stimulus speeds on coincidence-anticipation timing accuracy of batting Jong-Hwa Lee, Seok-Jin Kim, & Seon-Jin Kim* Seoul National University [Purpose] [Methods] [Results]

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부

264 축되어 있으나, 과거의 경우 결측치가 있거나 폐기물 발생 량 집계방법이 용적기준에서 중량기준으로 변경되어 자료 를 활용하는데 제한이 있었다. 또한 1995년부터 쓰레기 종 량제가 도입되어 생활폐기물 발생량이 이를 기점으로 크 게 줄어들었다. 그러므로 1996년부 大 韓 環 境 工 學 會 誌 特 輯 - Special Feature - 263~268. 2008. 인구구조변화에 따른 생활폐기물 발생량 현황 및 전망 서울대학교 보건대학원 Status and Forecast of the Municipal Solid Waste Generation by the Change of Population Structure Sa-rah

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT

More information

A Study on Married Female Immigrants Life Style and Marriage Satisfaction in Terms of Preparing Their Old Age in Chungcheongnam-do Department of Gerontology, Hoseo University Doctoral Student : Hi Ran

More information

박선영무선충전-내지

박선영무선충전-내지 2013 Wireless Charge and NFC Technology Trend and Market Analysis 05 13 19 29 35 45 55 63 67 06 07 08 09 10 11 14 15 16 17 20 21 22 23 24 25 26 27 28 29 30 31 32 33 36 37 38 39 40

More information

°ø±â¾Ð±â±â

°ø±â¾Ð±â±â 20, 30, 40 20, 30, 40 1 2 3 4 5 6 7 8 9 10 3.1 6.3 9.4 12.6 15.7 18.8 22.0 25.1 28.3 31.4 2.4 4.7 7.1 9.4 11.8 14.1 16.5 18.8 21.2 23.6 7.1 14.1 21.2 28.3 35.3 42.4 49.5 56.5 63.6 70.7 5.9 11.9 17.8 23.7

More information

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770>

<C7D1B1B9B1B3C0B0B0B3B9DFBFF85FC7D1B1B9B1B3C0B05F3430B1C733C8A35FC5EBC7D5BABB28C3D6C1BE292DC7A5C1F6C6F7C7D42E687770> 기혼 여성이 사이버대학에서 상담을 전공하면서 겪는 경험 방기연 (고려사이버대학교 상담심리학과 부교수) * 요 약 본 연구는 기혼 여성의 사이버대학 상담전공 학과 입학에서 졸업까지의 경험을 이해하는 것을 목적으로 한 다. 이를 위해 연구참여자 10명을 대상으로 심층면접을 하고, 합의적 질적 분석 방법으로 분석하였다. 입학 전 에 연구참여자들은 고등교육의 기회를

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI: * Suggestions of Ways

Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp DOI:   * Suggestions of Ways Journal of Educational Innovation Research 2019, Vol. 29, No. 1, pp.65-89 DOI: http://dx.doi.org/10.21024/pnuedi.29.1.201903.65 * Suggestions of Ways to Improve Teaching Practicum Based on the Experiences

More information

16(2)-7(p ).fm

16(2)-7(p ).fm w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although

More information

10(3)-12.fm

10(3)-12.fm w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed

More information

untitled

untitled 대한마취과학회지 2008; 55: 190~6 Korean J Anesthesiol Vol. 55, No. 2, August, 2008 임상연구 대한민국의 마취통증의학 임상실습 현황 연세대학교 의과대학 마취통증의학교실 및 마취통증의학연구소 장동진ㆍ안소운ㆍ안지원ㆍ김종훈 The current status of anesthesiology clerkship in Korea

More information

04김호걸(39~50)ok

04김호걸(39~50)ok Journal of Environmental Impact Assessment, Vol. 22, No. 1(2013) pp.39~50 Prediction of Landslides Occurrence Probability under Climate Change using MaxEnt Model Kim, Hogul* Lee, Dong-Kun** Mo, Yongwon*

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>

<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466> 001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043

More information

ISO17025.PDF

ISO17025.PDF ISO/IEC 17025 1999-12-15 1 2 3 4 41 42 43 44, 45 / 46 47 48 49 / 410 411 412 413 414 5 51 52 53 54 / 55 56 57 58 / 59 / 510 A( ) ISO/IEC 17025 ISO 9001:1994 ISO 9002:1994 B( ) 1 11 /, / 12 / 1, 2, 3/ (

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). *

, ( ) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * , 40 12 (2006 6) 1) *.. I. (batch). (production planning). (downstream stage) (stockout).... (endangered). (utilization). * 40, 40 12 (EPQ; economic production quantity). (setup cost) (setup time) Bradley

More information

Microsoft Word - KSR2016S168

Microsoft Word - KSR2016S168 2016 년도 한국철도학회 춘계학술대회 논문집 KSR2016S168 GPR 을 이용한 자갈궤도 파울링층 파악을 위한 실내실험적 접근 Evaluation of Applicability of GPR to Detect Fouled Layer in Ballast Using Laboratory Tests 신지훈 *, 최영태 **, 장승엽 *** Ji-hoon. Shin

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

-06-......,......

-06-......,...... Analysis of the Current Condition of Student Childcare Training in Korea: Student Childcare Training Centers, Guidance Teachers, Student Teachers and Student Childcare Training Fees Department of Childcare

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

<35BFCFBCBA2E687770>

<35BFCFBCBA2E687770> 주요개념 : 컴퓨터음란물 접촉자, 성지식, 성태도 남자중학생의 컴퓨터음란물 접촉자와 비접촉자간의 성지식과 태도의 차이 김 영 혜* 이 화 자** 정 향 미*** 1. 연구의 필요성 한국은 I. 서 론 1960 년대 이후부터 시작된 돌진적 산업화 ( 한 상진, 1996) 로 인하여 경제적 부흥을 이루어 집집마다 TV 수상기를 가질 수 있게 되었고 최근에는 PC보급율

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

Æ÷Àå82š

Æ÷Àå82š Lee, Kyungbae (E-mail : kblee6078@ex.co.kr) Lee, Jaehoon (E-mail : ranian74@ex.co.kr) Sohn, Duecksu (E-mail : mgsds@ex.co.kr) Kwon, Soonmin (E-mail : soonmini2@ex.co.kr) ABSTRACT PURPOSES : The purpose

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특

232 도시행정학보 제25집 제4호 I. 서 론 1. 연구의 배경 및 목적 사회가 다원화될수록 다양성과 복합성의 요소는 증가하게 된다. 도시의 발달은 사회의 다원 화와 밀접하게 관련되어 있기 때문에 현대화된 도시는 경제, 사회, 정치 등이 복합적으로 연 계되어 있어 특 한국도시행정학회 도시행정학보 제25집 제4호 2012. 12 : pp.231~251 생활지향형 요소의 근린주거공간 분포특성 연구: 경기도 시 군을 중심으로* Spatial Distribution of Daily Life-Oriented Features in the Neighborhood: Focused on Municipalities of Gyeonggi Province

More information

main.hwp

main.hwp 열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement

More information

도비라

도비라 광고학연구 : 제24권 5호(2013년) The Korean Journal of Advertising, Vol.24, No.5 (2013). pp.99 116 대학생 광고공모전이 광고업계 취업에 미치는 영향: 대학생과 실무자의 인식 비교를 중심으로 차 유 철 우석대학교 광고이벤트학과 교수, 언론학박사 이 희 복 상지대학교 언론광고학부 교수, 언론학박사* 신

More information

82-01.fm

82-01.fm w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong

More information

¿ÀǼҽº°¡À̵å1 -new

¿ÀǼҽº°¡À̵å1 -new Open Source SW 4 Open Source SW 5 Korea Copyright Commission 8 Open Source SW 9 10 Open Source SW 11 12 Open Source SW 13 14 Open Source SW 15 Korea Copyright Commission 18 Open Source SW 19 20 Open

More information

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability

27 2, * ** 3, 3,. B ,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability 27 2, 71-90. 2009. 3 * ** 3, 3,. B 2003 4 2004 2.,.,,,. 3,.,,,,..,. :,, : 2009/09/03 : 2009/09/21 : 2009/09/30 * ICAD (Institute for Children Ability Development) ** ( : heyjun@gmail.com) 72 한국교육문제연구제

More information

분석결과 Special Edition 녹색건물의 가치산정 및 탄소배출 평가 이슈 서 민간분야의 적극적인 참여 방안의 마련이 필요하다. 또한 우리나라는 녹색건축의 경제성에 대한 검증에 대 한 연구가 미흡한 실정이다. 반면, 미국, 영국, 호주 등은 민간 주도로 녹색건축물

분석결과 Special Edition 녹색건물의 가치산정 및 탄소배출 평가 이슈 서 민간분야의 적극적인 참여 방안의 마련이 필요하다. 또한 우리나라는 녹색건축의 경제성에 대한 검증에 대 한 연구가 미흡한 실정이다. 반면, 미국, 영국, 호주 등은 민간 주도로 녹색건축물 기획특집Ⅱ 1 지속가능성 평가기반 에너지효율등급인증 건축물 가치산정에 관한 연구 지속가능성 평가기반 에너지효율등급인증 건축물 가치산정에 관한 연구 * 유 영 준 부연구위원 한국감정원 녹색건축센터 녹색건축연구단 신 성 은 연구원 한국감정원 녹색건축센터 녹색건축연구단 박 아 름 연구원 한국감정원 녹색건축센터 녹색건축연구단 윤 종 돈 부장 한국감정원 녹색건축센터

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

04-다시_고속철도61~80p

04-다시_고속철도61~80p Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770>

<313630313032C6AFC1FD28B1C7C7F5C1DF292E687770> 양성자가속기연구센터 양성자가속기 개발 및 운영현황 DOI: 10.3938/PhiT.25.001 권혁중 김한성 Development and Operational Status of the Proton Linear Accelerator at the KOMAC Hyeok-Jung KWON and Han-Sung KIM A 100-MeV proton linear accelerator

More information

- 2 -

- 2 - - 1 - - 2 - 전기자동차충전기기술기준 ( 안 ) - 3 - 1 3 1-1 3 1-2 (AC) 26 1-3 (DC) 31 2 37 3 40-4 - 1 14, 10,, 2 3. 1-1 1. (scope) 600 V (IEC 60038) 500 V. (EV : Electric Vehicle) (PHEV : Plug-in Hybrid EV).. 2. (normative

More information