untitled

Size: px

Start display at page:

Download "untitled"

주은 낭
5 years ago
Views:

1 J Dent Hyg Sci Vol. 15, No. 2, 2015, pp RESEARCH ARTICLE 치과대학임상시뮬레이션실습실치과용유니트수계의세균오염도조사 윤혜영ㆍ이시영 강릉원주대학교치과대학구강미생물학교실및구강과학연구소 Bacterial Contamination of Dental Unit Water Systems in a Student Clinical Simulation Laboratory of College of Dentistry Hye Young Yoon and Si Young Lee Department of Oral Microbiology, College of Dentistry, Research Institute of Oral Science, Gangneung-Wonju National University, Gangneung , Korea The water supplied from dental unit water systems (DUWS) in dentistry may be heavily contaminated with bacteria and thus may be a potential source of infection for both practice staff and patients. The aim of this study was to evaluate the level of heterotrophic bacteria and to confirm the presence of opportunistic pathogens from DUWS in student clinical simulation laboratory of college of dentistry. Water samples were collected from 36 ultrasonic scalers in student clinical simulation laboratory. The levels of heterotrophic bacteria in water samples were quantified by counting colony forming units (CFUs) on R2A agar media. In addition, opportunistic pathogens were detected by using the polymerase chain reaction (PCR) method. The mean CFUs were 16,095 CFU/ml for water samples and all of water samples exceeded current American Dental Association recommendations of 200 CFU/ml. Pseudomonas species and non-tuberculous Mycobacterium species were detected in the one sample and two samples, respectively, among the 36 water samples by the PCR with specific primers for these bacteria. Our study indicated that DUWS in student clinical simulation laboratory can cause potential infection in students and participants. This study suggested the dental unit water line management and wearing personal protective equipment in student clinical simulation laboratory will be needed to reduce bacterial contamination. Key Words: Biofilms, Dental infection control, Polymerase chain reaction, Water microbiology, Water quality 서론 치과용유니트수계 (dental unit water system, DUWS) 에서는수관 (waterline) 을통하여치과용유니트 (dental chair unit, DCU) 와연결된고속핸드피스, 초음파치석제거기, air-water syringe 등에물을분배한다. DUWS의물은구강소독후세척, 치석제거, 그리고치아절삭등치과치료중다양한용도로사용된다. 치과치료과정에서 DUWS 물은환자의구강에접촉되기때문에음용수와같은수준으로깨 끗해야만한다. 미국질병관리본부 (Center for Disease Control) 에서는치과치료에사용하는물의종속영양세균 (heterotrophic bacteria) 수를음용수와같은기준인 500 colony forming unit ( 세균집락형성단위, CFU)/ml 이하로유지해야함을강조하고있으며 1), 미국치과의사협회 (American Dental Association, ADA) 는 200 CFU/ml 이하로가능한한낮춰야한다고권고하고있다 2). 국내에서는치과치료를위해사용하는물을대상으로종속영양세균수의기준을정하지는않았지만, 환경부에서음용수의일반세균수가 100 Received: March 6, 2015, Revised: March 31, 2015, Accepted: March 31, 2015 ISSN (Print) / ISSN (Online) Correspondence to: Si Young Lee Department of Oral Microbiology, College of Dentistry, Research Institute of Oral Science, Gangneung-Wonju National University, 7 Jukheon-gil, Gangneung , Korea Tel: , Fax: , siyoung@gwnu.ac.kr Copyright 2015 by the Korean Society of Dental Hygiene Science This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License ( by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

2 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 CFU/ml를넘지않을것을제시하고있다. 하지만이전의많은연구결과를보면대부분의치과에서사용하는 DUWS 물이권장하는기준에도달하지못하는것으로밝혀졌다 3-5). Williams 등 3) 의연구에서는 DUWS 물의세균오염도가최대 CFU/ml, Walker 등 6) 의연구에서는최대 CFU/ml, 그리고 Epstein 등 7) 의연구에서는최대 CFU/ml까지다양하게나타났다. 국내에서치과대학병원의 DCU를대상으로진행된 Lee 등 8) 의연구에서는최대 CFU/ml의세균오염도를보여주었고, 이오염도또한국내환경부에서권장하는음용수기준에는적합하지않은것을확인할수있다. 오염된 DUWS의물에는주로병원성이낮은종속영양세균이포함되어있지만, Pseudomonas species, Legionella species, 비결핵성 Mycobacterium species와같은기회감염성병원균도또한분리된다고보고되고있다 1,3,5,9-12). 기회감염성병원균은치과치료중오염된물의접촉이나혹은발생되는에어로졸흡입으로감염될수있으며, 면역력이저하된환자와노인에게는특히위험할수있다 1,13,14). Martin 14) 의연구에서오염된 DUWS의물을통해두명의암환자가 Pseudomonas aeruginosa에감염된사례가보고된바가있고, Oppenheim 등 15) 과 Fotos 등 16) 의연구에서는비치과종사군보다치과종사군에서 Legionella 항체가높고, 임상에서노출된시간이증가할수록 Legionella 감염의위험이증가한다는것을보여주었다. 이러한이유로 DUWS에서공급되는물은치과종사자와환자모두에게잠재적인감염의원인이될수있다 6). DUWS의미생물오염은학생들의임상실습을위해사용되는 DCU에서도일어날수있으며, 실습과정중물이나에어로졸을통해학생들과대상자들이기회감염성병원균에노출될가능성이있다. 하지만현재임상실습을위해사용되는 DCU를대상으로세균오염도를조사한연구를국내나국외에서찾아볼수없다. 본연구의목적은치과대학학생들의임상실습을위해사용되고있는시뮬레이션실의 DCU를대상으로 DCU의초음파치석제거기 (ultrasonic scaler) 에서배출되는물속종속영양세균의수준을평가하고기회감염성병원균인 Pseudomonas species, Legionella species, 비결핵성 Mycobacterium species의존재를분자생물학적방법을사용하여확인하는것이다. 연구대상및방법 1. 시료채취강릉원주대학교치과대학임상실습에사용되는시뮬레 이션실의 DCU 중 36개를대상으로하였다. 36개 DCU에서초음파치석제거기의한달사용빈도를조사하여, 1) 한달동안 1번도사용하지않은 DCU, 2) 1번이상 3번미만으로사용한 DCU, 3) 3번이상사용한 DCU로분류하였다. 각 DCU의초음파치석제거기에서물시료를 1 L씩멸균된유리병에수집하였다 17). 수집전다른세균오염요인을차단하기위해물이나오는입구와손잡이부분을 70% 에탄올로표면소독해주었다 18). 잔류염소를중화시키기위해채취한각시료에 10% sodium thiosulphate (Yakuri Pure Chemicals Co., Ltd, Kyoto, Japan) 용액을 1 ml씩넣어주었다 19). 이렇게채취한시료는바로실험실로옮겨졌다. 2. 세균배양 CFU/ml를조사하기위해시료를 1:1, 1:100으로희석하여 R2A agar 배지 (Becton; Dickinson and Company, Sparks, MD, USA) 에각각 2장씩 spiral plater (IUL, S.A., Barcelona, Spain) 를사용하여도말하였다. 도말한 R2A agar 배지를 24 o C에서 7일동안배양후세균의집락을 colony counter로계수하였다 20). 3. DNA 추출기회병원성세균의존재유무를 polymerase chain reaction (PCR) 방법을이용하여탐색하기위하여수집시료에서다음과같은방법으로전체세균을수집하고세균의 genomic DNA를얻었다. 수집한시료를 0.2 m 여과지 (Millipore, Billerica, MA, USA) 에통과시켜세균을모은후, 여과지를 0.15 mm 유리비드 7개와 1% phosphatebuffered saline 용액 10 ml가담긴멸균된플라스틱튜브에넣어서강하게와류시켰다 17). G-spin Genomic DNA Extraction Kit (Intron Biotechnology Inc., Seongnam, Korea) 를사용하여제조사의방법대로시료에서얻은세균으로부터 genomic DNA를추출하였다. 4. Polymerase chain reaction PCR 반응은 HotStart PCR Premix (Bioneer, Daejeon, Korea) 에추출한 genomic DNA와각세균에대한 forward/ reverse primer를각각넣어최종 20 l를만들어준후, 유전자증폭기 (GeneAMP PCR System 9700; Perkin Elmer, Waltham, MA, USA) 를사용하여증폭시켰다. 모든세균에항상존재하는 universal primer를사용하여추출한 genomic DNA 시료에서세균이제대로분리되고 genomic DNA를얻었는지를확인하였고, 기회감염성병원균인 Pseudomonas species, P. aeruginosa, Legionella species, 233

3 J Dent Hyg Sci Vol. 15, No. 2, 2015 Legionella pneumophila, 및비결핵성 Mycobacterium species의검출을위해각세균의특이적 primer를사용하였다 (Table 1) 21-24). Table 1에기록된방법으로 DNA를증폭한후, PCR 산물을 1.5% agarose gel에 1시간동안전기영동하고 ethidium bromide로염색후 ultraviolet transilluminator (Corebio, Seoul, Korea) 로유전자증폭유무를확인하였다. 5. 통계처리연구에사용된 DCU 에서초음파치석제거기의사용빈도 와 CFU/ml 사이를통계적으로분석하기위해통계프로그램인 IBM SPSS Statistics ver (IBM SPSS Inc., Armonk, NY, USA) 를사용하여일원배치분산분석 (oneway ANOVA) 으로유의성을확인한후, 각군별간의차이를확인하기위해 Scheffe의사후검정을실시하였다. 결과 1. CFU/ml 연구에사용된 DCU 의물시료를도말한모든 R2A agar Table 1. Primers and Polymerase Chain Reaction (PCR) Conditions References Target organism Product size (bp) Sequence (5-3 ) de Lillo et al. 21) Universal 1, AGAGTTTGATCMTGGCTCAG-3 5 -GGYTACCTTGTTACGACTT-3 Spilker et al. 22) Pseudomonas species GACGGGTGAGTAATGCCTA-3 5 -CACTGGTGTTCCTTCCTATA-3 Spilker et al. 22) P. aeruginosa GGGGGATCTTCGGACCTCA-3 5 -TCCTTAGAGTGCCCACCCG-3 Joly et al. 23) Legionella species AGGGTTGATAGGTTAAGAGC-3 5 -CCAACAGCTAGTTGACATCG-3 Joly et al. 23) L. pneumophila GCATTGGTGCCGATTTGG-3 5 -G[CT]TTTGCCATCAAATCTTTCTG AA-3 Briancesco et al. 24) Non-tuberculous Mycobacterium species ACCAACGATGGTGTGTCCAT-3 5 -CTTGTCGAACCGCATACCCT-3 PCR condition 34 cycle (94 o C 30 sec, 55 o C 30 sec, 72 o C 1 min), 25 cycle (94 o C 20 sec, 54 o C 20 sec, 72 o C 40 sec), 25 cycle (94 o C 20 sec, 58 o C 20 sec, 72 o C 40 sec), 95 o C 8 min, 45 cycle (95 o C 10 sec, 57 o C 10 sec, 72 o C 15 sec), 95 o C 8 min, 45 cycle (95 o C 10 sec, 57 o C 10 sec, 72 o C 15 sec), 45 cycle (94 o C 1 min, 64 o C 1 min, 72 o C 1 min), Fig. `1. Heterotrophic bacterial counts (counting colony forming unit, CFU/ml) in water samples of dental unit water system in student clinical simulation laboratory. The values are the means of measurements of CFUs and the error bars indicate standard deviations of the mean. 234

4 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 Fig. 2. Universal primers (A) were used to confirm the presence of bacteria in samples genomic DNA extracted. Detection of Pseudomonas species (spp.) (B) and non-tuberculous Mycobacterium spp. (C) with specific primers. Polymerase chain reaction products were electrophoresed on 1.5% agarose gel and stained with ethidium bromide. 배지에서세균군집을확인하였다. CFU/ml를측정한결과는 Fig. 1에정리하였다. 평균 CFU/ml는 16,095 CFU/ml (standard deviation [SD]=8,921) 로최대 39,920 CFU/ml, 최소 720 CFU/ml로나타났다. 초음파치석제거기를한달동안사용하지않은 DCU, 1 번이상 3번미만사용한 DCU, 3번이상사용한 DCU로나누었을때, 각군의평균 CFU/ml가각각 18,590 CFU/ml (SD=7,720/n=18), 20,070 CFU/ml (SD=9,400/n=8), 8,420 CFU/ml (SD=6,710/n=10) 로나타났다. 3개군의평균 CFU/ml는통계학적으로유의한차이를보였고 (one-way ANOVA, p<0.05), 3번이상사용한 DCU의평균 CFU/ml 가다른두군의평균 CFU/ml보다유의하게낮음을확인하였다 (p<0.05). 2. Polymerase chain reaction 분석 36개의 DCU에서얻은물시료중 1개의시료에서 Pseudomonas species가검출되었고, 2개의시료에서비결핵성 Mycobacterium species가검출되었다 (Fig. 2). Legionella species, L. pneumophila, P. aeruginosa는검출되지않았다 (results not shown). 고찰 연구에사용된 DCU에서수집한모든물시료의세균오염수준은국내환경부, ADA와미국질병관리본부에서권고하는수준을초과하였다. 우리의연구에서평균세균오염수준은 16,095 CFU/ml로, 49,700 CFU/ml의평균세균오염수준을나타낸 Williams 등 3) 의연구와평균 62,900 CFU/ml의세균오염수준을보여준 Epstein 등 7) 의연구결과보다는낮으며, 평균 2,900 CFU/ml의세균오염수준을보여준 Walker 등 6) 의연구결과보다는높았다. 연구에사용된 DCU를초음파치석제거기의사용빈도에따라 3개의군으로분류하였을때, 3개군의평균 CFU/ml는유의한차이를보였고, 사용빈도가가장높은군에서의평균 CFU/ml가유의하게낮았으며사용빈도가세균오염수준에영향을주는것을확인하였다. 다른학교실습실의 DCU도거의비슷한빈도로사용하므로, 세균오염수준또한본실험에서보여준결과와유사할것으로추정된다. DUWS에공급되는물의세균오염수준이낮은것에비해 DUWS에서배출되는물의세균오염수준이높은현상에대한원인으로연구자들은치과용유니트수관 (dental unit waterline, DUWL) 내면에형성된바이오필름을강조하고있다 3,4,25). DUWL과같은수생환경에서흔하게볼수있는바이오필름은수관내부표면에부착하여성장하는세균, 곰팡이, 바이러스등여러종으로이루어진복잡한미생물덩어리이다 26). 좁은구경의 DUWL과진료시간외물의긴정체시간은바이오필름이형성되기좋은환경을만들어준다 27,28). 이렇게형성된바이오필름은 DUWL 속에서미생물의성장이계속되도록도와준다 1,27,29,30). 이때문에바이오필름의형성을억제시키는것이물의미생물오염수준을감소시킬수있는것으로알려졌다. 사용빈도가높은군의세균오염도가낮았던이유는물의잦은사용이 DUWL에형성된바이오필름의성장을억제하는역할을했기때문으로추정된다. 기회감염성병원균중에는 Pseudomonas species, 비결핵성 Mycobacterium species가 36개의 DCU 중각각 1개 (1%) 와 2개 (5%) 의검출률을보였다. 요르단에서 DCU에서배출되는물을수집하여기회감염성병원균의존재를확인한결과, L. pneumophila와 P. aeruginosa의검출률이 86.7% 로높은기회감염성병원균오염수준을보였다 11,12). 또유럽국가들의치과의원 DCU를대상으로조사한연구에서 P. aeruginosa는스페인에서최대 10%, Legionella species와 L. pneumophila는덴마크에서각각 11%, 6%, 그리고 Mycobacterium species는 53% 의검출률을나타냈다 5). 기존연구들과우리연구가세균오염수준이나기회감염성병원균의검출률에서차이를보였다. 기존연구는치과의원에서사용되는 DCU를대상으로하였으나, 우리의연구에서는학생실습에사용되는 DCU를대상으로한것이검출률차이의한가지원인으로추정된다. 또한본실험에사용된 DCU는대형탱크하나에저장된상수도를전체유니트에공급하는시스템이고, 기존연구의대상치과의원에서는 DCU의개별적으로장치된독립적인저수통에물을저장하여사용하는시스템으로물을공급하는체계에서도차이를 235

5 J Dent Hyg Sci Vol. 15, No. 2, 2015 보였다. 하지만, DCU에물이공급되는체계별로세균오염수준을비교한 Walker 등 6) 의연구결과에의하면공급체계에따른세균오염수준은통계적으로유의하지않는것으로나타났다. 기존연구들과우리연구가보여준차이중, 결과에큰영향을미쳤을원인은국가별로상수도를처리하는과정이다르고상수도에포함된염소나다른화학물질들의농도차이로인해공급되는물자체가다르기때문으로추측된다. 그리고각치과별로다른 DUWL의소독주기와방법또한세균오염수준에큰영향을미쳤을것으로추측된다. 국내나국외에서발표된연구중학생실습을위해사용되는 DCU를대상으로세균오염실태를조사한연구가없고국내에는치과의원에서사용되는 DCU의오염도를조사한논문이드물기때문에적절한비교대상이되는논문을찾아볼수없어, 본연구와기존연구의오염수준이차이를보이는정확한원인을파악하기힘들다. 본연구에서실습을위해사용되는 DCU를대상으로연구를진행하였지만, 앞으로치과의원이나치과병원의 DCU를대상으로한여러연구가많이진행되어우리나라의자체적인기준과지침을제정하여야할것으로생각된다. 이러한기준을충족시키기위한근거기반의효율적인소독처리과정에관한폭넓은연구또한필요하며교육과정에서부터 DCU 수관관리를포함한치과감염관리에대한지도가비중있게이루어져야할것으로생각된다. 우리의연구는학생실습에사용되는 DCU도일반치과의원에서사용되는 DCU의오염수준이상의높은수준으로미생물에오염이되어있고, 그중에는기회성병원균도존재함을보여주었다. 본연구의결과는오염된물로인해일어날수있는잠재적감염의방지를위한실습전학생들의보호장비착용과실습후수관관리의필요성을알려준다. 요약 이연구는강릉원주대학교치과대학학생들의임상실습을위해사용되고있는 DCU에서배출되는물속종속영양세균의수준을평가하면서사용빈도에따른세균오염수준의차이를확인하고기회감염성병원균의존재를분자생물학적방법을사용하여확인하였다. 임상실습실에서사용되는 DCU 36개를대상으로초음파치석제거기에서물시료를수집하여평균 CFU/ml를조사하고초음파치석제거기의한달사용빈도에따라 DCU를세집단으로분류하여세균오염수준을비교하였다. 또한수집한물시료에서세균의 genomic DNA를추출한후 PCR 분석을통해기회감염성병원균의존재를확인한결과는다음과같다. 학생실습에 사용한 DCU에서수집한물시료의평균종속영양세균수준은 16,095 CFU/ml로 ADA에서권장하는 200 CFU/ml 이하의수준에적합하지않은것을확인하였다. 초음파치석제거기의한달사용빈도에따라 3집단으로나누어 CFU/ml 를조사하였을때, 초음파치석제거기를한달에 1번이상 3 번미만사용한 DCU에서평균 CFU/ml가 20,070 CFU/ml 로가장높게나타났으며, 3번이상사용한유니트는 CFU/ml 평균이 8,420 CFU/ml로가장적게나타났다. 3개군의 CFU/ml 차이는통계학적으로유의성이있는것을보여주었고 (p<0.05), 그중사용빈도가가장높은군에서유의하게낮은 CFU/ml를보여주었다. 치과에서사용하는 DCU에존재하는기회감염성병원균이학생실습에사용하는 DCU에서도분리되었다. 36개의 genomic DNA 시료중 1개의시료에서 Pseudomonas species가검출되었고, 2개의시료에서비결핵성 Mycobacterium species가검출되었다. 따라서학생실습용으로사용되는 DCU는학생들과대상자에게잠재적감염의원인이될수있으며, 실습전학생들의보호장비착용과실습후수관관리가필요하다. References 1. Kohn WG, Harte JA, Malvitz DM, et al.: Guidelines for infection control in dental health care settings J Am Dent Assoc 135: 33-47, Shearer BG: Biofilm and the dental office. J Am Dent Assoc 127: , Williams JF, Johnston AM, Johnson B, Huntington MK, Mackenzie CD: Microbial contamination of dental unit waterlines: Prevalence, intensity and microbiological characteristics. J Am Dent Assoc 124: 59-65, Uzel A, Cogulu D, Oncag O: Microbiological evaluation and antibiotic susceptibility of dental unit water systems in general dental practice. Int J Dent Hyg 6: 43-47, Walker JT, Bradshaw DJ, Finney M, et al.: Microbiological evaluation of dental unit water systems in general dental practice in europe. Eur J Oral Sci 112: , Walker JT, Bradshaw DJ, Bennett AM, Fulford MR, Martin MV, Marsh PD: Microbial biofilm formation and contamination of dental-unit water systems in general dental practice. Appl Environ Microbiol 66: , Epstein JB, Dawson JR, Buivids IA, Wong B, Le ND: The effect of a disinfectant/coolant irrigant on microbes isolated from dental unit water lines. Spec Care Dentist 22: , 236

6 윤혜영ㆍ이시영 : 임상시뮬레이션실치과용유니트수계의세균오염도 Lee BM, Kim CW, Kim YS: A study on the microbial contamination of dental unit and ultrasonic scaler. J Korean Acad Prosthodont 36: 64-80, Schulze-Robbecke R, Feldmann C, Fischeder R, Janning B, Exner M, Wahl G: Dental units: an environmental study of sources of potentially pathogenic mycobacteria. Tuber Lung Dis 76: , Porteous NB, Redding SW, Jorgensen JH: Isolation of non-tuberculosis mycobacteria in treated dental unit waterlines. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 98: 40-44, Ma'ayeh SY, Al-Hiyasat AS, Hindiyeh MY, Khader YS: Legionella pneumophila contamination of a dental unit water line system in a dental teaching centre. Int J Dent Hyg 6: 48-55, Al-Hiyasat AS, Ma'ayeh SY, Hindiyeh MY, Khader YS: The presence of Pseudomonas aeruginosa in the dental unit waterline systems of teaching clinics. Int J Dent Hyg 5: 36-44, Dutil S, Veillette M, Meriaux A, Lazure L, Barbeau J, Duchaine C: Aerosolization of mycobacteria and legionellae during dental treatment: Low exposure despite dental unit contamination. Environ Microbiol 9: , Martin MV: The significance of the bacterial contamination of dental unit water systems. Br Dent J 163: , Oppenheim BA, Sefton AM, Gill ON, et al.: Widespread Legionella pneumophila contamination of dental stations in a dental school without apparent human infection. Epidemiol Infect 99: , Fotos PG, Westfall HN, Snyder IS, Miller RW, Mutchler BM: Prevalence of legionella-specific IgG and IgM antibody in a dental clinic population. J Dent Res 64: , Dallolio L, Scuderi A, Rini MS, et al.: Effect of different disinfection protocols on microbial and biofilm contamination of dental unit waterlines in community dental practices. Int J Environ Res Public Health 11: , Lin SM, Svoboda KK, Giletto A, Seibert J, Puttaiah R: Effects of hydrogen peroxide on dental unit biofilms and treatment water contamination. Eur J Dent 5: 47-59, Rice EW, Baird RB, Eaton AD, Clesceri LS: Standard methods for the examination of water and wastewater. 22ed. American Public Health Association, Washington DC, Karpay RI, Plamondon TJ, Mills SE: Comparison of methods to enumerate bacteria in dental unit water lines. Curr Microbiol 38: , de Lillo A, Ashley FP, Palmer RM, et al.: Novel subgingival bacterial phylotypes detected using multiple universal polymerase chain reaction primer sets. Oral Microbiol Immunol 21: 61-68, Spilker T, Coenye T, Vandamme P, LiPuma JJ: PCR-based assay for differentiation of Pseudomonas aeruginosa from other pseudomonas species recovered from cystic fibrosis patients. J Clin Microbiol 42: , Joly P, Falconnet PA, Andre J, et al.: Quantitative real-time legionella PCR for environmental water samples: Data interpretation. Appl Environ Microbiol 72: , Briancesco R, Semproni M, Della Libera S, Sdanganelli M, Bonadonna L: Non-tuberculous mycobacteria and microbial populations in drinking water distribution systems. Ann Ist Super Sanita 46: , Williams HN, Baer ML, Kelley JI: Contribution of biofilm bacteria to the contamination of the dental unit water supply. J Am Dent Assoc 126: , American Dental Association Council on Scientific Affairs: Dental unit water lines: approaching the year J Am Dent Assoc 130: , Coleman DC, O'Donnell MJ, Shore AC, Russell RJ: Biofilm problems in dental unit water systems and its practical control. J Appl Microbiol 106: , O'Donnell MJ, Boyle MA, Russell RJ, Coleman DC: Management of dental unit waterline biofilms in the 21st century. Future Microbiol 6: , Walker JT, Marsh PD: Microbial biofilm formation in DUWS and their control using disinfectants. J Dent 35: , Cobb CM, Martel CR, McKnight SA 3rd, Pasley-Mowry C, Ferguson BL, Williams K: How does time-dependent dental unit waterline flushing affect planktonic bacteria levels? J Dent Educ 66: ,

untitled

untitled J Dent Hyg Sci Vol. 15, No. 5, 2015, pp.659-665 http://dx.doi.org/10.17135/jdhs.2015.15.5.659 RESEARCH ARTICLE 치과용유니트수관물빼기 (Flushing) 가세균오염도감소에미치는영향 윤혜영ㆍ이시영 강릉원주대학교치과대학구강미생물학교실, 구강과학연구소 Effects of Flushing