05 (12-22-OK).hwp

Save this PDF as:
 WORD  PNG  TXT  JPG
Size: px
Start display at page:

Download "05 (12-22-OK).hwp"

Transcription

1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 45(5), 664~67(216) 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 이기호 1 심미옥 1 송용수 2 정호경 1 장지훈 1 김민석 1,3 김태묵 1 이효은 1 안병관 1 정원석 1 1 한약진흥재단한약자원본부 2 해남자연농업영농조합법인 3 원광대학교한의학과 Effects of Poly-Gamma Glutamate Contents Cheonggukjang on Osteoblast Differentiation Ki Ho Lee 1, Mi-Ok Sim 1, Yong Su Song 2, Ho Kyung Jung 1, Ji-Hun Jang 1, Min-Suk Kim 1,3, Tae Mook Kim 1, Hyo Eun Lee 1, Byeong-Kwan An 1, and Won Seok Jung 1 1 Traditional Korean Medicine Research Team, National Development Institute of Korean Medicine 2 Heanam Natural Farming Association Cooperation 3 Department of Pathology, College of Korean Medicine, Wonkwang University ABSTRACT Cheonggukjang (CKJ) is a Korean traditional food made of fermented soybeans. In comparison to normal intake of soybeans, Cheonggukjang has high digestibility with bioactive, antioxidant substances, and thrombolytic enzymes. Recent studies have reported anti-oxidant, anti-cancer, anti-inflammatory, anti-obesity activities as well as inhibitory activities against osteoporosis for CKJ. In this study, we identified the effects of CKJ on osteoblast differentiation by increasing the polyglutamic acid (PGA) content of CKJ. Alkaline phosphatase (ALP) activity and mineralization significantly increased in response to treatment with both natural CKJ (CKJ A) and PGA-increased CKJ (CKJ B). However, CKJ B exhibited higher ALP activity and mineralization than CKJ A. Real-time reverse transcription PCR demonstrated that mrna expression of osteoblastic-associated genes such as type Ⅰ collagen, alkaline phosphatase, osteocalcin, and osteopontin in C2C12 cells was significantly up-regulated by CKJ A or B treatment. These results indicate that treatment with CKJ has an anabolic effect on bone by increasing osteoblastic differentiation and ALP activity. Increasing PGA content in CKJ had a greater effect than CKJ A on up-regulation of osteoblastic gene expression in osteoblast cells. Key words: ALP, Cheonggukjang, osteoblast, osteocalcin, osteopontin 서 현대에는평균수명의연장으로노인질환의관리가중요문제로대두하고있으며, 그중골다공증은유전적요인이나식이, 생활방식과같은환경적요인에의해영향을받는복합적인질병이다 (1,2). 골다공증은단위용적내의골량이골의화학적조성의큰변화없이감소하는질환으로이로인해쉽게골절을일으킬수있으며폐경후여성들에게가장그발생빈도가높게나타나는질환이다 (3). 뼈는체내구조를이루고골격계를구성하는역할을함으로써파골세포에의한골흡수와새로운골기질을형성하는조골세포가서로균형을이루면서무기질화과정이끊임없이일어나는동적인조직이다 (4). 정상성인에서는골흡수 Received 21 December 215; Accepted 28 March 216 Corresponding author: Won Seok Jung, Traditional Korean Medicine Research Team, National Development Institute of Korean Medicine, Jeonnam 59338, Korea i823@nate.com, Phone: 론 량과골형성량이항상성을유지하고있고, 뼈는일정한주기로재형성을이루게된다 (5). 이러한골격계의구조와기능은호르몬과국소적인자의상호작용에의해조절되며, 조골세포와파골세포활성간의불균형은전체적인뼈의감소나증가로인한골격계의이상을나타낸다 (3). 골손실이일어나게되면뼈를원상태로복구하는것은어려우며, 보통뼈의소실이더는진행되지않게치료하는방법을사용하고있다 (2,6). 대표적인방법으로에스트로겐, 칼시토닌, 비스포스테이트제제가이용되고있으며 (7,8), 그중에스트로겐투여가기본적으로사용되고있으나장기적인사용은오심, 두통, 체중증가, 유방암발생을초래하여장기적인사용은기피하는실정이다 (9-11). 이러한이유로비교적부작용이적은장점으로인해천연물질을이용한신약개발과질병의치료가보편화되면서골다공증의치료에이를응용하려는연구또한많이보고되고있다. 청국장은우리나라를대표하는전통적인발효식품으로써일반콩섭취시보다소화흡수율이높은이점을가지고

2 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 665 있으며, 이소플라본, 피틴산, 사포닌, 토코페롤, 불포화지방산, 식이섬유, 올리고당등의각종생리활성물질과항산화물질및혈전용해효소가다량함유된것으로밝혀져있다 (12-15). 또한청국장은항산화, 항암, 항염증, 항비만, 골다공증개선효과등의다양한생리활성이보고돼있으며, 이러한이유로건강기능식품으로서청국장관련제품의소비가더욱증가하고있다 (16-18). 특히발효한청국장에서나타나는끈끈한실형태의물질을 γ-polyglutamic acid(γ- PGA) 라하는데 D,L-glutamic acid의중합체로청국장과 Natto의주성분으로알려졌다 (19). γ-pga는수용성, 음이온성, 무독성, 생분해성, 생체적합성, 식용등의다양한특성이있으며, 침전제, 동결방지제, 쓴맛감소제, 동물사료첨가제등으로이용되고있다. 또한의료분야에서는약물전달체, 의료용생물접착제, 골다공증예방등에이용되고있는것으로알려졌다 (2). 따라서본연구에서는청국장의유효성분으로보고되어있는 γ-pga에대한함량을증대시키고이를 HPLC를이용하여기존청국장 ( 청국장 A) 과 γ-pga가증대된청국장 ( 청국장 B) 의 γ-pga 함량을비교탐색하였다. 또한유효성분을증대시킨청국장이기존청국장보다조골세포분화에어떠한효과를미치는지검색하고자하였다. 재료및방법실험재료 γ-pga의함유량이증대되도록시료를준비하기위하여청국장발효에사용된동일균주를사용하여 Bang 등 (21) 의방법을변형하여액체배양물 3 L를준비하였다. 그중일부를사용하고나머지는냉동보관하였다. 액체배양물제조의영양원으로 soybean 1%, glutamic acid 1%, sucrose 1%, NH 4Cl.2%, KH 2PO 4.1%, MgSO 4 7H 2O.1% 의조성이되도록준비하여사용하였으며, Jar Fermentor(LiFlus GX, Hanil Science Industrial, Incheon, Korea) 에 37 C, 15 rpm, 1. L/air min 조건으로 36시간동안배양하였다. 본실험에사용된시료청국장 B는발효후 55 C에서 48시간건조해분쇄한가루 1 g과액체배양물 1 ml를 1:1 (v:v) 의비율로균일하게혼합한다음 5 C에서 48시간건조한후사용하였다. 표준및시험용액조제표준물질인글루탐산 1 mg을정밀히칭량하여 1 ml 부피플라스크에넣어증류수에용해하여표준원액으로이용하였으며, 이를 2배씩희석하여사용하였다. 또한두종류의청국장시료 2 g을정밀히칭량하여 5 ml 부피플라스크에넣고, 증류수에녹인후 3분간초음파로추출하였다. 추출한용액을원심분리기를이용해 15, rpm에서 25분간 4 C로처리하였고, 그상등액을 1 ml 취하여내열성플라스크에담고 6 N 염산 1 ml를가하여오븐에넣어 11 C에서 24시간동안가수분해하였다. 이를 5 ml 부피플라스크 에옮겨증류수로정용하여희석한후, 그중 1 ml를취하여 5 ml 부피플라스크에넣은다음증류수로정용하여.2 N에가까운농도로희석하였다. 이렇게희석한시료는필터하여총 glutamic acid의시험용액으로하였다. 또한가수분해하지않은용액을사용해유리글루탐산의시험용액으로하였다. 폴리감마글루탐산의 HPLC 분석 PGA의함량분석에사용한고성능액체크로마토그래피 (HPLC) 는 Agilent 12 series(agilent Technologies Inc., Santa Clara, CA, USA) 를사용하였으며, 검출기는 FLD (fluorescence detector) 와 DAD(diode array detector) 를사용하였다. 샘플의주입은 Agilent auto-sampler(agilent Technologies Inc.) 의 injection program을사용해주입하였다. Column은 Agilent ZORBAX Eclipse AAA( mm, 5 μm, Agilent Technologies Inc.) 를사용하였으며, 이동상 (mobile phase) 으로는 Solvent A[4 mm sodium phosphate(dibasic),.1% phosphoric acid in water], Solvent B(acetonitrile : methanol : DW=45:45:1) 를사용하여 gradient 조건에서 1.5 ml/min의유속으로분석하였다. 이동상의기울기조건은 Table 1에표기하였다. 분석시약으로는유도체화시약인 OPA와 Borate buffer를사용하였으며, Agilent auto-sampler의 injection program을통해기기내에서의시약반응을통한주입을진행하였다. 주입한표준및시험용액은이용해 DAD(254, 338 nm) 와 FLD(Ex 23 nm, Em 45 nm) 를통해 chromatogram으로기록되었으며, peak의적분값을이용해총글루탐산함량 (%) 및유리글루탐산함량 (%) 을계산하였다. 분석및계산 PGA는글루탐산의펩티드결합으로이루어진중합체로 LC 분석을통한함량분석시글루탐산의총함량이필요하다. 따라서 PGA의함량은가수분해한총글루탐산의함량에서유리글루탐산의함량을뺀값이라할수있다. 따라서 PGA 의 LC를이용한함량계산은다음식을이용해계산하였다. PGA 함량 (mg/g)=( 총 glutamic acid.88)- free glutamic acid 함량.88=129(PGA의 glutamic acid 잔기의분자량 )/147 (glutamic acid 분자량 ) Table 1. Gradient condition of solvent A and B for PGA quantitative analysis Time A% (4 mm Na 2HPO 4,.1% phosphoric acid) Mobile phase B% (acetonitrile : methanol : Dw=45:45:1) 3 3

3 666 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 Cell culture 마우스 C2C12 각 4, cell/22 mm well로분주하고 DMEM(Dulbecco's modified Eagle's medium, Gibco Laboratories, Grand Island, NY, USA) 에 1% FBS(fetal bovine serum, Gibco Laboratories) 와항생제 (1% antibiotic antimycotic solution, Sigma-Aldrich Co., St. Louis, MO, USA) 를처리한후 37 C, 5% CO 2 하에서배양하였다. C2C12가 8% 자랐을때분화유도를위해 5% FBS, 1 ng/ml의 rhbmp-2를포함하는 DMEM으로교체하였다. Table 2. Real-time PCR primers used in this study Gene Primer sequence 5'-3' OPN Forward GTAGGGACGATTGGAGTGAAAG GGAAACCAGCCAAGGACTAA COL1A ALP OCN Forward Forward Forward CTCCCAGAACATCACCTATCAC GGTGGAGAAAGGAGCAGAAA GCCATGACATCCCAGAAAGA CAGATACAGGCAAGGCAGATAG ACACCATGAGGACCATCTTTC AGCTGCTGTGACATCCATAC 조골세포의 alkaline phosphatase(alp) 활성분화된조골세포를 PBS로세척한다음.1% Triton X- 1을 2 μl씩첨가하여 37 C에서 3분간 lysis 하였다. Lysis 된 cell의상층액 5 μl는단백질정량에사용하였고, 나머지상층액에 2 μl의.1 N glycine과 1 μl의 1 mm ρ-nitrophenylphosphate(ρ-npp) 를첨가한후다시 37 C에서 3분간반응시켰다. 반응후 2 μl의.1 N NaOH로반응을중지하고, 45 nm에서흡광도를측정하였다. ALP 활성은 ρ-npp로부터생성된 ρ-nitrophenol(ρ- NP) 을측정하여 ρ-np에대한표준그래프를작성한후활성도를대조군과의상대비교를통해도출하였다. 석회화결절형성측정배양후배지를제거하고 PBS로가볍게세척한후 7% ethanol을가하고 4 C에서 1시간동안고정하였다. 세포를증류수로세척하고 2% alizarin red solution(ph 4.2) 으로실온에서 1분간염색하였다. 비특이적인염색을줄이기위해증류수로 5번세척한후 PBS를가하고 15분방치하였다. PBS를제거한후 1%(w/v) cetylpyridinium chloride를첨가한 1 mm sodium phosphate(ph 7.) 용액을각 well 에첨가하고실온에서 15분간반응시켜서얻은 alizarin red 추출액을 96-well plate로옮기고 562 nm에서흡광도를측정하였다. 4회반복수행하였다. 통계분석실험의정량적인결과는평균값과표준편차로표시하였다. 통계적인차이는 Student's t-test를이용하여분석하였고 P 값이.5 이하인경우통계적으로유의성이있다고판정하였다. 결과및고찰글루탐산의분석조건선정및직선성시약을통해유도체화한글루탐산의 detector별 chromatogram의 peak를비교해분석에적당한 detector를선정하였다. 그결과 UV 254 nm에서는 peak를확인할수없었으며, 338 nm에서약간의 peak가나타나는것을확인하였다. 그리고 FLD(Ex 23 nm, Em 45 nm) 에서 UV보다뚜렷한 peak가나타나는것을확인하였다. 글루탐산의표준용액을.1~12.5 μg/ml의범위로용해시켜 HPLC를이용해분석하였으며, 각각의농도에따른검량선상관계수가.999 이상의직선성을보이는것을확인하였다. 또한청국장의총 glutamic acid 및 free glutamic acid의함량이글루탐산표준용액의회귀곡선범위안에포함되는것을확인하였다 (Table 3, Fig. 1). 유전자발현 real-time PCR 수확한세포는 TriPure Isolation Reagent(Roche Diagnostics, Mannheim, Germany) 를이용하여 RNA를분리하였다. 5 μg의 mrna를 High Capacity cdna Transcription Kit(Applied Biosystem, Foster City, CA, USA) 을이용하여 cdna로합성하였다. 실험은제조사매뉴얼에따라수행하였다. 합성된 cdna 1 μl, TaqMan primer 1 μl, TaqMan Universal Master Mix Ⅱ(Applied Biosystem) 1 μl, 3차증류수 8 μl를넣고 real-time PCR 기기 (ABI75, Applied Biosystem) 를이용하여 PCR 을수행하였다. 정량중합효소반응에쓰인 gene의정보는 Table 2에서나타내었다. 또한 real-time PCR 반응조건은 5 C에서 2분, 95 C에서 1분동안 1회수행하고, 변성온도 95 C에서 15초어닐링, 온도 6 C에서 15초인사이클을 청국장시료의 PGA 함량분석 HPLC-FLD를이용해균주별청국장함유량을확인하기위해기존의일반적인방법으로발효시킨청국장 A와 PGA 의증대를위한공정시술개발로발효시킨청국장 B의시료 Table 3. Area values of the respective concentrations (n=3) Level Amount Area (mean) SD RSD

4 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 667 청국장시료의세포독성평가 C2C12 세포주에서청국장시료의독성을각각조사하기위해 MTS 실험을수행하였다. 각각 C2C12 세포에농도별 (62.5, 125, 25, 5 μg/ml) 로각각의청국장시료를처리하고 72시간후에 MTS를처리한결과모든농도에서독성이나타나지않았다 (Fig. 3). Fig. 1. The calibration curve of glutamic acid. 를같은실험방법을이용해분석을진행하였으며, 그결과시료각각 3.6±.86%, 5.231±.193% 의함량이측정되었으며, 청국장 B가 A보다약 1.7배의 PGA 함량증가를확인하였다 (Table 4, Fig. 2). A B 청국장시료의골석회화형성에미치는영향골석회화형성능은조골세포의분화에중요한표식인자로서칼슘에특이적으로흡착력이높은식물성염료인 alizarin을이용해염색하였다 (22,23). 이것은세포의기질이무기질화된부분에염색되어석회화된양과염색정도가상호비례하기때문에여러논문에서이를이용하여골석회화형성도를확인하였다 (24-27). 청국장 A와 B 시료의농도에따른석회화형성도를확인하기위해염색된석회화물을 1% cetylpyridinium chloride로녹여흡광도값을측정하여상대활성을 Fig. 4에나타내었다. 청국장을처리한모든군에서시료를처리하지않은군보다농도의존적으로높은골석회화형성능을보였으며, 청국장 A보다청국장 B가더높은골석회화형성능을보였다. 최근 Choi 등 (28) 의연구에서도대두에탄올추출물을조골세포에처리하였을때대조군보다골석회화형성이유의적으로증가하였다. 이를바탕으로대두를기반으로한청국장이조골세포의분화를촉진시키며, 특히 PGA 함유량이증가한청국장 (CKJ B) 이일반청국장 (CKJ A) 보다더 C Fig. 2. LC chromatogram of glutamic acid (A), CKJ A (B), and CKJ B (C). CKJ A: natural Cheonggukjang, CKJ B: PGAincreased Cheonggukjang. Fig. 3. Effect of CKJ on cell viability in C2C12 cells. Cell viability was evaluated with the MTS assay. Data represent the mean±sd of triplicate determinations from three separate experiments. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. Table 4. PGA contents of the CKJ A and CKJ B prepared with various microorganisms Sample CKJ A CKJ B PGA contents (%) 1 time 2 time 3 time CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. Mean SD RSD

5 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 668 μg/ml 62.5 μg/ml 125 μg/ml 25 μg/ml 5 μg/ml CKJ A CKJ B Fig. 4. Effect of CKJ on mineralization in C2C12 cell by alizarin Red S Staining. Data represent the mean±sd of triplicate determinations from three separate experiments. P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. 높은 골 석회화 형성능을 가지는 것으로 생각한다. 청국장이 조골세포 분화 유전자 발현에 미치는 영향 골의 형성과정에 조골세포의 분화는 유전형질의 발현에 청국장 시료의 ALP 활성에 미치는 영향 의해 조절되며, 배양방법에 따라 고유의 특성이 있다. 즉 증 염기성 인산분해효소(ALP)는 대부분의 조직에 존재하 식과 분화 석회화 과정을 거치며 type Ⅰ collagen(col1), 며, 특히 골조직에 존재하는 ALP는 골 성장이 활발히 일어 ALP, osteocalcin(ocn), osteopontin(opn) 등의 골 관련 날 때 그 활성이 증가하게 된다(29). Jeon과 Kim(3)이 보 형질표현 유전자가 발현된다(31). OCN은 성숙한 조골세포 고한 연구 결과에서는 톳 분획물이 ALP의 발현을 증가시키 므로 조골세포의 분화에 영향을 준다고 제시하였으며, 또한 황금 추출물, 아보카도 과피 및 씨 추출물에서 조골세포의 ALP 활성을 증가시킴에 따라 조골세포의 분화가 증대된 것 으로 보고하였다(2,3). 따라서 조골세포의 활성을 알아보는 생화학적 지표로써 ALP 활성을 측정하는 방법이 일반화되 어 있으므로 청국장이 ALP 활성에 미치는 영향을 검토하였 다. 청국장을 농도별로 처리한 결과 모든 시료를 처리한 군에 서 시료를 처리하지 않은 대조군보다 높은 ALP 활성을 나타 내었다. 특히 청국장 B는 대조군보다 약 2배의 높은 활성을 나타내었으며, 청국장 B가 청국장 A보다 더 높은 ALP 활성 을 나타내었다. 따라서 청국장이 조골세포의 ALP 활성을 증가시켜 조골세포의 분화에 영향을 미칠 것으로 생각하며, 청국장 B가 청국장 A보다 골 석회화 형성을 촉진시킬 것으 로 생각한다(Fig. 5). Fig. 5. Effect of CKJ on the alkaline phosphatase activities of the C2C12 osteoblastic cell during differentiation. Data represent the mean±sd of triplicate determinations from three separate experiments. P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGAincreased Cheonggukjang.

6 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 669 A B C D Fig. 6. Effect of CKJ on mrna expression of osteoblast-related genes in of the C2C12 osteoblastic cell during differentiation. (A) osteocalcin (OCN), (B) type Ⅰ collagen (Col1), (C) alkaline phosphatase (ALP), and (D) osteopontin (OPN). Data represent the mean±sd of triplicate determinations from three separate experiments P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. 에서발현되는유전자로서일반적으로골기질의석회화를촉진하는요인으로작용하는것으로알려졌다 (32,33). 또한 OCN은 bone morphogenetic proteins(bmps) 에의해발현이촉진되며, 특히 BMP-4에의해발현이증가한다 (33). OCN의발현은골이석회화되어결절을형성하는시기와일치하는반면, OPN은 OCN과달리조골세포분화의초기와석회화기에나타난다. Col1은 Runx2의발현이증가할때유도되며이는뼈의무기질화를촉진한다 (32). ALP의발현역시증대되면조골세포의분화를촉진한다고알려졌다. 이를토대로본실험에서는청국장이조골세포분화와관련된유전자발현에미치는영향에대해알아보고자하였다. ALP의발현은모든농도및청국장처리군에서증가하였으며이는 ALP의활성정도와같은양상을나타내었다. 또한다른유전자인 OCN, OPN, Col1의유전자발현역시모든농도및시료처리군에서대조군보다높은발현을보였다. 또한청국장 A보다청국장 B가더높은발현을보였다. 이로인하여본연구진은청국장 B가청국장 A보다 ALP, OCN, OPN, Col1 등의유전자발현을증대시킴으로써조골세포의석회화및분화를증대시켜골다공증에더효과적일것으로생각한다 (Fig. 6). 요약 Polyglutamic acid(pga) 함유량이증대된청국장이조골세포에미치는영향을세포수준에서관찰하고자하였다. 조골세포에미치는영향을관찰하기위하여세포생존율, 염기성인산분해효소 (alkaline phosphatase, ALP) 활성, 골석회화형성능, 조골세포분화관련유전자발현능을측정하였다. 세포독성이없는농도에서염기성인산분해효소활성을측정한결과농도에의존적으로 ALP 활성이증가하였으며, 일반청국장 A보다 PGA 함유량이증가한청국장 B가더높은 ALP 활성증가효과를나타내었다. 청국장의골석회화형성능을측정한결과역시청국장 A보다 B가더높은석회화형성능을나타내었다. 또한분화관련유전자인 OCN, OPN, Col1, ALP 역시청국장 B가 A보다유전자발현이더높게나타났다. 이러한실험결과를바탕으로 PGA 가증대된청국장이기존청국장보다조골세포의활성에효과적일것으로생각한다. 감사의글본연구는산업통상자원부와한국산업기술진흥원의지역특

7 67 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 성화산업육성기술개발사업 (R&D) 으로수행된연구결과입니다. REFERENCES 1. Seo J, Hwang ES, Kim GH Antioxidative and differentiation effects of Artemisia capillaris T. extract on hydrogen peroxide-induced oxidative damage of MC3T3-E1 osteoblast cells. J Korean Soc Food Sci Nutr 4: Kim MJ, Im NK, Yu MH, Kim HJ, Lee IS Effects of extracts from sarcocarp, peels, and seeds of avocado on osteoblast differentiation and osteoclast formation. J Korean Soc Food Sci Nutr 4: Shin JM, Park CK, Shin EJ, Jo TH, Hwang IK. 28. Effects of Scutellaria radix extract on osteoblast differentiation and osteoclast formation. Korean J Food Sci Technol 4: Canalis E Effect of growth factors on bone cell replication and differentiation. Clin Orthop Relat Res 193: Canalis E, McCarthy T, Centrella M Growth factors and the regulation of bone remodeling. J Clin Invest 81: Oh HJ. 25. Therapy of osteoporosis in climacteric. J Korean Acad Fam Med 21: Wu D, Malda J, Crawford RW, Xiao Y. 27. Effects of hyperbaric oxygen on proliferation and differentiation of osteoblasts derived from human alveolar bone. Connect Tissue Res 48: Dong GC, Chen HM, Yao CH. 28. A novel bone substitute composite composed of tricalcium phosphate, gelatin and Drynaria fortunei herbal extract. J Biomed Mater Res A 84: Aldercreutz H, Mazur W Physiological effects of phyto-estrogens in relation to cancer and other human health risks. Proc Nutr Soc 55: Baker VL, Leitman D, Jaffe RB. 2. Selective estrogen receptor modulators in reproductive medicine and biology. Obstet Gynecol Surv 55: S21-S Gray TK, Flynn TC, Gray KM, Nabell LM β- Estradiol acts directly on the clonal osteoblastic cell line UMR16. Proc Natl Acad Sci 84: Lee BK, Jang YS, Yi SY, Chung KS, Choi SY Immunomodulators extracted from Korean-style fermented soybean paste and their function. 1. Isolation of B cell mitogen from Korean-style fermented soybean paste. Korean J Immunol 19: Youn KC, Kim DH, Kim JO, Park BJ, Yook HS, Cho JM, Byun MW. 22. Quality characteristics of the chungkookjang fermented by the mixed culture of Bacillus natto and B. licheniformis. J Korean Soc Food Sci Nutr 31: Kim JS, Yoo SM, Choe JS, Park HJ, Hong SP, Chang CM Physicochemical properties of traditional chonggugjang produced in different regions. Agric Chem Biotechnol 41: Joo EY, Park CS Antioxidant and fibrinolytic activities of extracts from soybean and Chungkukjang (fermented soybean paste). Korean J Food Preserv 18: Park H, Yoon L, Kim HS Effects of fermented soybean paste Chungkukjang on the immunoreactivity in ovariectomized mice. J Korean Soc Food Sci Nutr 42: Harada S, Matsumoto T, Ogata E Role of ascorbic acid in the regulation of proliferation in osteoblast-like MC3T3-E1 cells. J Bone Miner Res 6: Takamizawa S, Maehata Y, Imai K, Senoo H, Sato S, Hata R. 24. Effects of ascorbic acid and ascorbic acid 2-phosphate, a long-acting vitamin C derivative, on the proliferation and differentiation of human osteoblast-like cells. Cell Biol Int Cheng C, Asada Y, Aida T Production of γ-polyglutamic acid by Bacillus licheniformis A35 under denitrifying conditions. Agric Biol Chem 53: Borbely M, Nagasaki Y, Borbely J, Fan K, Bhogle A, Sevoian M Biosynthesis and chemical modification of poly (γ-glutamic acid). Polymer Bull 32: Bang BH, Rhee MS, Kim KP, Yi DH Influences of culture medium components on the production poly (γ-glutamic acid) by Bacillus subtilis GS-2 isolated chungkookjang. Korean J Food & Nutr 25: Maeda T, Matsunuma A, Kawane T, Horiuchi N. 21. Simvastatin promotes osteoblast differentiation and mineralization in MC3T3-E1 cells. Biochem Biophys Res Commun 28: Schiller PC, D'ippolito G, Balkan W, Roos BA, Howard GA. 21. Gap-junctional communication is required for the maturation process of osteoblastic cells in culture. Bone 28: Yun J, Hwang ES, Kim GH Effects of Chrysanthemum indicum L. extract on the growth and differentiation of osteoblastic MC3T3-E1 cells. J Korean Soc Food Sci Nutr 4: Lee YS. 21. Effect of isoflavones on proliferation and oxidative stress of MC3T3-E1 osteoblast-like cells. Korea Soybean Digest 18: Choi EM, Koo SJ. 22. Effects of soybean ethanol extract on the prostaglandin E 2 and interleukin-6 production in osteoblastic cells. Food Res Int 35: Stein GS, Lian JB, Owen TA Relationship of cell growth to the regulation of tissue-specific gene expression during osteoblast differentiation. FASEB J 4: Choi EM, Suh KS, Kim YS, Choue RW, Koo SJ. 21. Soybean ethanol extract increases the function of osteoblastic MC3T3-E1 cells. Phytochemistry 56: Newmark HL Plant phenolics as potential cancer prevention agents. Adv Exp Med Biol 41: Jeon MH, Kim M Effect of Hijikia fusiforme fractions on proliferation and differentiation in osteoblastic MC3T3-E1 cells. J Life Sci 21: Park MJ, Joo BS, Lee JE, Kim HJ, Moon SE, Moon HS. 21. Alendronate enhances osteoblastic differentiation with increased expression of Id-1 and Id-2 in pre-osteoblast cell line, MC3T3-E1. Korean J Obstet Gynecol 53: Yang HM, Seo HS Effects of ascorbic acid on osteoblast differentiation in MC3T3-E1 cells. Soonchunhyang Medical Science 19: Kozawa O, Hatakeyama D, Tokuda H, Oiso Y, Matsuno H, Uematsu T. 22. Sphingomyelinase amplifies BMP-4-induced osteocalcin synthesis in osteoblasts: role of ceramide. Cell Signal 14:

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011, Vol. 21. No μ μ Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,

More information

γ

γ 경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical

More information

α α α α α

α α α α α α α α α α α α α 太陰調胃湯加減方 dbdb 마우스 肝에 대한 아디포사이토카인 및 발현에 미치는 영향 SREBPs 와 섞어서 하고 마커 또한 하여 전기 영동을 하였다 전기영동을 한 후에 에 를 쪼여서 각 를 확인하였다 이 를 프로그램을 이용해 수치화하 여 분석하였다 肝 조직 동결 절편 분리한 조직은 로 시간 동안 고정 시킨 후 에 세척한 후 물기를

More information

139~144 ¿À°ø¾àħ

139~144 ¿À°ø¾àħ 2 139 DOI : 10.3831/KPI.2010.13.2.139 2 Received : 10. 04. 08 Revised : 10. 04. 26 Two Case Report on Wrist Ganglion Treated with Scolopendrid Pharmacopuncture Accepted : 10. 05. 04 Key Words: Wrist Ganglion,

More information

한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과

한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 한약재품질표준화연구사업단 고삼 ( 苦參 ) Sophorae Radix 생약연구과 - 1 - KP 11 Sophorae Radix Sophora flavescens Solander ex Aiton oxymatrine, matrine 1.0% CP 2015 Sophorae Flavescentis Radix Sophora flavescens Aiton - JP 16

More information

386-390.hwp

386-390.hwp 386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon

More information

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상

제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김 상 욱 이 수 형 이 상 6차 산업 수익모델 시범사업 농산물가공품개발 연구용역 최 종 보 고 서 영남대학교 식품공학과 연구책임자 : 한 기 동 제 출 문 경상북도 경산시 농업기술센터 귀하 본 보고서를 6차산업수익모델시범사업 농산물가공품개발 연구용역 과제의 최종보고서로 제출합니다. 2014 년 11 월 19 일 주관연구기관명 : 영남대학교 총괄연구책임자 : 한 기 동 연 구 원 : 김

More information

untitled

untitled 3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,

More information

jaeryomading review.pdf

jaeryomading review.pdf 4 5 6 7 8 9 10 11 12 13 1. S. Kim, H. Y. Jeong, S. K. Kim, S. Y. Choi and K. J. Lee, Nano Lett. 11, 5438 (2011). 2. E. Menard, K. J. Lee, D. Y. Khang, R. G. Nuzzo and J. A. Rogers, Appl. Phys. Lett. 84,

More information

012임수진

012임수진 Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar

More information

- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -

More information

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과

한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 한약재품질표준화연구사업단 금은화 ( 金銀花 ) Lonicerae Flos 생약연구과 - 2 - KP 11 Lonicerae Flos Lonicera japonica Thunberg - CP 2015 JP 16 Lonicerae Japonicae Flos Lonicerae Folium Cum Caulis Lonicera japonica Thunberg - Lonicera

More information

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과

한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 한약재품질표준화연구사업단 작약 ( 芍藥 ) Paeoniae Radix 생약연구과 - 2 - KP 11 CP 2015 JP 16 Paeoniae Radix Paeoniae Radix Alba Paeoniae Radix Rubra Paeoniae Radix Paeonia lactiflora Pallas paeoniflorin, albiflorin 2.3% Paeonia

More information

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010

환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 11-1480523-000702-01 환경중잔류의약물질대사체분석방법확립에 관한연구 (Ⅱ) - 테트라사이클린계항생제 - 환경건강연구부화학물질연구과,,,,,, Ⅱ 2010 목차 ⅰ ⅱ ⅲ Abstract ⅳ Ⅰ Ⅱ i 목차 Ⅲ Ⅳ i 목차 ii 목차 iii Abstract α β α β iv Ⅰ. 서론 Ⅰ 1 Ⅱ. 연구내용및방법 Ⅱ. 2 Ⅱ. 연구내용및방법

More information

Jkbcs032.hwp

Jkbcs032.hwp Clinical Correlation of HER-2/neu Overexpression in Patients with Breast Cancer Sung Yong Kim, Tae Yoon Kim, Jae Jun Kim, Chang Ho Kim, Ok Pyung Song, Min Hyuk Lee, Eui Han Kim 1, and Moo Sik Cho Departments

More information

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici

학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Suffici 학술원논문집 ( 자연과학편 ) 제 50 집 2 호 (2011) 97-137 콩의식품적의의및생산수급과식용콩의자급향상 李弘䄷 * 李英豪 ** 李錫河 *** * Significance of Soybean as Food and Strategies for Self Sufficiency Improvement Hong Suk Lee*, Yeong-Ho Lee**, and

More information

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer

패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 패션 전문가 293명 대상 앙케트+전문기자단 선정 2010.1 Fashionbiz CEO Managing Director Creative Director Independent Designer READY-TO-WEAR Fashionbiz 2010.1 1 2 3 4 5 6 7 8 9 9 2010.1 Fashionbiz

More information

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과

한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 한약재품질표준화연구사업단 단삼 ( 丹參 ) Salviae Miltiorrhizae Radix 생약연구과 - 1 - KP 11 CP 2015 Salvia miltiorrhizae Radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bunge Salvia miltiorrhiza Bunge salvianolic

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA 한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words

More information

( )Kju269.hwp

( )Kju269.hwp 만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University

More information

한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과

한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 한약재품질표준화연구사업단 강활 ( 羌活 ) Osterici seu Notopterygii Radix et Rhizoma 생약연구과 - 2 - - 3 - KP 11 Osterici seu Notopterygii Radix et Rhizoma Ostericum koreanum Maximowicz, Notopterygium incisum Ting, Notopterygium

More information

주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 -

주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - - 1 - 주제발표 식품소비구조의변화가국민건강에미치는영향 연구책임자맹원재 ( 자연제 2 분과 ) 공동연구자홍희옥 ( 상명대학교겸임교수 ) - 2 - 식품소비구조의변화가국민건강에미치는영향 硏究責任者 : 孟元在 ( 自然第 2 分科 ) 共同硏究者 : 洪熙玉 ( 祥明大學校兼任敎授 ) 1. 서론 2. 연도별식품소비변화추이 - 3 - (g/ / ) 1970 1980 1990

More information

03-ÀÌÁ¦Çö

03-ÀÌÁ¦Çö 25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo

More information

03-서연옥.hwp

03-서연옥.hwp 농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥

More information

1607 - 1 - - 2 - - 3 - 그림 1-4 - - 5 - 그림 3 농도에따른댓잎추출액의항세균효과 - 6 - 그림 4 한천확산법 그림 5 배지에균뿌리는과정 그림 6 배지에균스프레딩하는과정 표 1 실험에사용한미생물의종류와배양에사용한배지 Bacterial Strain Gram (+) bacteria Rothia dentocariosa G1201 Streptococcus

More information

433대지05박창용

433대지05박창용 Recent Changes in Summer Precipitation Characteristics over South Korea Changyong Park* JaYeon Moon** Eun-Jeong Cha*** Won-Tae Yun**** Youngeun Choi***** 1958 2007 6 9 6 9 10 10 10 10 10 Abstract This

More information

Lumbar spine

Lumbar spine Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical

More information

한약재품질표준화연구사업단 맥문동 ( 麥門冬 ) Liriopis Tuber 생약연구과

한약재품질표준화연구사업단 맥문동 ( 麥門冬 ) Liriopis Tuber 생약연구과 한약재품질표준화연구사업단 맥문동 ( 麥門冬 ) Liriopis Tuber 생약연구과 Fig.1 ( ) ( ) Table 1. The origin of the Liriopis Tuber in KP, ChP and JP β α β α βα αβ α aster saponin Hb methyl ester H H H H H H H liriope glycoside Lm-3

More information

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ

Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract

More information

(21) hwp

(21) hwp Journal of Life Science 2010 Vol. 20. No. 4. 607~613 cjls / ISSN 1225-9918 Effect of Pine (Pinus densiflora) Needle Extracts on Synthesis of Collagen in Osteoblastic MC3T3-E1 Cells Min Hee Jeon, Young

More information

09-감마선(dh)

09-감마선(dh) Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected

More information

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있

달생산이 초산모 분만시간에 미치는 영향 Ⅰ. 서 론 Ⅱ. 연구대상 및 방법 達 은 23) 의 丹 溪 에 최초로 기 재된 처방으로, 에 복용하면 한 다하여 난산의 예방과 및, 등에 널리 활용되어 왔다. 達 은 이 毒 하고 는 甘 苦 하여 氣, 氣 寬,, 結 의 효능이 있 대한한방부인과학회지 THE JOURNAL OF ORIENTAL OBSTETRICS & GYNECOLOGY VOL.17, NO.2 : 115-122 (2004) 달생산이 초산모 분만시간에 미치는 영향 * 북경한의원, ** 윤산부인과의원, *** 최은림산부인과의원, 상지대학교 한의과대학 부인과학교실 ****, 경희대학교 동서의학대학원 김성준 *****, 윤왕준

More information

Jkbcs016(92-97).hwp

Jkbcs016(92-97).hwp Expression of bcl-2 and Apoptosis and Its Relationship to Clinicopathological Prognostic Factors in Breast Cancer - A Study with Long Term Follow-up correlated with the survival rate.(journal of Korean

More information

歯5-2-13(전미희외).PDF

歯5-2-13(전미희외).PDF The Korean Journal of Counseling 2004, Vol. 5, No. 2, 423-434,. 4 5 18 9, 9.,,,,,.,,, t-.. :,,, (,, 1996),.,,. (, 2001),... 88 98 2000, 88 12.5%(250 )98 35.6%(712 )2.8 (,,, 2001) (Corresponding Author)

More information

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ

Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]

More information

μ μ μ μ μ μ μ μ μ α μ μ β μ α μ α γ μ α β α α γ γ μ μ μ αα αα α α β μ α Diabetic Patients ( 천만 ) 35 30 25 20 15 10 5 0 1985 2003 2010 2025 Year Anual number of Diabetic Patients α β α α

More information

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF.

-, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF, BSF -, rrna, BSF. 1. 2010 6 1, 2 4 Ⅰ,Ⅱ 2013,, -,. - Human Cell.. -,., Biosand Filter(BSF) - BSF Main Filtering (Biofilm) BSF, BSF ( ),. -, BSF BSF. - BSF BSF ( ),,. BSF -,,,. - BSF,. -. -. -. - 2. BSF -, rrna, BSF. 2. -

More information

(01) hwp

(01) hwp Journal of Life Science 2013 Vol. 23. No. 2. 157~166 ISSN (Print) 1225-9918 ISSN (Online) 2287-3406 DOI : http://dx.doi.org/10.5352/jls.2013.23.2.157 α μ δ κ 158 생명과학회지 2013, Vol. 23. No. 2 Journal of

More information

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적

목 차 회사현황 1. 회사개요 2. 회사연혁 3. 회사업무영역/업무현황 4. 등록면허보유현황 5. 상훈현황 6. 기술자보유현황 7. 시스템보유현황 주요기술자별 약력 1. 대표이사 2. 임원짂 조직 및 용도별 수행실적 1. 조직 2. 용도별 수행실적 用 役 指 名 願 금번 貴 社 에서 실시하고자 하는 用 役 에 참여하고자 當 社 의 指 名 願 을 提 出 하오니 審 査 하시고 指 名 하여 주시면 감사하겠습니다. 2014년 (주)하우드 엔지니어링 종합건축사사무소 대표이사 문 홍 길 대표이사 채 희 대표이사 이 재 규 대표이사 김 성 우 SUBMISSION We are submitting our brochure

More information

- 2 -

- 2 - 한약재품질표준화연구사업단 인동 ( 忍冬 ) Lonicerae Folium et Caulis 생약연구과 - 2 - KP 11 Lonicera japonica Thunberg 0.1% CP 2015 JP 16 Lonicera japonica Thunberg chlorogenic acid 0.10% Lonicera japonica Thunberg - β α - 3

More information

?

? http://kfaexpo.kr/ The 40th Korea Franchise Business Expo 2017 JUNE - Vol.23 2017 JUNE - Vol.23 2017 in Busan COVER STORY SPEACIAL REPORT GUIDE POST PEOPLE & STORY ASSOCIATION NEWS Ҷ

More information

10(3)-10.fm

10(3)-10.fm w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction

More information

(....).hwp

(....).hwp sugar cane 계분 (%) a ATCC : American type Culture Collection, b IFO : Institute for fermentation, osaka, c MPNU : Mycological lab. Pusan National University d Mycelial

More information

10(3)-12.fm

10(3)-12.fm w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed

More information

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :

27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( : 27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,

More information

노인정신의학회보14-1호

노인정신의학회보14-1호 제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시

More information

10(3)-09.fm

10(3)-09.fm w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½

More information

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong

Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling

More information

09È«¼®¿µ 5~152s

09È«¼®¿µ5~152s Korean Journal of Remote Sensing, Vol.23, No.2, 2007, pp.45~52 Measurement of Backscattering Coefficients of Rice Canopy Using a Ground Polarimetric Scatterometer System Suk-Young Hong*, Jin-Young Hong**,

More information

???춍??숏

???춍??숏 Suseong gu Council Daegu Metropolitan City www.suseongcouncil.daegu.kr Contents SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY 10 www.suseongcouncil.daegu.kr 11 SUSEONG GU COUNCIL DAEGU METROPOLITAN CITY

More information

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot

Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는 Lactate dehydrogenase(ldh) 의양을고감도로측정함으로써 cytotoxicity/cytolysis를간단하게측정할수있는 kit 입니다. Cytot EZ-LDH Cell Cytotoxicity Assay Kit Cat. No. DG-LDH500 DG-LDH1000 FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES. 1 ( 주 ) 대일랩서비스부설두젠생명공학연구소 Product Description Apoptosis 혹은 necrosis등에의하여죽거나손상된세포에서방출되는

More information

untitled

untitled 대한수혈학회지:제권 제호, 0 한 대학병원의 혈액 폐기 분석 김병철ㆍ서영익ㆍ채금란ㆍ신정원ㆍ최태윤 = Abstract = 순천향대학교 의과대학 서울병원 진단검사의학교실 Analysis of Discarded Blood Components at a University Hospital in Korea Byung Chul Kim, Young Ik Seo, Gum Ran

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월

이 발명을 지원한 국가연구개발사업 과제고유번호 KGM2420913 부처명 교육과학기술부 연구관리전문기관 연구사업명 전북분원운영사업 연구과제명 저탄소 녹생성장을 위한 바이오매스/에너지 개발 주관기관 한국생명공학연구원 연구기간 2009년 01월 01일 ~ 2009년 12월 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (45) 공고일자 2015년04월10일 (11) 등록번호 10-1509796 (24) 등록일자 2015년04월01일 (51) 국제특허분류(Int. Cl.) A61K 36/45 (2006.01) A23L 1/30 (2006.01) A61P 3/04 (2006.01) (21) 출원번호 10-2009-0108173

More information

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012

유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 11-1480523-001163-01 유해중금속안정동위원소의 분석정밀 / 정확도향상연구 (I) 환경기반연구부환경측정분석센터,,,,,,,, 2012 목 차 ⅰ ⅲ ⅳ Abstract ⅵ Ⅰ Ⅱ Ⅲ i 목 차 Ⅳ ii 목 차 iii 목 차 iv 목 차 v Abstract vi Abstract σ ε vii Abstract viii Ⅰ. 서론 Ⅰ. 1 Ⅰ. 서론.

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Sep.; 30(9), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2019 Sep.; 30(9), 712 717. http://dx.doi.org/10.5515/kjkiees.2019.30.9.712 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) MOS

More information

( )Kjhps043.hwp

( )Kjhps043.hwp Difference of Fistula Maturation Degree and Physical Property by the Types of Tube Material: An Experimental Study Sang Koo Kang, M.D. 1, Hee Chul Yu, M.D. 1,4, Woo Sung Moon, M.D. 2,4, Ju Hyoung Lee,

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2013) 26(1), 201 208 DOI: http://dx.doi.org/10.5351/kjas.2013.26.1.201 A Note on Model Selection in Mixture Experiments with Process Variables Jung Il Kim a,1

More information

대한한의학원전학회지24권6호-전체최종.hwp

대한한의학원전학회지24권6호-전체최종.hwp 小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental

More information

인문사회과학기술융합학회

인문사회과학기술융합학회 Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement

More information

03이경미(237~248)ok

03이경미(237~248)ok The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).

More information

A 617

A 617 Special Issue Diabetic Retinopathy Won Ki Lee, M.D. Department of Ophthalmology The Catholic University of Korea College of Medicine Kangnam St. Mary s Hospital E mail : wklee@catholic.ac.kr Abstract R

More information

개최요강

개최요강 55 2009. 5. ( ) ( ) < > 1. 1 2. 2. 2. 3 1) 3 2) 3 3) GC-MS 4. 5 1) 5 2) 5 3) ICP-OES 6 3. 7. 7 1) 7 2) 10. 13 1) 1g 13 2),,, 14 3), 15 4),, 15 4. 17 19 < > [ 1] 2 [ 2] ICP-OES 6 [ 3] 13 [ 4] 1g 13 [ 5]

More information

Treatment and Role of Hormaonal Replaement Therapy

Treatment and Role of Hormaonal Replaement Therapy Treatment and Role of Hormone Replacement Therapy Chung-Ang University Hospital Chee Jeong Kim 7.2 5.3 6.4 5.6 7.3 5.5 1 1 2 3 4 10 11 7 34 49 122 123 1.0 - - 10. 2001 1998 1998 Improvement of postmenopausal

More information

Crt114( ).hwp

Crt114( ).hwp cdna Microarray Experiment: Design Issues in Early Stage and the Need of Normalization Byung Soo Kim, Ph.D. 1, Sunho Lee, Ph.D. 2, Sun Young Rha, M.D., Ph.D. 3,4 and Hyun Cheol Chung, M.D., Ph.D. 3,4 1

More information

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI: 3 * Effects of 9th

Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp DOI:   3 * Effects of 9th Journal of Educational Innovation Research 2019, Vol. 29, No. 2, pp.357-378 DOI: http://dx.doi.org/10.21024/pnuedi.29.2.201906.357 3 * Effects of 9th Grade Students Participation in Career Curriculum Cluster

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Jul.; 27(7), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 16 Jul.; 27(7), 64662. http://dx.doi.org/./kjkiees.16.27.7.646 ISSN 1226-3133 (Print)ISSN 2288-226 (Online) 2D Microwave Image

More information

- 2 -

- 2 - - 1 - - 2 - - 3 - - 4 - μ μ μ μ μ μ μ α μ μ μ μ μ - 5 - μ μ μ μ - 6 - μ - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - μ μ μ α μ λ - 14 - μ μ μ μ μ - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22

More information

Can032.hwp

Can032.hwp Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory

More information

<313430333033C6AFC1FD28C3E0B1B8292E687770>

<313430333033C6AFC1FD28C3E0B1B8292E687770> 스포츠와 물리학: 구기운동 안티-싸커 와 간접-축구 DOI: 10.3938/PhiT.23.005 이 인 호 Anti-soccer and Indirect Soccer 편성은 없다고 장담한다. 벨기에(FIFA 랭킹 11위), 러시아 (FIFA 랭킹 22위), 알제리(FIFA 랭킹 26위), 그리고 한국(FIFA 랭킹 61위)으로 이어지는 H조 편성 결과이다. 이

More information

<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770>

<C7D1BDC4BFAC20B1E8B5BFBCF6B9DABBE7B4D4676C75636F20C3D6C1BE5B315D2E687770> Glucomannan 을이용한 기능성소재화연구 Study on the Functional and Processing Properties of Glucomannan for Food Material 연구기관 한국식품개발연구원 농림부 - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 4, August, 30, 2016:319~332 Received: 2016/07/28, Accepted: 2016/08/28 Revised: 2016/08/27, Published: 2016/08/30 [ABSTRACT] This paper examined what determina

More information

한국성인에서초기황반변성질환과 연관된위험요인연구

한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -

More information

l l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related

More information

μ

μ μ 초콩의제조중기능적특성비교 173 Table 1. Changes in total polyphenol contents of Chokong as affected by soaking time Extracting solvents Chokong 1) Soaking time (days) 1 4 7 10 14 Water 70% ethanol solution 23.46±4.62

More information

<313120B9DABFB5B1B82E687770>

<313120B9DABFB5B1B82E687770> 한국민족문화 40, 2011. 7, 347~388쪽 1)중화학공업화선언과 1973년 공업교육제도 변화* 2)박 영 구** 1. 머리말 2. 1973년, 중화학공업화선언과 과학기술인력의 부족 3. 1973년 전반기의 교육제도 개편과 정비 1) 계획과 개편 2) 기술교육 개선안과 인력개발 시책 4. 1973년 후반기의 개편과 정비 5. 정비된 정규교육제도의 특징

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing

More information

서론 34 2

서론 34 2 34 2 Journal of the Korean Society of Health Information and Health Statistics Volume 34, Number 2, 2009, pp. 165 176 165 진은희 A Study on Health related Action Rates of Dietary Guidelines and Pattern of

More information

01이정훈(113~127)ok

01이정훈(113~127)ok The Role of Historical Relativity in International Exchange of Culture and Tourism at the Regional Level: A Case of Gyeonggi and Shandong Province Jung-hoon Lee** Kyung-Eun Choi*** Eun-Ja Lee****,.,,.,,.,,.,.,.,,,

More information

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770>

<30312DC1A4BAB8C5EBBDC5C7E0C1A4B9D7C1A4C3A52DC1A4BFB5C3B62E687770> Journal of the Korea Institute of Information and Communication Engineering 한국정보통신학회논문지(J. Korea Inst. Inf. Commun. Eng.) Vol. 19, No. 2 : 258~264 Feb. 2015 ID3 알고리즘 기반의 귀납적 추론을 활용한 모바일 OS의 성공과 실패에 대한

More information

00º½Çмú-¾Õ

00º½Çмú-¾Õ 547-8( 307 ) TEL (02)458-3078, 3079 / FAX (02)458-3047, 3077 NICE , (),, ( 1) NICE 1. Biochemical Engineering in 21st Century in the era of Life Science and Technology 09:00 ~ 09:15 Opening Remarks: President

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4)

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. vol. 29, no. 10, Oct ,,. 0.5 %.., cm mm FR4 (ε r =4.4) THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2018 Oct.; 29(10), 799 804. http://dx.doi.org/10.5515/kjkiees.2018.29.10.799 ISSN 1226-3133 (Print) ISSN 2288-226X (Online) Method

More information

lastreprt(....).hwp

lastreprt(....).hwp pheophytin Jukart.. 서론 재료및방법 . 650 nm (10). 3. 124 15 3 68 2 3 124 2, 3, 43 5, 5 23 (5). 4. 5 4 5 53. 650 nm (10),..,. 16 pheophytin Jukart.. IC 50 1mg/ml.. pheophytin Jukart.. IC 50 1mg/ml.

More information

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu

878 Yu Kim, Dongjae Kim 지막 용량수준까지도 멈춤 규칙이 만족되지 않아 시행이 종료되지 않는 경우에는 MTD의 추정이 불가 능하다는 단점이 있다. 최근 이 SM방법의 단점을 보완하기 위해 O Quigley 등 (1990)이 제안한 CRM(Continu 한 국 통 계 학 회 논 문 집 2012, 19권, 6호, 877 884 DOI: http://dx.doi.org/10.5351/ckss.2012.19.6.877 Maximum Tolerated Dose Estimation Applied Biased Coin Design in a Phase Ⅰ Clinical Trial Yu Kim a, Dongjae Kim

More information

Abstract Musculoskeletal Symptoms and Related Factors for Nurses and Radiological Technologists Wearing a Lead Apron for Radiation Pro t e c t i o n Jung-Im Yoo, Jung-Wan Koo 1 ) Angio Unit, Team of Radiology,

More information

14.531~539(08-037).fm

14.531~539(08-037).fm G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01

이 발명을 지원한 국가연구개발사업 과제고유번호 SI-1304 부처명 기획예산처 연구관리전문기관 산업기술연구회 연구사업명 정부출연 일반사업 연구과제명 생명통합정보시스템 활용 독창적 신약개발협동연구사업 기 여 율 1/1 주관기관 한국화학연구원 연구기간 2013.01.01 (19) 대한민국특허청(KR) (12) 등록특허공보(B1) (51) 국제특허분류(Int. Cl.) A61K 31/519 (2006.01) A61K 31/4162 (2006.01) A61P 19/00 (2006.01) A61P 19/10 (2006.01) (21) 출원번호 10-2013-0039066 (22) 출원일자 2013년04월10일 심사청구일자 2013년04월10일

More information

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발

이 발명을 지원한 국가연구개발사업 과제고유번호 G1111700300320000000000000 부처명 한국환경산업기술원 연구사업명 토양지하수오염방지기술개발사업 연구과제명 시데로포아(Siderophore)의 대량생산을 통한 토양 및 지하수의 친환경 중금속 제거기술 개 발 (19) 대한민국특허청(KR) (12) 공개특허공보(A) (11) 공개번호 10-2013-0029213 (43) 공개일자 2013년03월22일 (51) 국제특허분류(Int. Cl.) C12N 1/15 (2006.01) C12P 21/00 (2006.01) C12R 1/77 (2006.01) (21) 출원번호 10-2011-0092470 (22) 출원일자 2011년09월14일

More information

1. Korea Centers for Disease Control and Prevention. The fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1) 2010. Cheongwon: Korea Centers for Disease Control and Prevention; 2012.

More information

歯kjmh2004v13n1.PDF

歯kjmh2004v13n1.PDF 13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - - 5 - SUMMARY ( 영문요약문 ) - 6 - - 7 - - 8 - - 9 - cavenging - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 -

More information

???? 1

???? 1 The Korean Journal of Applied Statistics (2014) 27(1), 13 20 DOI: http://dx.doi.org/10.5351/kjas.2014.27.1.013 Maximum Tolerated Dose Estimation by Stopping Rule and SM3 Design in a Phase I Clinical Trial

More information

fm

fm [ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties

More information

04_이근원_21~27.hwp

04_이근원_21~27.hwp 1) KIGAS Vol. 16, No. 5, pp 21~27, 2012 (Journal of the Korean Institute of Gas) http://dx.doi.org/10.7842/kigas.2012.16.5.21 실험실의 사례 분석에 관한 연구 이근원 이정석 한국산업안전보건공단 산업안전보건연구원 (2012년 9월 5일 투고, 2012년 10월 19일

More information

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11),

THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE Nov.; 26(11), THE JOURNAL OF KOREAN INSTITUTE OF ELECTROMAGNETIC ENGINEERING AND SCIENCE. 2015 Nov.; 26(11), 985991. http://dx.doi.org/10.5515/kjkiees.2015.26.11.985 ISSN 1226-3133 (Print)ISSN 2288-226X (Online) Analysis

More information

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타

Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타 RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of

More information

Kbcs002.hwp

Kbcs002.hwp Does Real-time Compound Imaging Improve Evaluation of reast Cancer Compared to Conventional Sonography? o Kyoung Seo, M.D., Yu Whan Oh, M.D., Kyu Ran Cho, M.D., Young Hen Lee, M.D., Hyung Joon Noh, M.D.,

More information

DBPIA-NURIMEDIA

DBPIA-NURIMEDIA The e-business Studies Volume 17, Number 6, December, 30, 2016:3~20 Received: 2016/12/04, Accepted: 2016/12/27 Revised: 2016/12/27, Published: 2016/12/30 [ABSTRACT] This study aims to comprehensively analyze

More information

16(1)-3(국문)(p.40-45).fm

16(1)-3(국문)(p.40-45).fm w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University

More information

- 1 -

- 1 - - 1 - - 2 - - 3 - - 4 - 장비구성 : - 5 - - 6 - 치 - 7 - μ - 8 - - 9 - 고체흡착관의안정화방법및기기 (Tube conditioner) - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - 전기냉각저온농축장치 (TD) GC/FPD - 18 - GC/FID Headspace

More information

2 3 4 5 6 8 9 11 12 13 14 16 44 68 80 86 1 ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) (, ) ( ) ( ) ( ) ( ) ( ) ( ) (KORDI/KRISO) () () () () () () 2 3 : 1 : 2005 5 12() 09:00~14:30 Session 15:00~19:00 : 19:00~20:30

More information