92-06.fm

Size: px

Start display at page:

Download "92-06.fm"

서현 국
5 years ago
Views:

1 Biomaterials Research (2005) 9(2) : Biomaterials Research 7 The Korean Society for Biomaterials z w e y p sƒ Evaluation of Oxidative Stress of Dental Biomaterials with a Yeast Biosensor Á Á Á x * Bum-Soon Lim, Yong-Keun Lee, Dong Hee Lee, and Hyeong-Cheol Yang* d Š xfš Še x tg Š Dept. of Dental Biomaterials Science and Dental Research Institute, College of Dentistry, Seoul National Univeristy, 28 Yongon-Dong, Chongro-Gu, Seoul , Korea (Received April 15, 2005/Accepted May 19, 2005) Dental alloys are known to release metal ions into oral cavity and to induce biological reactions mostly though oxidative stress. In this study, we developed a new method for the assessment of cellular oxidative stress with a geneticallyengineered yeast, Saccharomyces cerevisiae. An oxidative-stress responding gene, superoxide dismutase 1 (SOD1), of the yeast cell was tagged with GFP, and the expression level was measured by fluorescence intensity of GFP., an oxidant, increased fluorescence intensity dose and time dependently. Cadmium ion also induced increase of fluorescence within 1 hr at the concentrations over 1 µm. The fluorescence response appeared at the concentrations inhibiting cell growth, suggesting that the oxidative stress generated by cadmium ion is a major factors affecting cell growth. Nickel ion did not changed the fluorescence intensity of the yeast cells even at the concentrations exhibiting suppression of yeast growth. We also tested amalgam extract and TEGDMA, a dental resin monomer, for evaluation of oxidative stress. Amalgam extract induced fluorescence dose-dependently. There was no fluorescence changes and inhibition of cell growth at all concentrations of TEGDMA. Intracellular infiltration of TEGDMA should be confirmed to conclude the absence of oxidative stress by the resin monomer. In conclusion, the yeast cell bearing SOD1-GFP developed in this study was able to response to oxidative stress and seems useful for evaluation of toxic effects of some metal ions. Key words: Yeast, Biosensor, Oxidative stress, Cadmium, Nickel, Amalgam, TEGDMA tg f in vitro thš Œf eh f Š ff, Š Š f f thš h ud f Š fd f. l x Œ f g f Œf j eff h Š f. f Š h f f f fdš fš. eh f d, Salmenella typhimuriumf fdš Ames test 1) Š fdš micronucleus test, 2) sister chromatid exchange f 3) d f Š f. Ames test f f dš d f rfhf fš ft Š g f eš Š ff, f g Š whf Š, l d w ff, f Šhf g h f ehh Œf dfš ghf f. f f Š Š screeningf eš t f ii d ff, g *sf hf: yanghc@snu.ac.kr f fdš f j f. Œf f f ŠŠ tg e f f f j f Œ ƒ Œf Œ f ff~ f h f. f f d Fenton-like reactionf Š Œ i(ros)f glutathione f Š Œ lf f Œ 4) ƒ f jd h f. x d l d triethyleneglycol dimethacrylate(tegdma) glutathione ŠŠ Œ ƒ e Š f. Œ f eff ROS 5) ll, l, Š f Œ ~ 6) apoptosis, l, f f ff~. 7,8) ROS f Œ ƒ jd ff ROSf wh f f ŒŒe h wš Š hf. Œ ƒ Š f lf Š Œ lf Š ŒŒe jf hh l fd Š. f Saccharomyces cerevisiaef Š Œ ff f Š Œ h e Š r Š fdš Œ wh f f Š ff, 100

2 tg f Œ ƒ wh 101 g x d Š f f l d Š. f Š S. cerevisiaef f f } l ff t d f f Œf f. Œ ƒ Š 9) ešš Œ hfš eš Š Œ ff ~, Œ f e f Š Œ h hš f l Š Š Œ h ŒŠf Œ f h whš f Š. Œ f Š h eš Š Œ f f l Š Œ f h f eš Œ l(green fluorescence protein, GFP) Š Œ ehhf Š z Œ f Œ f fdš f Š. u Hu f S. cerevisiae f ƒ ff two-dimensional differential gel electrophoresis Š, Cu/Zn superoxide dismutase (Sod1p) f fš hš l. Sod1p f ƒ f 10) jd l, Sod1pf enconding ehf SOD1 GFP ehf Š ~, Sod1pf Œ GFP Œ Š whš f Š. Figure 1f Š f Š Œ f Œ f f j. Figure 1. Preparation and Schematic diagram of yeast biosensor for evaluation of oxidative stress. z s GFP tagging f w f Shermanf fš f 11) hf, lithium acetate transformation f dš 12) S. cerevisiae BY4741(MATa his3 leu2 met15 ura3)f SOD1 ehf C-terminus GFP ehf Š. GFP ehf G418 resistant y l plasmid(pfa6a-gfp(s65t)- kanmx) template 13) Š, SOD1f C-terminus homologous f Š ~ primer dš PCRf Š Š. SOD1f forward primer reverse primerf f 5'CGGTCCAAGACCAGCCTGTGGTGTCATTGGT- CTAACCAACCGGATCCCCGGGTTAATT3' 5'TACATACGG- TTTTTATTCAAGTATATTATCATTAACATTAGAATTCGAGCTCGT TTAA3'f. PCR f h f Œf BY4741f lithium acetate transformation dš. Transformation 3f G418 t Š yeast/peptone/dextrose (YPD) l z f Œf, f z wš PCRf Š SOD1 ehf GFP hœ tagging ff ŒfŠ. SOD1-GFP l j YCY101 Š. w S. cerevisiae d BY4741, YCY101f YPD l mid-log phase l, 100 µl(10 cells/ml)f 3 ŠeŠ 100 µlf YPD ŒŠ, 24 Š fdš g f u hl (minimum inhibitory concentration, MIC) Š. z s xÿ Imaging xÿ d YCY101f Œ f l Zeiss AXIOSKOP Œ (Carl Zeiss, Oberkochen, Germany)f dš rš. yeast dextrose peptone(ypd) l mid-log phase l Š phosphate buffered saline(pbs) s GFP filter set r Œ f GFPf Œ f l rš. Š, Sod1pf f e Š eš s Š, Œ f Œ f Œ rš, ~ f Œ Œ whš eš 96 well microplate fluorescence reader(fluostar Optima, BMG Labtechnologies, Offenberg, Germany) dš. GFP Œ f 490 nm(excitation) 520 nm(emission) ~ f (OD) 620 nm whš. y d f fš Œ f whš eš CdCl 2, NiCl 2 YPD dšš ~, mid-log phase (OD 0.15)f ŒŠŠ, 30 C o 240 rpmf l~ Š. 1.5 ml swš e Š 6 vš 200 µl wš microplate Œ f whš. f Degussa (Germany)f hˆf dš f, hi f f f ŒŠŠ 24 YPD l vv f j Š. vvf l d dš C o 240 rpmf l~ vvš f, vv 1 ml 0.2 cm hf f dš 2 f, vv Š Š Š YPD l Š d Š. Œ gf f Š eš g Š f f f Œ wh ŠŠ. l fš Œ l e Œ R f dš f, Rf ff fš v. R = ((F S F B )/(OD S OD B ))/((F C F B )/(OD C OD B )) F S : sample fluorescence Vol. 9, No. 2

102 f Áfd Áf Á Œs F B F C : blank fluorescence : negative control fluorescence OD S : sample turbidity OD B : blank turbidity OD C : negative control turbidity y d Œ f e Š f l TEGDMA Š 9) YCY101f Œ

3 102 f Áfd Áf Á Œs F B F C : blank fluorescence : negative control fluorescence OD S : sample turbidity OD B : blank turbidity OD C : negative control turbidity y d Œ f e Š f l TEGDMA Š 9) YCY101f Œ ff f f f whš. TEGDMA(Sigma, St. Louis, MO, USA) dimethyl sulfoxide (DMSO) dšš stock solutionf hiš f, YPD l Š dš. lf DMSO ui 0.5% f Š f, f i f DMSO 0.5% Š dš. š YCY101 BY4741 s ƒh ehf Š GFP f hf ehff endonding lf lf Œ ~ Š f f Œl Œ f. ehhf f f gf Š wild type Š wh, GFP f fš f Š. ƒ f wh dš f Š d f Œ Œ x f Š d hf i Š. f h gf Š g hf jf h f h h gf 23 o C, 30 o C, 37 C f o dš. BY4741 (wild type), YCY101 (SOD1-GFP)f g whš, j e Š gf f GFP f Œ l } f jl f. w z s Sod1 lf superoxide hydrogen peroxide f ROS Š f hš f Š, Sod1pf Œ f hš f d ROS Š f l. BY4741 YCY101 f 50 µm f f fš ghš f f, fš MIC(12.5 mm) ~. f Sod1 lf Œ f GFP fš Šl ff j f Œ f YCY101f fd fff h Š. w YCY101 xÿ y f superoxide dismutase Sod1p Sod2p f f l z j Š f h f. Œ Sod1p-GFPf 14,15) rš, GFP Œ f l ht fš. f GFP h hf GFP f Sod1pf f xl ff f. 100 µmf YCY101f s Š, 30 f e f Š h Œ l f 90 d Š Œ f (Figure 2). Figure 2. Fluorescence image of YCY101 treated with. Untreated YCY101 cells (a) and cells that were treated with 100 µm for 90 min (b) were applied to fluorescence microscopic examination with 490 nm excitation and 520 nm emission. The bar indicates 1.5 µm. ~ f Œ f whš, Figure 3A f f fi Œ Œ ~. 50 µm ŒŠŠ d ~ f Œ l (R value) 500 µm l fihf Rf l ~ f, 500 µm f f f Œ Œ. jœ Œ Rf g f ~ f e Œ f f fišl. l, fš l f Š f l fš ~ f Œ l Š i Š e Œ l Šl R f Šl 1f. s fš 90 l fhš Œ l Š fi Œ f 1 mm fš 1.8h f R f l f. f Š Œ f l fš Sod1p l hf vh f f Š. 90 s fš g hš Œ l Š f f (Figure 3B), f Œ ƒ Š gf hšš f Š Œ f h Š f. w YCY101 xÿ y x (Cd) f f x d Š f vv ii Œ h ff~ j f g h f. 16) Cd f f f f f e Š d Š f methallothioneine ŠŠ Œ f e Š ft g f ff~ f h f. 17) YCY101f Œ f fdš Cd f fš Œ ƒ e l i Š. Cd f f 1 f 1 µm Œ l f f, 0.1 µm 4 Œ f Œ (Figure 4A). 1 µm f f 4 Œ f l l hf f, Biomaterials Research 2005

4 tg f Œ ƒ wh 103 Figure 3. Fluorescence response of YCY101 to (A) and inhibitory effect of cell growth (B). YCY101 cells were grown until mid-log phase and exposed to at various concentrations. Fluorescence intensity of cell suspension was measured at each time point indicated. Each data set is an average of relative fluorescence intensity R. Error bars are standard deviation. Figure 4. Fluorescence response of YCY101 to cadmium ion (A) and inhibitory effect of cell growth (B). YCY101 cells were grown as in Figure 3 and treated with cadmium (Cd) ion. Each data set is an average of relative fluorescence intensity R. Error bars are standard deviation. fih f f r. 0.1 µm Cd ionf Œ f l ~l f, f g Š hš ~ (Figure 4B). f Œ ƒ f Cd f hf igš, Sod1p- GFP whš f vš fš f f. z(ni)f hd Š j Š f l e f g h f. 18) Ni f f hf g h fl f, Cd Œf Hg f f Š f fl. Figure 5A zf fš YCY101f Œ Œ j f (1 mm l) Œ f Œ. 1 mm Ni f fš 50% h f ghš f f Sod1p Œ ƒ Ni f fš e l f. TEGDMA w YCY101 xÿ y ft eš f l f vv f s Š YCY101f Œ Œ whš. f 24 vv Š vv f YCY101 ŒŠ Š, 60% vv g hš ~ (Figure 6B). GFP Œ Š 60% f l f, 100% f R f fih Œ Œ ~. s 30 f d, Rf l f, h 1 f s Œ f Œ r Š f (Figure 6A). l TEGDMA h ( µm) Œ f Œ f, f g Š TEGDMA fš f l (Figure 7). f TEGDMA Œ ƒ Vol. 9, No. 2

5 104 f Áfd Áf Á Œs Figure 5. Fluorescence response of YCY101 to Nickel ion (A) and inhibitory effect of cell growth (B). YCY101 cells were grown as in Figure 3 and treated with Nickel (Ni) ion. Each data set is an average of relative fluorescence intensity R. Error bars are standard deviation. Figure 6. Fluorescence response of YCY101 to amalgam extract (A) and inhibitory effect of cell growth (B). YCY101 cells were grown as in Figure 3 and treated with amalgam extract. Each data set is an average of relative fluorescence intensity R. Error bars are standard deviation. f Šl f Œf Š TEGDMA x f f f h Š f. Œ ƒ j f d Š, uih f f Š Š. l llf Œ, e hf f Š f Œ, Œ l f Š. f Š Œ ƒ j tg f f g f h ff l. Œ ƒ ŒfŠ g f hf f Œ probe dš lhh f Œ if whš f, Œ if 19) jf Œ h f x l l f. Œ ƒ fš ~ f adaptation activity h Š Œ ƒ j l Šh f l y d f. gf iff dfš f ghf ff,, ph, g i Œ hf f Š d hšš lf l. Sod1 lf d j l Œ ƒ Š uh f j Š h ff f Œ l fš f l. tagged GFP dš f Sod1p f whš f f Š. Superoxide Œ Šf Š sod1p(superoxide dismutase 1 protein) superoxide ff Šl Œ f Š f l (Figure 3A). f f d f Š j x f YCY101f Biomaterials Research 2005

6 tg f Œ ƒ wh 105 Figure 7. Fluorescence response of YCY101 to TEGDMA (A) and inhibitory effect of cell growth (B). YCY101 cells were grown as in Fig. 3 and treated with TEGDMA. Each data set is an average of relative fluorescence intensity R. Error bars are standard deviation. Œ ff e Š (Figure 4A). f Š YCY101f Œ f Š (unpublished data), f Œ ff f eš f 100 h f x f ŠdŠ, whš 4 l l hf Œ f l ~. zf f Š h Œ Œ ghš ~ l f f fš Œ f jf Š h. h d f x d g j f Œ f vv f dš Š. Amalgamf j f, f, f Š ff ff ig fš f eš l f, l ft Š lhhf eš f fl fl f ~f. ISOf fd tg f ff d 1 ml g h 3 cm vvi f h Š 2 ff, Š f Š f Š eš f h f h 0.2 cm 2 dš. YCY101Œ Œ 100% vv 4 f 1 µmf f Š jf. f ff j f Š ff ~ Œ ƒ j f fš f f Š hš. f f ev f x g f u h f Š ff evf f. hf j 20) f Œ carbimide peroxide g l Œ ƒ e l Œ Š f f ff g Œ fdš Œ whf l Š j f. TEGDMA Œ ƒ e l ff, YCY101f Œ ff ~ l. f f igš multidrug transporter fš TEGDMA d 21) v f f, multidrug transporter h ~ fjf df ŠdŠ f. l f t le (03-PJ1-PG ) fš Š f. š x 1. B. N. Ames, J. McCann, and E. Yamasaki, Methods for detecting carcinogens and mutagens with the Salmonella/mammalianmicrosome mutagenicity test, Mutat. Res., 31, (1975). 2. W. Schmid, The micronucleus test. Mutat. Res., 31, 9-15 (1975). 3. E. Solomon and M. Bobrow, Sister chromatid exchange-a sensitive assay of agents damaging human chromosomes, Mutat. Res., 30, (1975). 4. N. Ercal, H. Gurer-Orhan and N. Aykin-Burns, Toxic metals and oxidative stress Part I: mechanism involved in metal-induced oxidative damage, Curr. Top. Med. Chem., 1, (2001). 5. L. Stanislawski, M. Lefeuvre, K. Bourd, E. Soheili-Majd, M. Goldberg, and A. Perianin, TEGDMA-induced toxicity in human fibroblasts is associated with early and drastic glutathione depletion with subsequent production of oxygen reactive species, J. Biomed. Mater. Res., 66A, (2003). 6. G. S. Buzard and K. S. Kasprzak, Possible role of nitric oxide and redox cell signaling in metal induced toxicity and carcinogenesis: a review, J. Environ. Pathol. Toxicol. Oncol., 19, (2000). 7. J. Boonstra and J. A. Post, Molecular events associated with reactive oxygen species and cell cycle pregression in mammalian cells, Gene, 337, 1-13 (2004). 8. I. Rahman, J. Marwick, and P. Kirkham, Redox modulation of chromatin remodeling: impact on histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression, Biochem. Pharmacol., 68, (2004). 9. L. Stanislawski, M. Lefeuvre, K. Bourd, E. Soheili-Majd, M. Goldberg, and A. Perianin, TEGDMA-induced toxicity in human fibroblasts is associated with early and drastic glutathione depletion with subsequent production of oxygen reactive species, J. Biomed. Mater. Res., 66A, (2003). Vol. 9, No. 2

7 106 f Áfd Áf Á Œs 10. Y. Hu, G. Wang, G. Y. Chen, X. Fu, and S. Q. Yao, Proteome analysis of Saccharomyces cerevisiae under metal stress by twodimensional differential gel electrophoresis, Electrophoresis, 24, (2003). 11. F. Sherman, Getting started with yeast, Methods Enzymol., 194, 3-21 (1991). 12. H. Ito, Y. Fukuda, K. Murata, and A. Kimura, Transformation of intact yeast cells treated with alkali cations, J. Bacterial., 153, (1983). 13. H. C. Yang and L. A. Yang, Actin cable dynamics in budding yeast, Proc. Natl. Acad. Sci. U.S.A., 99, (2002). 14. L. Y. Chang, J. W. Slot, H. J. Geuze, and J. D. Crapo, Molecular immunocytochemistry of the CuZn superoxide dismutase in rat hepatocytes, J. Cell Biol., 107, (1988). 15. S. L. Church, J. W. Grant, E. U. Meese, and J. M. Trent, Sublocalization of the gene encoding manganese superoxide dismutase (MnSOD/SOD2) to 6q25 by fluorescence in situ hybridization and somatic cell hybrid mapping, Genomics, 14, (1992). 16. J. C. Wataha, Biocompatibility of dental casting alloys: a review, J Prosthet. Dent., 83, (2000). 17. K. S. Squibb, J. B. Pritchard, and B. A. Fowler, Cadmium- Metallothionein nephropathy: relationships between ultrastructural/biochemical alterations and intracellular cadmium binding, J. Pharmacol. Exp. Ther., 229, (1984). 18. H. F. Hildebrand, C. Veron, and P. Martin, Nickel, chromium, cobalt dental alloys and allergic reactions: an overview, Biomaterials. 10, (1989). 19. C. P. LeBel, H. Ischiropoulos, and S. C. Bondy, Evaluation of the probe 2',7'-dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress, Chem. Res. Toxicol., 5, (1992). 20. I. Rotstein, H. Dogan, Y. Avron, H. Shemesh, and D. Steinberg, Mercury release from dental amalgam after treatment with 10% carbamide peroxide in vitro, Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod., 89, (2000). 21. Z. Kozovska and J. Subik, Screening for effectors that modify multidrug resistance in yeast, Int. J. Antimicrob. Agents, 22, (2003). Biomaterials Research 2005

γ

경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical