Korean J Lab Med 2010;30:111-6 DOI /kjlm Case Report Diagnostic Hematology Molecular Analysis of Two Cases of Severe Congenital N

Size: px
Start display at page:

Download "Korean J Lab Med 2010;30:111-6 DOI /kjlm Case Report Diagnostic Hematology Molecular Analysis of Two Cases of Severe Congenital N"

Transcription

1 Korean J Lab Med 2010;30:111-6 DOI /kjlm Case Report Diagnostic Hematology Molecular Analysis of Two Cases of Severe Congenital Neutropenia Joonhong Park, M.D. 1, Myungshin Kim, M.D. 1, Jihyang Lim, M.D. 1, Yonggoo Kim, M.D. 1, Bin Cho, M.D. 2, Yeon-Joon Park, M.D. 1, and Kyungja Han, M.D. 1 Departments of Laboratory Medicine 1 and Pediatrics 2, College of Medicine, The Catholic University of Korea, Seoul, Korea Severe congenital neutropenia is a rare hematological disease characterized by a selective decrease in circulating neutrophils, maturation arrest of granulocytic precursors at the promyelocyte stage, and recurrence of infections. A 2-month-old male infant (patient A) and a 14-month-old female child (patient B) were referred to our hospital due to severe neutropenia. Sequencing analysis of ELA2 and HAX1 genes was performed. Two single nucleotide polymorphisms of HAX1 gene were found. They were 5,104T G point mutation of exon 1 and 5,474A G point mutation of intron 1 in HAX1 gene. The mutation of ELA2 gene was not found. The patient A showed a good response to granulocyte colony-stimulating factor (G-CSF) treatment and the absolute neutrophil count recovered to 1,195/mL. But the patient B showed a partial response to G-CSF treatment and experienced several episodes of herpetic gingivostomatitis, oral ulcer, acute pharyngotonsillitis and otitis media during follow-up. (Korean J Lab Med 2010;30:111-6) Key Words : Severe congenital neutropenia, ELA2, HAX1 서 론 검사를시행하고문헌고찰과함께보고하고자한다. 선천성호중구감소증 (severe congenital neutropenia, SCN) 은순환호중구의선택적감소, 전골수구단계에서골수과립구계세포의성숙정지그리고반복적인감염을특징으로하는드문혈액질환이다 [1]. SCN 환자는대부분소아이고절대호중구수 (absolute neutrophil count, ANC) 가보통 200/mL 이하이며골수구성장촉진인자 (granulocyte colony-stimulating factor, G-CSF) 를이용한치료가도입되기이전에는심한세균감염으로인해조기에사망하였다 [2]. SCN의병태생리에흔히관여하는유전자변이로는상염색체우성 SCN의 ELA2 (elastase 2, neutrophil) 유전자변이와상염색체열성 SCN의 HAX1 (HCLS1 associated protein X-1) 유전자변이가보고되어있다 [3-6]. 저자들은항생제치료에도불구하고심한호중구감소증을보인 2명의 SCN 환아를대상으로분자유전학적 Received : April 29, 2009 Manuscript No : KJLM Revision received : January 11, 2010 Accepted : February 4, 2010 Corresponding author : Kyungja Han, M.D. Department of Laboratory Medicine, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-gu, Seoul , Korea Tel : , Fax : hankja@catholic.ac.kr 증례 1. 증례 A 환자 : 2개월, 남아주증상 : 심한호중구감소증현병력 : 환아는생후 2일째부터지속되는열로타병원에입원하여요로감염으로진단받고항생제치료를받았으나심한호중구감소가지속되어본원소아과외래를경유하여입원하였다. 과거력및가족력 : 형제는없으며기타특이사항은없었다. 이학적소견 : 호흡수는분당 60회, 맥박은분당 138회, 체온은 36.4 였고기타특이소견은없었다. 검사소견 : 총백혈구는 /L였고이중분절호중구가 2% 로 ANC가 156/mL 였다. 기타백혈구백분율은림프구 94%, 단핵구 1%, 호산구 3% 였다. 혈색소는 8.8 g/dl, 적혈구용적은 25.7%, 혈소판은 /L, ESR은 44 mm/hr, CRP는 mg/l였다. 말초혈액도말상심한호중구감소가관찰되었다. 골수도말및생검소견 : 골수의세포충실도는 100% 였고 M:E ratio는 1:2였다. 과립구계세포가현저히감소하였고소 111

2 112 Joonhong Park, Myungshin Kim, Jihyang Lim, et al. 수의전골수구가관찰되었으며성숙호중구는거의관찰되지않았다 (Fig. 1). 세포감별계산은적혈모세포 27%, 골수모세포 1%, 전골수구 7%, 골수구 1%, 후골수구 0%, 대상호중구및분엽핵호중구 0%, 호산구 4%, 호염기구 1%, 림프구 59% 였다. 말초혈액을이용한림프구면역표현형검사에서림프구는 CD3 (72%), CD19 (17%), CD3+CD4+ (61%), CD3+CD8+ (11%), CD3-(CD16+56)+ (7%), CD19+CD5+ (0%) 로정상이었다. 골수염색체검사 : 염색체분석결과 46,XY[20] 로정상소견을보였다. 분자생물학적검사 : ELA2와 HAX1 유전자에대한시발체는참고문헌에따라 Table 1과같이제작하였다 [7, 8]. BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) 와 ABI 3730XL DNA analyzer (Applied Biosystems) 를이용한염기서열분석결과, HAX1 유전자의 exon 1에서 5,104T G 점돌연변이와 intron 1에서 5,474A G 점돌연변이가관찰되었다 (Fig. 2). ELA2 유전자분석결 과에서는돌연변이가관찰되지않았다. 미생물검사 : 소변배양검사, 인후배양검사, 혈액배양검사상균이분리되지않았다. 치료및경과 : 환아는 3일동안항생제 (piperacillin, tazobactam) 와 G-CSF 4 mg으로치료받은후증상이호전되어 1주일후퇴원하였다. 퇴원시검사소견은백혈구는 /L ( 분절호중구 3.3%, 림프구 80.1%, 단핵구 5.6%, 호산구 9.6%, 호염구 1.4%) 로써 ANC가 252/mL, 혈색소는 8.7 g/dl, 적혈구용적은 26.3%, 혈소판은 /L였다. 퇴원 4개월후검사소견은총백혈구수가 /L였고이중분절호중구가 14.3% 로 ANC가 1,195/mL 였다. 2. 증례 B 환자 : 14개월, 여아주증상 : 심한호중구감소증 A B C D Fig. 1. Bone marrow smears show markedly decreased granulocytic precursors (A and C, Wright stain, 400) and a few promyelocytes (B and D, Wright stain, 1,000) in patient A and B, respectively.

3 Molecular Analysis of SCN 113 Table 1. Primers for PCR amplification and sequencing of ELA2 and HAX1 genes Primers for PCR amplification Sequence Nucleotides ELA2 Forward primer CTCGCGTGTCTTTTCCTC Reverse primer AGCCCTTCTCAGTGGGTC HAX1 Forward primer CGTTTACGACAGTGTCAGGATCG 5,017-5,039 Reverse primer TGACAAACTGACATGGCCCCAG 8,253-8,274 Primers for sequencing Sequence Nucleotides ELA2 1 Forward primer CTCGCGTGTCTTTTCCTC Reverse primer GACGTTTACATTCGCCAC Forward primer CCCAACTTCGTCAT GTCG Reverse primer AGGCACTGCACCCCGTTG Forward primer ATCAACGCCAACGTGCAG Reverse primer GATTAGCCCGTTGCAGAC Forward primer AACGTCTGCACTCTCGTG Reverse primer AGCCCTTCTCAGTGGGTC HAX1 1 Forward primer CGTTTACGACAGTGTCAGGATCG 5,017-5,039 Reverse primer GAAAGGTGGCAGGTGTTTGC 6,187-6,206 2 Forward primer TTTTGATG TGGCAGCCAGTC 5,634-5,653 Reverse primer GGCTGGTCTC CAACTCCTG 6,535-6,553 3 Forward primer CCCTAAGGGGCAACCTGTG 6,049-6,067 Reverse primer CTACAA AGAGAAGTCCCCAC 7,811-7,830 4 Forward primer GAAGGAGTGTGTAAATAAGGC 7,242-7,262 Reverse primer TGACAAACTGACATGGCCCCAG 8,253-8,274 Nucleotide position corresponds to GenBank entry NM_ (ELA2) and NG_ (HAX1). 현병력 : 환아는타병원에서내원 2일전부터지속되는미열과식욕부진으로치료중심한호중구감소증이관찰되어본원소아과외래를경유하여입원하였다. 과거력및가족력 : 환아는출생후 3일동안지속되는열과요로감염으로 2주간입원한병력이있었고이후에도구강궤양과급성위장관염으로진료받은과거력이있었다. 형제는없으며기타특이사항은없었다. 이학적소견 : 호흡수는분당 30회, 맥박은분당 130회, 체온은 36.0 였고기타특이소견은없었다. 검사소견 : 총백혈구는 /L였고이중분절호중구가 0.4% 로 ANC가 33/mL 였다. 기타백혈구백분율은림프구 81.9%, 단핵구 14.7%, 호산구 2.5% 였다. 혈색소는 10.6 g/dl, 적혈구용적은 30.7%, 혈소판은 /L, ESR은 32 mm/h, CRP 는 mg/l였다. 말초혈액도말상심한호중구감소가관찰되었다. 골수도말및생검소견 : 골수의세포충실도는 60% 였고 M:E ratio는 1:1이었다. 과립구계세포가현저히감소하였고소수의전골수구가관찰되었으며성숙호중구는거의관찰되지않았다 (Fig. 1). 세포감별계산은적혈모세포 22%, 골수모세포 1%, 전골수구 10%, 골수구 3%, 후골수구 0%, 대상호중구및분엽핵호중구 0%, 호산구 5%, 호염기구 1%, 림프구 53% 였다. 분자생물학적검사 : ABI 3130XL DNA analyzer (Applied Biosystems) 를이용한염기서열분석결과, HAX1 유전자의 exon 1에서 5,104T G 점돌연변이와 intron 1에서 5,474A G 점돌연변이가관찰되었다 (Fig. 2). ELA2 유전자분석결과에서는돌연변이가관찰되지않았다. 미생물검사 : 소변배양검사, 인후배양검사, 혈액배양검사상균이분리되지않았다. 치료및경과 : 환아는 6일동안항생제 (augmentin) 와 G-CSF 50 mg 으로치료받은후호전되어 2주일후퇴원하였다. 퇴원시검사소견은백혈구는 /L ( 분절호중구 31.4%, 림프구 51.1%, 단핵구 10.0%, 호산구 2.4%, 호염구 5.1%) 로써 ANC 가 7,033/mL, 혈색소는 10.2 g/dl, 적혈구용적은 29.4%, 혈소판은 /L였다. 그러나퇴원 2개월후검사소견은총백혈구수가 /L였고이중분절호중구가 1.5% 로 ANC가 109/mL 였다. 이후환아는 G-CSF 치료에일시적인반응을보이며수차례반복적인발열과헤르페스잇몸입안염 (herpetic gingivostomatitis), 구강궤양, 인후염과중이염등으로입원또는외래진료를받으며추적관찰중이다. 고찰 Kostmann [9] 은 1956년에 ANC가 500/mL 이하인심한호중구감소증과조기에발병하는심한세균감염을특징으로하는상염색체열성혈액질환을보고하였고이후 Kostmann 증후군으로명명되었다. SCN에서는구강점막을보호하는호중구의감소로잇몸입안염과구강궤양이가장흔한증상이고피부감염, 중이염, 폐렴, 요로감염등도흔하다. 세균감염과관련된균주로는황색포도상구균및대장균이가장흔한감염균주이고환자는패혈증, 복막염등으로사망한다 [10]. SCN 환자들의약 9% 가 G-CSF 치료중골수이형성증후군 (MDS) 이나급성골수성백혈병 (AML) 으로이행하는것으로보고되었다. G-CSF가 SCN에서 MDS/AML을유발하는직접적인기여인자임을배제할수없으나 G-CSF 치료로 SCN 환자들의생존율이향상되면서잠재적인 MDS/AML 유발소인이발현하는것으로생각되고있다 [11]. SCN에서 MDS/AML로이행은 mo-

4 114 Joonhong Park, Myungshin Kim, Jihyang Lim, et al. 5,104 (T G) 5,474 (A G) C A G G T T K C C C C C A G G A A T A R G A C A G B C A G G T T G C C C C C G G A A T A G G A C A G C A G G T T G C C C C C G G A A T A G G A C A G C D Fig. 2. Sequencing analysis of HAX1. 5,104T G point mutation of exon 1 (A, C) and 5,474A G point mutation of intron 1 (B, D) in patient A and B, respectively. The point mutations of patient A are heterozygous and those of patient B are homozygous mutations. nosomy 7, trisomy 21, ras 돌연변이를획득하는일부 SCN 환자에서다단계경로를통해일어난다 [12]. 본증례의환아들은모두생후 2-3일째부터발열이관찰되었고요로감염으로진단받아항생제치료를하였다. 특히증례 B 환아에서는추적관찰중에잇몸입안염, 구강궤양, 인후염, 중이염등이관찰되었다. 염색체검사를시행한증례 A 환아는정상염색체핵형이었다. 국내에서는 SCN에대한 5예의증례보고가있고 [13-17] 보고된환아들은반복적인세균감염으로피부감염, 인두염, 부비동염, 폐렴, 중이염, 잇몸입안염등의병력이있었다. G-CSF 투여로 SCN 환자에서호중구수가증가하고발열과감염의빈도가감소함이보고되었다 [16]. 1994년에 Severe Chronic Neutropenia International Registry (SCNIR) 가설립되어 700명이상의 SCN 환자를추적관찰한결과, 90% 이상의환자가 G-CSF 치료에반응하였고 ANC가 1,000/mL 이상으로호전되었으며치료에반응한모든환자에서항생제의사용과입원기간이현저히감소하였다 [18-22]. 현재 G-CSF는대부분의 SCN 환자에서추천되는 1차치료제이고, G-CSF 치료에불응하는환자와 MDS/AML로이행된환자에서는조혈모세포이식이유일한치료방법으로알려져있다 [23]. 본증례 에서증례 A 환아는 G-CSF 투여로임상증상이호전되었고 ANC도 1,195/mL 로회복되었다. 그러나증례 B 환아는 G-CSF 치료에일시적인반응은보였으나 ANC가 500/mL 이상지속되지않았으며추적관찰중에반복적인세균감염이관찰되었다. 국내에서 Seo 등 [24] 이선천성무과립증환자를대상으로유전자재조합인 G-CSF를투여하여 G-CSF가 SCN의일차적선택치료제제가될수있음을확인한이후 Yoon 등 [16] 과 Lee 등 [17] 은 SCN 환아들을대상으로한 G-CSF 치료경험을보고하였다. G-CSF는현재국내에서도 SCN 환자들에게추천되는 1 차치료제이다. SCN은 ELA2 [25], HAX1 [5,6], G-CSF receptor (G-CSFR) [26], Wiskott-Aldrich syndrome protein (WAS) [27], growth factor independent-1 transcription repressor (GFI-1) [28] 등다양한유전자가관여하는이형 ( ) 질환임이밝혀졌다. ELA2 유전자변이는대략 50-60% 의 SCN 환자에서관찰되는가장흔한유전자이상이며특히상염색체우성 SCN 환자에서흔하게보고되고있다 [3, 4]. HAX1 유전자변이는 SCN 환자의 3분의 1에서보고되고있다 [5, 6]. WASP, GFI-1 등과같은다른유전자변이는극히드물고소수의환자에서만보고되었다.

5 Molecular Analysis of SCN 115 최근상염색체열성 SCN 환자에서 anti-apoptotic gene인 HAX1 유전자변이가보고되었다 [5]. Klein 등 [5] 은중동의 20 명의 SCN 환자와전형적인 Kostmann 증후군을보이는세가족을대상으로상염색체열성 SCN의원인인동형 ( ) HAX1 유전자변이를연구하여 HAX1 유전자는골수세포에서 inner mitochondrial membrane potential을유지하고 apoptosis 에대해방어역할을하는데중요하다고제안하였다. ELA2 유전자변이와 HAX1 유전자변이는유사한형태학적이상과임상적으로공통적인표현형을보이는데이것은두유전자변이에의한분자생물학적결함이유전자발현의공통적인경로에존재할가능성을의미한다. Skokowa 등 [29] 은 ELA2 유전자변이와 HAX1 유전자변이를보이는각각의환자군에서 transcription factor인 Lymphoid enhancer-binding factor-1 (LEF-1) 의발현소실과순차적인 CCAAT/enhancer binding protein a (C/EBPa) 와 survivin의 down-regulation으로인하여과립구계전구세포들의생존율이감소하고분화가지연되며골수에서과립구생성의성숙정지와말초혈액에서호중구감소가관찰된다고보고하였다. 본증례에서는두예모두 ELA2 유전자변이는관찰되지않았으나 HAX1 유전자의 exon 1에서 5,104T G 점돌연변이와 intron 1에서 5,474A G 점돌연변이가관찰되었다. 관찰된두개의변이중, exon1의 5,104T G 점돌연변이는 protein-coding sequence를이용한염기서열분석결과 ATG (start codon) 이전의부분이어서 protein 합성과는관련이없을것으로생각되었다. Intron 1의 5,474A G 점돌연변이는염기서열분석결과만본다면종결코돈으로사용될수도있으나변이의위치가 intron이기때문에코돈이형성되지않을것으로판단되었다. 분석결과, 관찰된두개의점돌연변이는 open reading frame (ORF) 내에위치하지는않았고모두외국 SNP database에보고된단일염기변이 (single nucleotide polymorphism, SNP) 였다. RefSNP 번호는 exon1 의 5,104T G 점돌연변이는 rs 였고, intron 1의 5,474A G 점돌연변이는 rs 이었다. 증례 A 환아의 SNP는 heterozygote였고증례 B 환아의 SNP는 homozygote였다. 환아들의가계도분석결과, SCN의가족력은없었으나환아들은모두형제가없었기때문에질환의표현형을분석하기에어려움이있었다. 최근에국내 SCN 환자에대한 ELA2와연관된새로운돌연변이가보고되었으나 [30] 아직한국 SCN 환자들을대상으로한분자유전학적연구가보고된바가거의없어서앞으로국내 SCN 환자들을대상으로추가적인분자유전학적연구가필요하다. 증례 A 환아는 G-CSF 치료에좋은반응을보였지만증례 B 환아는 G-CSF 치료에일시적인반응을보였고 추적관찰중에반복적인세균감염이관찰되었다. 환아들은세균감염과 MDS/AML로의이행에대한조기진단을위해추적관찰중이다. 요약선천성호중구감소증 (severe congenital neutropenia, SCN) 은순환호중구의선택적감소, 전골수구단계에서골수과립구계세포의성숙정지, 빈번한감염을특징으로하는드문혈액질환이다. 저자들은항생제치료에도불구하고심한호중구감소증을보인 2명의 SCN 환아를대상으로분자유전학적분석을시행한결과, 두예모두에서 ELA2 유전자변이는관찰되지않았으나, HAX1 유전자의 exon 1에서 5,104T G 점돌연변이와 intron 1에서 5,474A G 점돌연변이가관찰되었다. 증례 A 환아는 granulocyte colony-stimulating factor (G-CSF) 치료에좋은반응을보였지만증례 B 환아는 G-CSF 치료에일시적인반응을보였고추적관찰중에반복적인세균감염이관찰되었다. 환아들은세균감염과급성백혈병이나골수이형성증후군으로의이행에대한조기진단을위해추적관찰중이다. 참고문헌 1. Boxer LA. Severe congenital neutropenia: genetics and pathogenesis. Trans Am Clin Climatol Assoc 2006;117: Kostmann R. Infantile genetic agranulocytosis. A review with presentation of ten new cases. Acta Paediatr Scand 1975;64: Dale DC, Person RE, Bolyard AA, Aprikyan AG, Bos C, Bonilla MA, et al. Mutations in the gene encoding neutrophil elastase in congenital and cyclic neutropenia. Blood 2000;96: Horwitz MS, Duan Z, Korkmaz B, Lee HH, Mealiffe ME, Salipante SJ. Neutrophil elastase in cyclic and severe congenital neutropenia. Blood 2007;109: Klein C, Grudzien M, Appaswamy G, Germeshausen M, Sandrock I, Schaffer AA, et al. HAX1 deficiency causes autosomal recessive severe congenital neutropenia (Kostmann disease). Nat Genet 2007; 39: Germeshausen M, Grudzien M, Zeidler C, Abdollahpour H, Yetgin S, Rezaei N, et al. Novel HAX1 mutations in patients with severe congenital neutropenia reveal isoform-dependent genotype-phenotype associations. Blood 2008;111: Kawaguchi H, Kobayashi M, Nakamura K, Konishi N, Miyagawa

6 116 Joonhong Park, Myungshin Kim, Jihyang Lim, et al. S, Sato T, et al. Dysregulation of transcriptions in primary granule constituents during myeloid proliferation and differentiation in patients with severe congenital neutropenia. J Leukoc Biol 2003;73: Ishikawa N, Okada S, Miki M, Shirao K, Kihara H, Tsumura M, et al. Neurodevelopmental abnormalities associated with severe congenital neutropenia due to the R86X mutation in the HAX1 gene. J Med Genet 2008;45: Kostmann R. Infantile genetic agranulocytosis (agranulocytosis infantilis hereditaria): a new recessive lethal disease in man. Acta Pediatr Scand. 1956; 45: Boxer L and Dale DC. Neutropenia: causes and consequences. Semin Hematol 2002;39: Freedman MH, Bonilla MA, Fier C, Bolyard AA, Scarlata D, Boxer LA, et al. Myelodysplasia syndrome and acute myeloid leukemia in patients with congenital neutropenia receiving G-CSF therapy. Blood 2000;96: Freedman MH and Alter BP. Risk of myelodysplastic syndrome and acute myeloid leukemia in congenital neutropenias. Semin Hematol 2002;39: Yoo HW, Shin SM, Ahn HS, Choi Y, Hong CY. A case of Kostmann syndrome. J Korean Pediatr Soc 1983;26: ( 유한욱, 신손문, 안효섭, 최용, 홍창의. Kostmann 증후군 1례. 소아과 1983;26:284-8.) 14. Shin WS, Kim SW, Paik IK. A case of Kostmann syndrome. J Korean Pediatr Soc 1989;32: ( 신원섭, 김상우, 백인기. Kostmann 증후군 1례. 소아과 1989;32: ) 15. Kim SC, Kim MY, Song KE, Suh JS, Lee WK, Kim JS. A case of congenital neutropenia. Korean J Clin Pathol 1989;9: ( 김성철, 김문연, 송경은, 서장수, 이원길, 김재식. 선천성호중구감소증 1예. 대한임상병리학회지 1989;9:385-9.) 16. Yoon CG, Jang JG, Sin JB, Lee SY. Kostmann s disease: a case report. Korean J Pediatr Hematol-Oncol 1999;6: ( 윤철규, 장진규, 신종범, 이순용. Kostmann병. 대한소아혈액종양학회지1999;6: ) 17. Lee JH, Cho B, Sung IK, Kim HK, Lee KS, Han KJ. A case of Kostmann syndrome treated with recombinant human granulocyte colony-stimulating factor. Korean J Perinatol 1996;7: ( 이정화, 조빈, 성인경, 김학기, 이경수, 한경자. 과립구집락자극인자로치료한 Kostmann 증후군 1례. 대한주산의학회잡지 1996;7: ) 18. Dale DC, Bonilla MA, Davis MW, Nakanishi AM, Hammond WP, Kurtzberg J, et al. A randomized controlled phase III trial of recombinant human granulocyte colony-stimulating factor (filgrastim) for treatment of severe chronic neutropenia. Blood 1993;81: Freedman MH. Safety of long-term administration of granulocyte colony-stimulating factor for severe chronic neutropenia. Curr Opin Hematol 1997;4: Welte K and Dale D. Pathophysiology and treatment of severe chronic neutropenia. Ann Hematol 1996;72: Welte K and Boxer LA. Severe chronic neutropenia: pathophysiology and therapy. Semin Hematol 1997;34: Welte K, Zeidler C, Dale DC. Severe congenital neutropenia. Semin Hematol 2006;43: Zeidler C, Welte K, Barak Y, Barriga F, Bolyard AA, Boxer L, et al. Stem cell transplantation in patients with severe congenital neutropenia without evidence of leukemic transformation. Blood 2000;95: Seo JJ, Moon SH, Cha SW, Ko KO, Chung YH, Anh HS, et al. Effect of granulocyte colony-stimulating factor in a patient with congenital agranulocytosis. Korean J BRM 1994;4: ( 서종진, 문신혜, 차상원, 고경옥, 정용헌, 안효섭외. 선천성무과립구증에대한과립구집락자극인자 (G-CSF) 의치료. 한국 BRM 학회지 1994;4: ) 25. Ancliff PJ, Gale RE, Liesner R, Hann IM, Linch DC. Mutations in the ELA2 gene encoding neutrophil elastase are present in most patients with sporadic severe congenital neutropenia but only in some patients with the familial form of the disease. Blood 2001;98: Dong F, Brynes RK, Tidow N, Welte K, Lowenberg B, Touw IP. Mutations in the gene for the granulocyte colony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia. N Engl J Med 1995;333: Devriendt K, Kim AS, Mathijs G, Frints SG, Schwartz M, Van Den Oord JJ, et al. Constitutively activating mutation in WASP causes X-linked severe congenital neutropenia. Nat Genet 2001;27: Person RE, Li FQ, Duan Z, Benson KF, Wechsler J, Papadaki HA, et al. Mutations in proto-oncogene GFI1 cause human neutropenia and target ELA2. Nat Genet 2003;34: Skokowa J, Cario G, Uenalan M, Schambach A, Germeshausen M, Battmer K, et al. LEF-1 is crucial for neutrophil granulocytopoiesis and its expression is severely reduced in congenital neutropenia. Nat Med 2006;12: Lee ST, Yoon HS, Kim HJ, Lee JH, Park JH, Kim SH, et al. A novel mutation Ala57Val of the ELA2 gene in a Korean boy with severe congenital neutropenia. Ann Hematol 2009;88:593-5.

7.ƯÁýb71ÎÀ¯È« š

7.ƯÁýb71ÎÀ¯È« š J KMA Special Issue Myelodysplastic Syndrome June Won Cheong, MD Yoo Hong Min, MD Department of Internal Medicine, Yonsei University College of Medicine E mail : jwcheong70@yumc.yonsei.ac.kr minbrmmd@yumc.yonsei.ac.kr

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

untitled

untitled Clinical Pediatric Hematology-Oncology Volume ㆍ Number ㆍ October 04 ORIGINAL ARTICLE 소아청소년기에발생한중증호중구감소증의관찰 이진희 ㆍ김소현 ㆍ김성구 ㆍ이재욱 ㆍ장필상 ㆍ김명신 ㆍ정낙균 ㆍ조빈 ㆍ김학기 가톨릭대학교의과대학 소아과학교실, 가톨릭유전진단검사센터진단검사의학교실 Clinical and

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

김범수

김범수 Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis

More information

ºÎÁ¤¸ÆV10N³»Áö

ºÎÁ¤¸ÆV10N³»Áö case of brugada syndrome presented as chest pain STRCT rugada syndrome was described in 1992 as a new clinical entity characterized by electrocardiographic STsegment elevation in the right precordial leads

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교

충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~ Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교 충북의대학술지 Chungbuk Med. J. Vol. 27. No. 1. 1~5 2017 Charcot-Marie-Tooth Disease 환자의마취 : 증례보고 신일동 1, 이진희 1, 박상희 1,2 * 책임저자 : 박상희, 충북청주시서원구충대로 1 번지, 충북대학교의과대학마취통증의학교실, 의학연구소 (28644), happycat19@hanmail.net

More information

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>

<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770> 대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

Jksvs019(8-15).hwp

Jksvs019(8-15).hwp Grade I Grade II Grade III 12 대한혈관외과학회지 : 제 20 권 제 1 호 2004 Control Group A Group B Fig. 4. Microscopic findings of vein wall in control, group A and group B on the day of 7 after venous occlusion. The

More information

증례 Lab Med Online Vol. 1, No. 4: , October 진단혈액학 JAK2V617F 돌연변이를보인비정형만성골수성백혈병 1 예 A Case of Atyp

증례 Lab Med Online Vol. 1, No. 4: , October 진단혈액학 JAK2V617F 돌연변이를보인비정형만성골수성백혈병 1 예 A Case of Atyp 증례 Lab Med Online Vol. 1, No. 4: 232-236, October 2011 진단혈액학 JAK2V617F 돌연변이를보인비정형만성골수성백혈병 1 예 A Case of Atypical Chronic Myeloid Leukemia with the JAK2V617F Mutation 김주연 1 이세련 2 남명현 1 윤수영 1 임채승 1 이창규 1

More information

레이아웃 1

레이아웃 1 대한위장관기질종양연구회 01 GIST 06 02 11 03 Imatinib 14 04 05 06 07 Sunitinib 32 40 44 48 GIST 6 01 7 GIST Guide book GIST 8 01 9 GIST Guide book GIST (CT) MRI FDG-PET 10 02 11 GIST Guide book 12 02 (Imatinib)

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

(

( 317 318 319 320 1 3 5 5 5 5 2 321 : 1.,,,,, 06 2. X-ray beam penetration (density) (contrast) 03 3. patch coating, precipitation, flaking 03 4. centering 03 5. Esophagus, cardia, fundus, body, angle, antrum,

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

ECG & EP CASES Young-Keun On, MD, PhD Division of Cardiology, Department of Medicine Cardiac & Vascular Center, Samsung Medical Center Sungkyunkwan University School of Medicine, Seoul, Korea A case of

More information

04조남훈

04조남훈 Received : 2011. 11. 16 Reviewed : 2011. 11. 25 Accpeted : 2011. 12. 5 A Case Report of Prescribing Yanghyeolgeopung-tang(yangxuequfeng-tang) to Two Patients with Cervical Disc Herniation and Headache

More information

untitled

untitled Clinical Pediatric Hematology-Oncology Volume 24 ㆍ Number 2 ㆍ October 2017 ORIGINAL ARTICLE 소아에서발생한중증호중구감소증의임상적특성 천은재ㆍ황인찬ㆍ정현주ㆍ박준은 아주대학교의과대학소아과학교실 Eunjae Cheon, M.D., Inchan Hwang, M.D., Hyun Joo Jung,

More information

- 증 례 - - - 481

- 증 례 - - - 481 KISEP Case Report 15 4 2004 올란자핀에 의해 유발되고 과립구 콜로니 자극 인자로 치료된 무과립구증 환자 1예 이원희 김 원 채정호 전태연 박원명 가톨릭대학교 의과대학 정신과학교실 ABSTRACT A Case of Agranulocytosis Induced by Olanzapine and Treated with Granulocyte-Colony

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 정복이 안된 상태로 치료 시에는 추후 지속적인 족부 동통의 원인이 되며, 이런 동통으로 인해 종골에 대해 구제술이나 2차적 재건술이 필요할 수도 있다. 2) 경종골 거주상 관절 탈구는 외국 문헌에 증례

종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 정복이 안된 상태로 치료 시에는 추후 지속적인 족부 동통의 원인이 되며, 이런 동통으로 인해 종골에 대해 구제술이나 2차적 재건술이 필요할 수도 있다. 2) 경종골 거주상 관절 탈구는 외국 문헌에 증례 CSE REPORT 대한족부족관절학회지 제16권 제4호 2012 J Korean Foot nkle Soc. Vol. 16. No. 4. pp.270-275, 2012 종골 부정 유합에 동반된 거주상 관절 아탈구의 치료 (1예 보고) 인제대학교 의과대학 일산백병원 정형외과 차성무 장보훈 서진수 Treatment of Talonavicular Subluxation

More information

untitled

untitled 대한내과학회지 : 제 7 권제 3 호 6 만성호중구성백혈병 예 국립경찰병원내과, 진단검사의학과 홍순창 김지훈 이정민 정준오 김윤권 김소연 이경인 =Abstract= A case of chronic neutrophilic leukemia Sun Chang Hong, M.D., Ji Hoon Kim, M.D., Jung Min Lee, M.D., Jun Oh Chung,

More information

Kaes025.hwp

Kaes025.hwp 고위험군유두상갑상선암환자에대한방사성옥소최대허용선량측정법및치료법의검증 Verification of Measurement Methods and Therapeutic Efficacy of Maximum Permissible Dose of I-131 in High Risk Patients with Differentiated Papillary Thyroid Cancer

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770>

< C0CCB1E2BFED2DC0CCB8EDBDC D E687770> 원저 J Korean Neurol Assoc / Volume 24 / February, 200 젊은나이에산발성파킨슨병이생긴한국인환자의 Parkin 유전자변이 연세대학교의과대학신경과학교실, 영동세브란스병원신경과 Kee Ook Lee, M.D., Chul Hyoung Lyoo, M.D., Myung Sik Lee, M.D., Ph.D. Department of

More information

( )Jkstro011.hwp

( )Jkstro011.hwp 비인강암의방사선치료결과및생존율에관한예후인자분석 2005 2 1 2005 3 28. :, Tel: 053)250-7665, Fax: 053)250-7984 E-mail: jhkim@dsmc.or.kr 정영연외 2 인 : 비인강암의예후인자분석 정영연외 2 인 : 비인강암의예후인자분석 Carcinoma of the nasopharynx treated by radiotherapy

More information

±è¹ÎÁö

±è¹ÎÁö 531 김민지 외: 미숙아에 발생한 의인성 식도천공과 기종격증 및 종격동염 A B C D E F Fig. 1. Chest radiographs and CT scans of a premature infant. Chest radiograph at 6 days after birth (A) shows left paravertebral radiolucency at the

More information

<30372EC0CCC0AFC1F82E687770>

<30372EC0CCC0AFC1F82E687770> 산전 초음파상 진단된 단독 대조확장증의 출생 후 예후 울산대학교 의과대학 서울아산병원 산부인과학교실 이유진 원혜성 박상민 조현진 정 의 김선권 심재윤 이필량 김 암 Yu-Jin Lee, M.D., Hye-Sung Won, M.D., Sang-Min Park, M.D., Hyun-Jin Cho, M.D., Eui Jung, M.D., Sun-Kwon Kim,

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세

2016 학년도약학대학면접문제해설 문제 2 아래의질문에 3-4분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세 본문제에대한지적소유권은동국대학교에있습니다. 본교의서면허락없이무단으로출판, 게재, 사용할수없습니다. 문제 2 2016 학년도약학대학면접문제 아래의질문에 3-4 분이내로답하시오. 표피성장인자수용체 (epidermal growth factor receptor, EGFR) 는수용체티로신 인산화효소군 (receptor tyrosine kinases, RTKs) 의일종으로서세포의생존과증식

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

12이문규

12이문규 Review on Conservative Treatment of Spinal Scoliosis Moon-kyu Lee, O.M.D., Gil-jae Lee, O.M.D., Yun-kyung Song, O.M.D., Hyung-ho Lim, O.M.D. Dept. of Oriental Rehabilitation Medicine College of Oriental

More information

< FB5B5BAF1B6F32C20B8F1C2F D34292E687770>

< FB5B5BAF1B6F32C20B8F1C2F D34292E687770> Case Report J Sasang Constitut Med 2014;26(4):379-388 http://dx.doi.org/10.7730/jscm.2014.26.4.379 Abstract A Case Study of Soyangin Patient with Hyperhidrosis Treated Successfully with Hyungbangsabaek-san(

More information

황지웅

황지웅 Comparison of Laparoscopy and Exploration in the Distal Pancreatectomy BACKGROUND: To determine the benefits of laparoscopic surgery compared with exploration, the clinical outcomes of open and laparoscopic

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

슬라이드 1

슬라이드 1 인간생명과질병 2016. 5. 13 알기쉬운백혈병 강원대학교의학전문대학원내과학교실혈액종양내과분과이희영 ㄴ 림프구 백혈구 백혈구 적혈구 혈소판 http://www.youtube.com/watch?v=fjoyaaygqfe http://www.youtube.com/watch?v=fjoyaaygqfe http://www.youtube.com/watch?v=fjoyaaygqfe

More information

( )Kju225.hwp

( )Kju225.hwp 비임균성비뇨생식기감염에서 의진단적효용성 Usefulness of the Mycofast Test (MYCOFAST Evolution 2) for the Diagnosis of Nongonococcal Genitourinary Infections Hang Ro Park, Yang Hyun Kim, Ho Jae Lee, Jea Sang Oh, Hyoung Jin

More information

<313320C1F5B7CA D B9DAC7D8BFAD2DB1E8C0AFB8AE292E687770>

<313320C1F5B7CA D B9DAC7D8BFAD2DB1E8C0AFB8AE292E687770> 대한내과학회지 : 제 91 권제 1 호 2016 http://dx.doi.org/10.3904/kjm.2016.91.1.70 갑상선암환자에서방사성요오드치료후발생한만성골수성백혈병 2예 연세대학교의과대학강남세브란스병원 1 내과, 2 병리과, 3 핵의학과, 4 외과 박해열 1 최성은 2 유영훈 3 장항석 4 박정수 4 이경화 1 김유리 1 Chronic Myeloid

More information

005송영일

005송영일 Received : 2015. 12. 09 Reviewed : 2015. 12. 16 Accepted : 2015. 12. 16 Sternal Fracture occurred after Thai Massage : A Case Report Young-Il Song, K.M.D. 1, Dong-Eun Kim, K.M.D. 1 1 Department of Rehabilitation

More information

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w

YI Ggodme : The Lives and Diseases of Females during the Latter Half of the Joseon Dynasty as Reconstructed with Cases in Yeoksi Manpil (Stray Notes w 497 의사학 제24권 제2호(통권 제50호) 2015년 8월 Korean J Med Hist 24 ː497-532 Aug 2015 c대한의사학회 http://dx.doi.org/10.13081/kjmh.2015.24.497 pissn 1225-505X, eissn 2093-5609 역시만필( 歷 試 漫 筆 ) 의 사례로 재구성한 조선후기 여성의 삶과 질병

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

Connexin 26 의유전자변이 서론 재료및방법 대상 방법 Korean J Audiol Volume 5 December, 2001

Connexin 26 의유전자변이 서론 재료및방법 대상 방법 Korean J Audiol Volume 5 December, 2001 KISEP Original Articles Korean J Audiol 52:105-110, 2001 선천성고도난청에서 Connexin 26 의유전자변이의형태분석 이상흔 1 이정래 1 이지은 1 김태정 2 강봉석 2 Molecular Genetic Analysis of Connexin 26 in Congenital Profound Hearing Loss Sang

More information

16(2)-7(p ).fm

16(2)-7(p ).fm w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare

More information

기관고유연구사업결과보고

기관고유연구사업결과보고 기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

76 유수진 강수경 서을주외 3 인 증 례 증례 년 3월부터 2001년 3월까지서울중앙병원에서 acml로진단된 4예의현병력, 치료및경과는다음과같으며, 그들의임상소견, 말초혈액및골수검사결과는 Table 2 및 Table 3과같다. Table 1. The per

76 유수진 강수경 서을주외 3 인 증 례 증례 년 3월부터 2001년 3월까지서울중앙병원에서 acml로진단된 4예의현병력, 치료및경과는다음과같으며, 그들의임상소견, 말초혈액및골수검사결과는 Table 2 및 Table 3과같다. Table 1. The per 대한임상병리학회지 : 제 22 권제 2 호 2002 Korean J Clin Pathol 2002; 22: 75-9 진단혈액학 비전형만성골수성백혈병 4 예 유수진 강수경 서을주 박찬정 이규형 * 지현숙 울산대학교의과대학서울중앙병원임상병리학교실, 내과학교실 * Four Cases of Atypical Chronic Myeloid Leukemia Soo Jin

More information

156 Korean J Clin Lab Sci. 2011, 43(4) : ISSN Change of Blood Cells Number from Capillaries and Venous Blood of 20 s Healthy Adults

156 Korean J Clin Lab Sci. 2011, 43(4) : ISSN Change of Blood Cells Number from Capillaries and Venous Blood of 20 s Healthy Adults 156 ISSN 1738-3544 Change of Blood Cells Number from Capillaries and Venous Blood of 20 s Healthy Adults Ji-Yeong Seon and Jae Sik Lee Department of Clinical Laboratory Science, Hyejeon College, Hongseong

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

미래의학 - 맞춤형의학 유전자가위

미래의학 - 맞춤형의학 유전자가위 미래의학 유전자가위 / 맞춤형의료 Dr. Shoukhrat Mitalipov AUGUST 2, 2017 Center for Embryonic Cell and Gene Therapy, Oregon Health & Science University, Portland, Oregon, USA Knight Cardiovascular Institute, Oregon Health

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

J Korean Acad Pediatr Dent 38(1) 2011 Ⅱ. 증례 보고 환아는 2001년 6월생으로 2009년 7월 6일 하악 좌, 우측 유 중절치의 만기잔존을 주소로 서울대학교병원 소아정형외과에서 서울대학교치과병원 소아치과로 의뢰되어 본원에 내원하였다.

J Korean Acad Pediatr Dent 38(1) 2011 Ⅱ. 증례 보고 환아는 2001년 6월생으로 2009년 7월 6일 하악 좌, 우측 유 중절치의 만기잔존을 주소로 서울대학교병원 소아정형외과에서 서울대학교치과병원 소아치과로 의뢰되어 본원에 내원하였다. 대한소아치과학회지 38(1) 2011 Fibrodysplasia ossificans progressiva 환자의 증례보고 및 치과 치료시 고려 사항 권영선 현홍근 김영재 장기택 이상훈 김종철 한세현 김정욱 서울대학교 치과대학 소아치과학교실 국문초록 Fibrodysplasia ossificans progressiva(fop)는 연조직의 진행성 이소성 골경화를

More information

Trd022.hwp

Trd022.hwp 김신태, 이선녕, 이석정, 정필문, 박홍준, 신명상, 김종환, 이부길, 김상하, 리원연, 신계철, 용석중 Shin-Tae Kim, M.D., Shun Nyung Lee, M.D., Seok Jeong Lee, M.D., Pil Moon Jung, M.D., Hong Jun Park, M.D., Myung Sang Shin, M.D., Chong Whan Kim,

More information

16_이주용_155~163.hwp

16_이주용_155~163.hwp 사상체질의학회지 2008;20(2):155-163 J of Sasang Constitutional Medicine Vol. 20, No. 2, 2008:155-163 http://www.esasang.com 腦 梗 塞 으로 발생한 少 陽 人 半 身 舞 蹈 病 患 者 치험 1례 이주용 이한얼 한경수 안택원 Abstract 대전대학교 한의과대학 사상체질과 A Soyangin

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

인사말 과거에 불치의 병으로만 알려져 있던 백혈병 등 여러 혈액 질환들이 현재에는 표적치료제를 포함한 항암화학요법과 조혈모세포이식의 발전으로 많은 경우 완치 또는 장기간 관리가 가능합니다. 하지만, 혈액암 진단을 받은 환우분과 가족들은 누구나 엄청난 충격과 혼란을 경험

인사말 과거에 불치의 병으로만 알려져 있던 백혈병 등 여러 혈액 질환들이 현재에는 표적치료제를 포함한 항암화학요법과 조혈모세포이식의 발전으로 많은 경우 완치 또는 장기간 관리가 가능합니다. 하지만, 혈액암 진단을 받은 환우분과 가족들은 누구나 엄청난 충격과 혼란을 경험 대한혈액학회 The Korean Society of Hematology 인사말 과거에 불치의 병으로만 알려져 있던 백혈병 등 여러 혈액 질환들이 현재에는 표적치료제를 포함한 항암화학요법과 조혈모세포이식의 발전으로 많은 경우 완치 또는 장기간 관리가 가능합니다. 하지만, 혈액암 진단을 받은 환우분과 가족들은 누구나 엄청난 충격과 혼란을 경험하게 됩니다. 치료

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

<30352EB0A3BAB4B8AE2E687770>

<30352EB0A3BAB4B8AE2E687770> The Korean Journal of Hepatology 2007 ; 13 : 571-575 DOI: 10.3350/kjhep.2007.13.4.571 이번 호의 간 병리(32) 혼합 간세포-담관세포암종 순천향대학교병원 병리과 진윤미 진소영 Combined Hepatocellular-cholangiocarcinoma Yoon-Mi Jeen, M.D. and

More information

Korean J Lab Med 2010;30: DOI /kjlm Case Report Diagnostic Hematology Diamond-Blackfan Anemia Confirmed by RPS19 Gene Mutat

Korean J Lab Med 2010;30: DOI /kjlm Case Report Diagnostic Hematology Diamond-Blackfan Anemia Confirmed by RPS19 Gene Mutat Korean J Lab Med 2010;30:249-54 DOI 10.3343/kjlm.2010.30.3.249 ase Report Diagnostic Hematology Diamond-Blackfan Anemia onfirmed by RPS19 Gene Mutation Analysis: A ase Study and Literature Review of Korean

More information

석사논문.PDF

석사논문.PDF ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 1 ABO Rh A study on the importance of ABO and Rh blood groups information in Public Health 2000 2 2 ABO Rh

More information

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770>

<35335FBCDBC7D1C1A42DB8E2B8AEBDBAC5CDC0C720C0FCB1E2C0FB20C6AFBCBA20BAD0BCAE2E687770> Journal of the Korea Academia-Industrial cooperation Society Vol. 15, No. 2 pp. 1051-1058, 2014 http://dx.doi.org/10.5762/kais.2014.15.2.1051 멤리스터의 전기적 특성 분석을 위한 PSPICE 회로 해석 김부강 1, 박호종 2, 박용수 3, 송한정 1*

More information

슬라이드 1

슬라이드 1 Recent update on clinical genetic and genomic testing 2016. 9. 12 짂단검사의학과김명싞 짂단검사의학 인체로부터채취되는각종검체로어떤물질을검사 질병의선별및조기발견, 짂단및경과관찰, 치료및예후판정에기여 질병의기전과병인론을연구 검사를처방하는의사들의자문에응하여유효핚임상적성과를얻게하는전문짂료과목 Divisions in

More information

<5B30325DC8ABBDC2BAB92E687770>

<5B30325DC8ABBDC2BAB92E687770> 대한임상검사학회지 : 37 권제 3 호, 143-148, 25 Coulter LH 75 TM 에의한백혈구감별계산및 Suspect Flags 의평가 분당제생병원진단검사의학과 홍승복 최종태 이성규 김현수 Evaluation of Coulter LH 75 TM on Leukocyte Differential Count and Suspect Flags Seung-Bok

More information

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc

Kinematic analysis of success strategy of YANG Hak Seon technique Joo-Ho Song 1, Jong-Hoon Park 2, & Jin-Sun Kim 3 * 1 Korea Institute of Sport Scienc Kinematic analysis of success strategy of technique JooHo Song 1, JongHoon Park 2, & JinSun Kim 3 * 1 Korea Institute of Sport Science, 2 Catholic Kwandong University, 3 Yonsei University [Purpose] [Methods]

More information

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR

388 The Korean Journal of Hepatology : Vol. 6. No COMMENT 1. (dysplastic nodule) (adenomatous hyperplasia, AH), (macroregenerative nodule, MR 6 3 2000 ; 387-392 (3) Dysplastic Nodule Young Nyun Park, M.D., Chanil Park, M.D. Department of Pathology, Yonsei University College of Medicine BRIEF HISTORY 56. AST/ALT 72/73 IU/L, total bilirubin 0.7

More information

975_983 특집-한규철, 정원호

975_983 특집-한규철, 정원호 Focused Issue of This Month Gyu Cheol an, MD Department of Otolaryngology ead & Neck Surgery, Gachon University of College Medicine E - mail : han@gilhospital.com Won-o Jung, MD Department of Otolaryngology

More information

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285

2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914 ) ( ) ( ) 4) 1915 ( ) ( ) 1917 2) 3) 4) 285 13 2 ( 25 ) 2004 12 Korean J Med Hist 13 284 296 Dec 2004 ISSN 1225 505X 1) * ** ** 1 1920 1930 40 ( 1896-1973) 80 * ** 1) 2003 284 2 1896 2 26 ( ) 2 7-20 2) 1897 1898 ( )3) 6 1902 8 1904 10 10 (19 05-1914

More information

,......

,...... The Impact of Personal Traits, Family Characteristics, and Job Satisfaction on the Psychological Well-Being of Middle Aged Men from the Baby Boomer Generation Working in Large Corporations Department of

More information

ISSN (print) J Korean Acad Pediatr Dent 40(2) 2013 ORAL FINDINGS AND TREATMENT OF A PATIENT WI

ISSN (print) J Korean Acad Pediatr Dent 40(2) 2013 ORAL FINDINGS AND TREATMENT OF A PATIENT WI http://dx.doi.org/10.5933/jkapd.2013.40.2.133 ISSN (print) 1226-8496 ORAL FINDINGS AND TREATMENT OF A PATIENT WITH CYCLIC NEUTROPENIA Eun-Joo Kang, Nam-Ki Choi, Seon-Mi Kim Department of Pediatric Dentistry,

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

歯1.PDF

歯1.PDF 200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)

More information

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할

저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할 저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,

More information

ÀÇÇа�ÁÂc00Ì»óÀÏ˘

ÀÇÇа�ÁÂc00Ì»óÀÏ˘ Common Allergic Diseases in Children Sang - Il Lee, M.D. Department of pediatrics Sungkyunkwan University School of Medicine, Samsung Medical Center E - mail : silee@smc.samsung.co.kr Abstract Allergy

More information

원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현

원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 연세대학교대학원 의학과 남상현 원위부요척골관절질환에서의초음파 유도하스테로이드주사치료의효과 - 후향적 1 년경과관찰연구 - 지도김석원교수 이논문을석사학위논문으로제출함

More information

A Study on the Relationships between Self-Differentiation and Adaptability Factors for Senior Dementia Patients Care Givers Department of Social Welfare, Seoul Welfare Graduate University Full-time Lecturer

More information

페링야간뇨소책자-내지-16

페링야간뇨소책자-내지-16 야간뇨의진단과치료 - 실제적접근 - Reference 1. Choo MS, Ku JH, Park CH et al. Prevalence of Nocturia in a Korean Population Aged 40 to 89 Years. Neurourol Urodyn 2008; 27:60-64. 2. Weiss JP. Prevalence

More information

Korean Journal of Clinical Oncology 2016;12: pissn eissn Original Article 유방암으로항암치료받는환자

Korean Journal of Clinical Oncology 2016;12: pissn eissn Original Article 유방암으로항암치료받는환자 Korean Journal of Clinical Oncology 2016;12:55-59 http://dx.doi.org/10.14216/kjco.16009 pissn 1738-8082 eissn 2288-4084 Original Article 유방암으로항암치료받는환자에서발생하는과도한골수억제의예측인자 이정석, 이혜윤, 성낙송, 전기원, 문주익, 이상억, 최인석,

More information

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: 3 * The Effect of H

Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI:   3 * The Effect of H Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.577-601 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.577 3 * The Effect of Home-based Activities Using Traditional Fairy Tales

More information

<30342E20B1E8C7F6BFEC2C20B1E8C8A3C1D82C20B9DABFB5C8B82E687770>

<30342E20B1E8C7F6BFEC2C20B1E8C8A3C1D82C20B9DABFB5C8B82E687770> 교통사고환자에서의외상후스트레스장애에대한문헌고찰 東醫寶鑑을중심으로 Review of Post Traumatic Stress Disorder(PTSD) Symptoms in Traffic Accident Patients. Hyun-Woo Kim, O.M.D., Ho-Jun Kim, O.M.D., Young-Hoi Park, O.M.D., Dong-Ho Keum,

More information

<342EBEC8BCBABFAD2CB9DAC7E2C1D82E687770>

<342EBEC8BCBABFAD2CB9DAC7E2C1D82E687770> 大 韓 癩 學 會 誌 : 第 41 卷, 第 1 號 2008 Korean Leprosy Bulletin, Vol. 41, No. 1, June, 2008 마비성 하안검 외반증에 대한 lateral tarsal strip의 재조명 안성열 성형외과의원 1), 제일병원 피부과 2) 안성열 1), 박향준 2) - Abstract - Reappraisal of the

More information

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3

54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3 27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,

More information

Click to add title

Click to add title Genetic and Conventional Tests of PNH 2010. 8. 25. 원자력병원진단검사의학과 장윤환 Agenda 1. Mutation analysis of the PIGA gene 2. Cytogenetic study 3. Ham test and sucrose hemolysis test 4. Gel microtyping system (Gel

More information

Problem New Case RETRIEVE Learned Case Retrieved Cases New Case RETAIN Tested/ Repaired Case Case-Base REVISE Solved Case REUSE Aamodt, A. and Plaza, E. (1994). Case-based reasoning; Foundational

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

슬라이드 1

슬라이드 1 인간생명과질병 백혈병 강원대학교의학전문대학원내과학교실혈액종양내과분과이희영 ㄴ 림프구 백혈구 백혈구 적혈구 혈소판 http://www.youtube.com/watch?v=fjoyaaygqfe http://www.youtube.com/watch?v=fjoyaaygqfe http://www.youtube.com/watch?v=fjoyaaygqfe http://www.youtube.com/watch?v=fjoyaaygqfe

More information

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI: * The

Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp DOI:   * The Journal of Educational Innovation Research 2017, Vol. 27, No. 1, pp.243-268 DOI: http://dx.doi.org/10.21024/pnuedi.27.1.201703.243 * - 2001 2015 - The Research Trends on Peer Counseling in Elementary and

More information

2. 0. 0. 3 6 CO N T E N T S

2. 0. 0. 3 6 CO N T E N T S http://www.bloodcancer.or.kr 2. 0. 0. 3 6 Tel 02-3432-0807 Fax 02-3432-0609 Home page http://www.bloodcancer.or.kr e - mail sbnuri@dreamwiz.com 2. 0. 0. 3 6 CO N T E N T S Mo n t h l ysc h e d u l e

More information