05 (12-22-OK).hwp

Size: px

Start display at page:

Download "05 (12-22-OK).hwp"

국진 왕
5 years ago
Views:

1 J Korean Soc Food Sci Nutr 한국식품영양과학회지 45(5), 664~67(216) 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 이기호 1 심미옥 1 송용수 2 정호경 1 장지훈 1 김민석 1,3 김태묵 1 이효은 1 안병관 1 정원석 1 1 한약진흥재단한약자원본부 2 해남자연농업영농조합법인 3 원광대학교한의학과 Effects of Poly-Gamma Glutamate Contents Cheonggukjang on Osteoblast Differentiation Ki Ho Lee 1, Mi-Ok Sim 1, Yong Su Song 2, Ho Kyung Jung 1, Ji-Hun Jang 1, Min-Suk Kim 1,3, Tae Mook Kim 1, Hyo Eun Lee 1, Byeong-Kwan An 1, and Won Seok Jung 1 1 Traditional Korean Medicine Research Team, National Development Institute of Korean Medicine 2 Heanam Natural Farming Association Cooperation 3 Department of Pathology, College of Korean Medicine, Wonkwang University ABSTRACT Cheonggukjang (CKJ) is a Korean traditional food made of fermented soybeans. In comparison to normal intake of soybeans, Cheonggukjang has high digestibility with bioactive, antioxidant substances, and thrombolytic enzymes. Recent studies have reported anti-oxidant, anti-cancer, anti-inflammatory, anti-obesity activities as well as inhibitory activities against osteoporosis for CKJ. In this study, we identified the effects of CKJ on osteoblast differentiation by increasing the polyglutamic acid (PGA) content of CKJ. Alkaline phosphatase (ALP) activity and mineralization significantly increased in response to treatment with both natural CKJ (CKJ A) and PGA-increased CKJ (CKJ B). However, CKJ B exhibited higher ALP activity and mineralization than CKJ A. Real-time reverse transcription PCR demonstrated that mrna expression of osteoblastic-associated genes such as type Ⅰ collagen, alkaline phosphatase, osteocalcin, and osteopontin in C2C12 cells was significantly up-regulated by CKJ A or B treatment. These results indicate that treatment with CKJ has an anabolic effect on bone by increasing osteoblastic differentiation and ALP activity. Increasing PGA content in CKJ had a greater effect than CKJ A on up-regulation of osteoblastic gene expression in osteoblast cells. Key words: ALP, Cheonggukjang, osteoblast, osteocalcin, osteopontin 서 현대에는평균수명의연장으로노인질환의관리가중요문제로대두하고있으며, 그중골다공증은유전적요인이나식이, 생활방식과같은환경적요인에의해영향을받는복합적인질병이다 (1,2). 골다공증은단위용적내의골량이골의화학적조성의큰변화없이감소하는질환으로이로인해쉽게골절을일으킬수있으며폐경후여성들에게가장그발생빈도가높게나타나는질환이다 (3). 뼈는체내구조를이루고골격계를구성하는역할을함으로써파골세포에의한골흡수와새로운골기질을형성하는조골세포가서로균형을이루면서무기질화과정이끊임없이일어나는동적인조직이다 (4). 정상성인에서는골흡수 Received 21 December 215; Accepted 28 March 216 Corresponding author: Won Seok Jung, Traditional Korean Medicine Research Team, National Development Institute of Korean Medicine, Jeonnam 59338, Korea i823@nate.com, Phone: 론 량과골형성량이항상성을유지하고있고, 뼈는일정한주기로재형성을이루게된다 (5). 이러한골격계의구조와기능은호르몬과국소적인자의상호작용에의해조절되며, 조골세포와파골세포활성간의불균형은전체적인뼈의감소나증가로인한골격계의이상을나타낸다 (3). 골손실이일어나게되면뼈를원상태로복구하는것은어려우며, 보통뼈의소실이더는진행되지않게치료하는방법을사용하고있다 (2,6). 대표적인방법으로에스트로겐, 칼시토닌, 비스포스테이트제제가이용되고있으며 (7,8), 그중에스트로겐투여가기본적으로사용되고있으나장기적인사용은오심, 두통, 체중증가, 유방암발생을초래하여장기적인사용은기피하는실정이다 (9-11). 이러한이유로비교적부작용이적은장점으로인해천연물질을이용한신약개발과질병의치료가보편화되면서골다공증의치료에이를응용하려는연구또한많이보고되고있다. 청국장은우리나라를대표하는전통적인발효식품으로써일반콩섭취시보다소화흡수율이높은이점을가지고

2 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 665 있으며, 이소플라본, 피틴산, 사포닌, 토코페롤, 불포화지방산, 식이섬유, 올리고당등의각종생리활성물질과항산화물질및혈전용해효소가다량함유된것으로밝혀져있다 (12-15). 또한청국장은항산화, 항암, 항염증, 항비만, 골다공증개선효과등의다양한생리활성이보고돼있으며, 이러한이유로건강기능식품으로서청국장관련제품의소비가더욱증가하고있다 (16-18). 특히발효한청국장에서나타나는끈끈한실형태의물질을 γ-polyglutamic acid(γ- PGA) 라하는데 D,L-glutamic acid의중합체로청국장과 Natto의주성분으로알려졌다 (19). γ-pga는수용성, 음이온성, 무독성, 생분해성, 생체적합성, 식용등의다양한특성이있으며, 침전제, 동결방지제, 쓴맛감소제, 동물사료첨가제등으로이용되고있다. 또한의료분야에서는약물전달체, 의료용생물접착제, 골다공증예방등에이용되고있는것으로알려졌다 (2). 따라서본연구에서는청국장의유효성분으로보고되어있는 γ-pga에대한함량을증대시키고이를 HPLC를이용하여기존청국장 ( 청국장 A) 과 γ-pga가증대된청국장 ( 청국장 B) 의 γ-pga 함량을비교탐색하였다. 또한유효성분을증대시킨청국장이기존청국장보다조골세포분화에어떠한효과를미치는지검색하고자하였다. 재료및방법실험재료 γ-pga의함유량이증대되도록시료를준비하기위하여청국장발효에사용된동일균주를사용하여 Bang 등 (21) 의방법을변형하여액체배양물 3 L를준비하였다. 그중일부를사용하고나머지는냉동보관하였다. 액체배양물제조의영양원으로 soybean 1%, glutamic acid 1%, sucrose 1%, NH 4Cl.2%, KH 2PO 4.1%, MgSO 4 7H 2O.1% 의조성이되도록준비하여사용하였으며, Jar Fermentor(LiFlus GX, Hanil Science Industrial, Incheon, Korea) 에 37 C, 15 rpm, 1. L/air min 조건으로 36시간동안배양하였다. 본실험에사용된시료청국장 B는발효후 55 C에서 48시간건조해분쇄한가루 1 g과액체배양물 1 ml를 1:1 (v:v) 의비율로균일하게혼합한다음 5 C에서 48시간건조한후사용하였다. 표준및시험용액조제표준물질인글루탐산 1 mg을정밀히칭량하여 1 ml 부피플라스크에넣어증류수에용해하여표준원액으로이용하였으며, 이를 2배씩희석하여사용하였다. 또한두종류의청국장시료 2 g을정밀히칭량하여 5 ml 부피플라스크에넣고, 증류수에녹인후 3분간초음파로추출하였다. 추출한용액을원심분리기를이용해 15, rpm에서 25분간 4 C로처리하였고, 그상등액을 1 ml 취하여내열성플라스크에담고 6 N 염산 1 ml를가하여오븐에넣어 11 C에서 24시간동안가수분해하였다. 이를 5 ml 부피플라스크 에옮겨증류수로정용하여희석한후, 그중 1 ml를취하여 5 ml 부피플라스크에넣은다음증류수로정용하여.2 N에가까운농도로희석하였다. 이렇게희석한시료는필터하여총 glutamic acid의시험용액으로하였다. 또한가수분해하지않은용액을사용해유리글루탐산의시험용액으로하였다. 폴리감마글루탐산의 HPLC 분석 PGA의함량분석에사용한고성능액체크로마토그래피 (HPLC) 는 Agilent 12 series(agilent Technologies Inc., Santa Clara, CA, USA) 를사용하였으며, 검출기는 FLD (fluorescence detector) 와 DAD(diode array detector) 를사용하였다. 샘플의주입은 Agilent auto-sampler(agilent Technologies Inc.) 의 injection program을사용해주입하였다. Column은 Agilent ZORBAX Eclipse AAA( mm, 5 μm, Agilent Technologies Inc.) 를사용하였으며, 이동상 (mobile phase) 으로는 Solvent A[4 mm sodium phosphate(dibasic),.1% phosphoric acid in water], Solvent B(acetonitrile : methanol : DW=45:45:1) 를사용하여 gradient 조건에서 1.5 ml/min의유속으로분석하였다. 이동상의기울기조건은 Table 1에표기하였다. 분석시약으로는유도체화시약인 OPA와 Borate buffer를사용하였으며, Agilent auto-sampler의 injection program을통해기기내에서의시약반응을통한주입을진행하였다. 주입한표준및시험용액은이용해 DAD(254, 338 nm) 와 FLD(Ex 23 nm, Em 45 nm) 를통해 chromatogram으로기록되었으며, peak의적분값을이용해총글루탐산함량 (%) 및유리글루탐산함량 (%) 을계산하였다. 분석및계산 PGA는글루탐산의펩티드결합으로이루어진중합체로 LC 분석을통한함량분석시글루탐산의총함량이필요하다. 따라서 PGA의함량은가수분해한총글루탐산의함량에서유리글루탐산의함량을뺀값이라할수있다. 따라서 PGA 의 LC를이용한함량계산은다음식을이용해계산하였다. PGA 함량 (mg/g)=( 총 glutamic acid.88)- free glutamic acid 함량.88=129(PGA의 glutamic acid 잔기의분자량 )/147 (glutamic acid 분자량 ) Table 1. Gradient condition of solvent A and B for PGA quantitative analysis Time A% (4 mm Na 2HPO 4,.1% phosphoric acid) Mobile phase B% (acetonitrile : methanol : Dw=45:45:1) 3 3

3 666 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 Cell culture 마우스 C2C12 각 4, cell/22 mm well로분주하고 DMEM(Dulbecco's modified Eagle's medium, Gibco Laboratories, Grand Island, NY, USA) 에 1% FBS(fetal bovine serum, Gibco Laboratories) 와항생제 (1% antibiotic antimycotic solution, Sigma-Aldrich Co., St. Louis, MO, USA) 를처리한후 37 C, 5% CO 2 하에서배양하였다. C2C12가 8% 자랐을때분화유도를위해 5% FBS, 1 ng/ml의 rhbmp-2를포함하는 DMEM으로교체하였다. Table 2. Real-time PCR primers used in this study Gene Primer sequence 5'-3' OPN Forward GTAGGGACGATTGGAGTGAAAG GGAAACCAGCCAAGGACTAA COL1A ALP OCN Forward Forward Forward CTCCCAGAACATCACCTATCAC GGTGGAGAAAGGAGCAGAAA GCCATGACATCCCAGAAAGA CAGATACAGGCAAGGCAGATAG ACACCATGAGGACCATCTTTC AGCTGCTGTGACATCCATAC 조골세포의 alkaline phosphatase(alp) 활성분화된조골세포를 PBS로세척한다음.1% Triton X- 1을 2 μl씩첨가하여 37 C에서 3분간 lysis 하였다. Lysis 된 cell의상층액 5 μl는단백질정량에사용하였고, 나머지상층액에 2 μl의.1 N glycine과 1 μl의 1 mm ρ-nitrophenylphosphate(ρ-npp) 를첨가한후다시 37 C에서 3분간반응시켰다. 반응후 2 μl의.1 N NaOH로반응을중지하고, 45 nm에서흡광도를측정하였다. ALP 활성은 ρ-npp로부터생성된 ρ-nitrophenol(ρ- NP) 을측정하여 ρ-np에대한표준그래프를작성한후활성도를대조군과의상대비교를통해도출하였다. 석회화결절형성측정배양후배지를제거하고 PBS로가볍게세척한후 7% ethanol을가하고 4 C에서 1시간동안고정하였다. 세포를증류수로세척하고 2% alizarin red solution(ph 4.2) 으로실온에서 1분간염색하였다. 비특이적인염색을줄이기위해증류수로 5번세척한후 PBS를가하고 15분방치하였다. PBS를제거한후 1%(w/v) cetylpyridinium chloride를첨가한 1 mm sodium phosphate(ph 7.) 용액을각 well 에첨가하고실온에서 15분간반응시켜서얻은 alizarin red 추출액을 96-well plate로옮기고 562 nm에서흡광도를측정하였다. 4회반복수행하였다. 통계분석실험의정량적인결과는평균값과표준편차로표시하였다. 통계적인차이는 Student's t-test를이용하여분석하였고 P 값이.5 이하인경우통계적으로유의성이있다고판정하였다. 결과및고찰글루탐산의분석조건선정및직선성시약을통해유도체화한글루탐산의 detector별 chromatogram의 peak를비교해분석에적당한 detector를선정하였다. 그결과 UV 254 nm에서는 peak를확인할수없었으며, 338 nm에서약간의 peak가나타나는것을확인하였다. 그리고 FLD(Ex 23 nm, Em 45 nm) 에서 UV보다뚜렷한 peak가나타나는것을확인하였다. 글루탐산의표준용액을.1~12.5 μg/ml의범위로용해시켜 HPLC를이용해분석하였으며, 각각의농도에따른검량선상관계수가.999 이상의직선성을보이는것을확인하였다. 또한청국장의총 glutamic acid 및 free glutamic acid의함량이글루탐산표준용액의회귀곡선범위안에포함되는것을확인하였다 (Table 3, Fig. 1). 유전자발현 real-time PCR 수확한세포는 TriPure Isolation Reagent(Roche Diagnostics, Mannheim, Germany) 를이용하여 RNA를분리하였다. 5 μg의 mrna를 High Capacity cdna Transcription Kit(Applied Biosystem, Foster City, CA, USA) 을이용하여 cdna로합성하였다. 실험은제조사매뉴얼에따라수행하였다. 합성된 cdna 1 μl, TaqMan primer 1 μl, TaqMan Universal Master Mix Ⅱ(Applied Biosystem) 1 μl, 3차증류수 8 μl를넣고 real-time PCR 기기 (ABI75, Applied Biosystem) 를이용하여 PCR 을수행하였다. 정량중합효소반응에쓰인 gene의정보는 Table 2에서나타내었다. 또한 real-time PCR 반응조건은 5 C에서 2분, 95 C에서 1분동안 1회수행하고, 변성온도 95 C에서 15초어닐링, 온도 6 C에서 15초인사이클을 청국장시료의 PGA 함량분석 HPLC-FLD를이용해균주별청국장함유량을확인하기위해기존의일반적인방법으로발효시킨청국장 A와 PGA 의증대를위한공정시술개발로발효시킨청국장 B의시료 Table 3. Area values of the respective concentrations (n=3) Level Amount Area (mean) SD RSD

폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 667 청국장시료의세포독성평가 C2C12 세포주에서청국장시료의독성을각각조사하기위해 MTS 실험을수행하였다. 각각 C2C12 세포에농도별 (62.5, 125, 25, 5 μg/ml) 로각각의청국장시료를처리하고 72시간후에 MTS를처리한결과모든농도에서독성이나타나지않았다 (Fig. 3).

4 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 667 청국장시료의세포독성평가 C2C12 세포주에서청국장시료의독성을각각조사하기위해 MTS 실험을수행하였다. 각각 C2C12 세포에농도별 (62.5, 125, 25, 5 μg/ml) 로각각의청국장시료를처리하고 72시간후에 MTS를처리한결과모든농도에서독성이나타나지않았다 (Fig. 3). Fig. 1. The calibration curve of glutamic acid. 를같은실험방법을이용해분석을진행하였으며, 그결과시료각각 3.6±.86%, 5.231±.193% 의함량이측정되었으며, 청국장 B가 A보다약 1.7배의 PGA 함량증가를확인하였다 (Table 4, Fig. 2). A B 청국장시료의골석회화형성에미치는영향골석회화형성능은조골세포의분화에중요한표식인자로서칼슘에특이적으로흡착력이높은식물성염료인 alizarin을이용해염색하였다 (22,23). 이것은세포의기질이무기질화된부분에염색되어석회화된양과염색정도가상호비례하기때문에여러논문에서이를이용하여골석회화형성도를확인하였다 (24-27). 청국장 A와 B 시료의농도에따른석회화형성도를확인하기위해염색된석회화물을 1% cetylpyridinium chloride로녹여흡광도값을측정하여상대활성을 Fig. 4에나타내었다. 청국장을처리한모든군에서시료를처리하지않은군보다농도의존적으로높은골석회화형성능을보였으며, 청국장 A보다청국장 B가더높은골석회화형성능을보였다. 최근 Choi 등 (28) 의연구에서도대두에탄올추출물을조골세포에처리하였을때대조군보다골석회화형성이유의적으로증가하였다. 이를바탕으로대두를기반으로한청국장이조골세포의분화를촉진시키며, 특히 PGA 함유량이증가한청국장 (CKJ B) 이일반청국장 (CKJ A) 보다더 C Fig. 2. LC chromatogram of glutamic acid (A), CKJ A (B), and CKJ B (C). CKJ A: natural Cheonggukjang, CKJ B: PGAincreased Cheonggukjang. Fig. 3. Effect of CKJ on cell viability in C2C12 cells. Cell viability was evaluated with the MTS assay. Data represent the mean±sd of triplicate determinations from three separate experiments. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. Table 4. PGA contents of the CKJ A and CKJ B prepared with various microorganisms Sample CKJ A CKJ B PGA contents (%) 1 time 2 time 3 time CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. Mean SD RSD

이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 668 μg/ml 62.5 μg/ml 125 μg/ml 25 μg/ml 5 μg/ml CKJ A CKJ B Fig. 4. Effect of CKJ on mineralization in C2C12 cell by alizarin Red S Staining.

CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. 높은 골 석회화 형성능을 가지는 것으로 생각한다.

5 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 668 μg/ml 62.5 μg/ml 125 μg/ml 25 μg/ml 5 μg/ml CKJ A CKJ B Fig. 4. Effect of CKJ on mineralization in C2C12 cell by alizarin Red S Staining. Data represent the mean±sd of triplicate determinations from three separate experiments. P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. 높은 골 석회화 형성능을 가지는 것으로 생각한다. 청국장이 조골세포 분화 유전자 발현에 미치는 영향 골의 형성과정에 조골세포의 분화는 유전형질의 발현에 청국장 시료의 ALP 활성에 미치는 영향 의해 조절되며, 배양방법에 따라 고유의 특성이 있다. 즉 증 염기성 인산분해효소(ALP)는 대부분의 조직에 존재하 식과 분화 석회화 과정을 거치며 type Ⅰ collagen(col1), 며, 특히 골조직에 존재하는 ALP는 골 성장이 활발히 일어 ALP, osteocalcin(ocn), osteopontin(opn) 등의 골 관련 날 때 그 활성이 증가하게 된다(29). Jeon과 Kim(3)이 보 형질표현 유전자가 발현된다(31). OCN은 성숙한 조골세포 고한 연구 결과에서는 톳 분획물이 ALP의 발현을 증가시키 므로 조골세포의 분화에 영향을 준다고 제시하였으며, 또한 황금 추출물, 아보카도 과피 및 씨 추출물에서 조골세포의 ALP 활성을 증가시킴에 따라 조골세포의 분화가 증대된 것 으로 보고하였다(2,3). 따라서 조골세포의 활성을 알아보는 생화학적 지표로써 ALP 활성을 측정하는 방법이 일반화되 어 있으므로 청국장이 ALP 활성에 미치는 영향을 검토하였 다. 청국장을 농도별로 처리한 결과 모든 시료를 처리한 군에 서 시료를 처리하지 않은 대조군보다 높은 ALP 활성을 나타 내었다. 특히 청국장 B는 대조군보다 약 2배의 높은 활성을 나타내었으며, 청국장 B가 청국장 A보다 더 높은 ALP 활성 을 나타내었다. 따라서 청국장이 조골세포의 ALP 활성을 증가시켜 조골세포의 분화에 영향을 미칠 것으로 생각하며, 청국장 B가 청국장 A보다 골 석회화 형성을 촉진시킬 것으 로 생각한다(Fig. 5). Fig. 5. Effect of CKJ on the alkaline phosphatase activities of the C2C12 osteoblastic cell during differentiation. Data represent the mean±sd of triplicate determinations from three separate experiments. P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGAincreased Cheonggukjang.

폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 669 A B C D Fig. 6. Effect of CKJ on mrna expression of osteoblast-related genes in of the C2C12 osteoblastic cell during differentiation.

Data represent the mean±sd of triplicate determinations from three separate experiments P<.5 versus non treated group, P<.1 versus non treated group.

OCN의발현은골이석회화되어결절을형성하는시기와일치하는반면, OPN은 OCN과달리조골세포분화의초기와석회화기에나타난다. Col1은 Runx2의발현이증가할때유도되며이는뼈의무기질화를촉진한다 (32). ALP의발현역시증대되면조골세포의분화를촉진한다고알려졌다. 이를토대로본실험에서는청국장이조골세포분화와관련된유전자발현에미치는영향에대해알아보고자하였다.

6 폴리감마글루탐산 (PGA) 함유량이증가된청국장이조골세포분화에미치는영향 669 A B C D Fig. 6. Effect of CKJ on mrna expression of osteoblast-related genes in of the C2C12 osteoblastic cell during differentiation. (A) osteocalcin (OCN), (B) type Ⅰ collagen (Col1), (C) alkaline phosphatase (ALP), and (D) osteopontin (OPN). Data represent the mean±sd of triplicate determinations from three separate experiments P<.5 versus non treated group, P<.1 versus non treated group. CKJ A: natural Cheonggukjang, CKJ B: PGA-increased Cheonggukjang. 에서발현되는유전자로서일반적으로골기질의석회화를촉진하는요인으로작용하는것으로알려졌다 (32,33). 또한 OCN은 bone morphogenetic proteins(bmps) 에의해발현이촉진되며, 특히 BMP-4에의해발현이증가한다 (33). OCN의발현은골이석회화되어결절을형성하는시기와일치하는반면, OPN은 OCN과달리조골세포분화의초기와석회화기에나타난다. Col1은 Runx2의발현이증가할때유도되며이는뼈의무기질화를촉진한다 (32). ALP의발현역시증대되면조골세포의분화를촉진한다고알려졌다. 이를토대로본실험에서는청국장이조골세포분화와관련된유전자발현에미치는영향에대해알아보고자하였다. ALP의발현은모든농도및청국장처리군에서증가하였으며이는 ALP의활성정도와같은양상을나타내었다. 또한다른유전자인 OCN, OPN, Col1의유전자발현역시모든농도및시료처리군에서대조군보다높은발현을보였다. 또한청국장 A보다청국장 B가더높은발현을보였다. 이로인하여본연구진은청국장 B가청국장 A보다 ALP, OCN, OPN, Col1 등의유전자발현을증대시킴으로써조골세포의석회화및분화를증대시켜골다공증에더효과적일것으로생각한다 (Fig. 6). 요약 Polyglutamic acid(pga) 함유량이증대된청국장이조골세포에미치는영향을세포수준에서관찰하고자하였다. 조골세포에미치는영향을관찰하기위하여세포생존율, 염기성인산분해효소 (alkaline phosphatase, ALP) 활성, 골석회화형성능, 조골세포분화관련유전자발현능을측정하였다. 세포독성이없는농도에서염기성인산분해효소활성을측정한결과농도에의존적으로 ALP 활성이증가하였으며, 일반청국장 A보다 PGA 함유량이증가한청국장 B가더높은 ALP 활성증가효과를나타내었다. 청국장의골석회화형성능을측정한결과역시청국장 A보다 B가더높은석회화형성능을나타내었다. 또한분화관련유전자인 OCN, OPN, Col1, ALP 역시청국장 B가 A보다유전자발현이더높게나타났다. 이러한실험결과를바탕으로 PGA 가증대된청국장이기존청국장보다조골세포의활성에효과적일것으로생각한다. 감사의글본연구는산업통상자원부와한국산업기술진흥원의지역특

7 67 이기호 심미옥 송용수 정호경 장지훈 김민석 김태묵 이효은 안병관 정원석 성화산업육성기술개발사업 (R&D) 으로수행된연구결과입니다. REFERENCES 1. Seo J, Hwang ES, Kim GH Antioxidative and differentiation effects of Artemisia capillaris T. extract on hydrogen peroxide-induced oxidative damage of MC3T3-E1 osteoblast cells. J Korean Soc Food Sci Nutr 4: Kim MJ, Im NK, Yu MH, Kim HJ, Lee IS Effects of extracts from sarcocarp, peels, and seeds of avocado on osteoblast differentiation and osteoclast formation. J Korean Soc Food Sci Nutr 4: Shin JM, Park CK, Shin EJ, Jo TH, Hwang IK. 28. Effects of Scutellaria radix extract on osteoblast differentiation and osteoclast formation. Korean J Food Sci Technol 4: Canalis E Effect of growth factors on bone cell replication and differentiation. Clin Orthop Relat Res 193: Canalis E, McCarthy T, Centrella M Growth factors and the regulation of bone remodeling. J Clin Invest 81: Oh HJ. 25. Therapy of osteoporosis in climacteric. J Korean Acad Fam Med 21: Wu D, Malda J, Crawford RW, Xiao Y. 27. Effects of hyperbaric oxygen on proliferation and differentiation of osteoblasts derived from human alveolar bone. Connect Tissue Res 48: Dong GC, Chen HM, Yao CH. 28. A novel bone substitute composite composed of tricalcium phosphate, gelatin and Drynaria fortunei herbal extract. J Biomed Mater Res A 84: Aldercreutz H, Mazur W Physiological effects of phyto-estrogens in relation to cancer and other human health risks. Proc Nutr Soc 55: Baker VL, Leitman D, Jaffe RB. 2. Selective estrogen receptor modulators in reproductive medicine and biology. Obstet Gynecol Surv 55: S21-S Gray TK, Flynn TC, Gray KM, Nabell LM β- Estradiol acts directly on the clonal osteoblastic cell line UMR16. Proc Natl Acad Sci 84: Lee BK, Jang YS, Yi SY, Chung KS, Choi SY Immunomodulators extracted from Korean-style fermented soybean paste and their function. 1. Isolation of B cell mitogen from Korean-style fermented soybean paste. Korean J Immunol 19: Youn KC, Kim DH, Kim JO, Park BJ, Yook HS, Cho JM, Byun MW. 22. Quality characteristics of the chungkookjang fermented by the mixed culture of Bacillus natto and B. licheniformis. J Korean Soc Food Sci Nutr 31: Kim JS, Yoo SM, Choe JS, Park HJ, Hong SP, Chang CM Physicochemical properties of traditional chonggugjang produced in different regions. Agric Chem Biotechnol 41: Joo EY, Park CS Antioxidant and fibrinolytic activities of extracts from soybean and Chungkukjang (fermented soybean paste). Korean J Food Preserv 18: Park H, Yoon L, Kim HS Effects of fermented soybean paste Chungkukjang on the immunoreactivity in ovariectomized mice. J Korean Soc Food Sci Nutr 42: Harada S, Matsumoto T, Ogata E Role of ascorbic acid in the regulation of proliferation in osteoblast-like MC3T3-E1 cells. J Bone Miner Res 6: Takamizawa S, Maehata Y, Imai K, Senoo H, Sato S, Hata R. 24. Effects of ascorbic acid and ascorbic acid 2-phosphate, a long-acting vitamin C derivative, on the proliferation and differentiation of human osteoblast-like cells. Cell Biol Int Cheng C, Asada Y, Aida T Production of γ-polyglutamic acid by Bacillus licheniformis A35 under denitrifying conditions. Agric Biol Chem 53: Borbely M, Nagasaki Y, Borbely J, Fan K, Bhogle A, Sevoian M Biosynthesis and chemical modification of poly (γ-glutamic acid). Polymer Bull 32: Bang BH, Rhee MS, Kim KP, Yi DH Influences of culture medium components on the production poly (γ-glutamic acid) by Bacillus subtilis GS-2 isolated chungkookjang. Korean J Food & Nutr 25: Maeda T, Matsunuma A, Kawane T, Horiuchi N. 21. Simvastatin promotes osteoblast differentiation and mineralization in MC3T3-E1 cells. Biochem Biophys Res Commun 28: Schiller PC, D'ippolito G, Balkan W, Roos BA, Howard GA. 21. Gap-junctional communication is required for the maturation process of osteoblastic cells in culture. Bone 28: Yun J, Hwang ES, Kim GH Effects of Chrysanthemum indicum L. extract on the growth and differentiation of osteoblastic MC3T3-E1 cells. J Korean Soc Food Sci Nutr 4: Lee YS. 21. Effect of isoflavones on proliferation and oxidative stress of MC3T3-E1 osteoblast-like cells. Korea Soybean Digest 18: Choi EM, Koo SJ. 22. Effects of soybean ethanol extract on the prostaglandin E 2 and interleukin-6 production in osteoblastic cells. Food Res Int 35: Stein GS, Lian JB, Owen TA Relationship of cell growth to the regulation of tissue-specific gene expression during osteoblast differentiation. FASEB J 4: Choi EM, Suh KS, Kim YS, Choue RW, Koo SJ. 21. Soybean ethanol extract increases the function of osteoblastic MC3T3-E1 cells. Phytochemistry 56: Newmark HL Plant phenolics as potential cancer prevention agents. Adv Exp Med Biol 41: Jeon MH, Kim M Effect of Hijikia fusiforme fractions on proliferation and differentiation in osteoblastic MC3T3-E1 cells. J Life Sci 21: Park MJ, Joo BS, Lee JE, Kim HJ, Moon SE, Moon HS. 21. Alendronate enhances osteoblastic differentiation with increased expression of Id-1 and Id-2 in pre-osteoblast cell line, MC3T3-E1. Korean J Obstet Gynecol 53: Yang HM, Seo HS Effects of ascorbic acid on osteoblast differentiation in MC3T3-E1 cells. Soonchunhyang Medical Science 19: Kozawa O, Hatakeyama D, Tokuda H, Oiso Y, Matsuno H, Uematsu T. 22. Sphingomyelinase amplifies BMP-4-induced osteocalcin synthesis in osteoblasts: role of ceramide. Cell Signal 14:

Journal of Life Science 2011, Vol. 21. No μ μ

Journal of Life Science 2011 Vol. 21. No. 8. 1120~1126 ISSN : 1225-9918 DOI : http://dx.doi.org/10.5352/jls.2011.21.8.1120 μ μ μ α β Journal of Life Science 2011, Vol. 21. No. 8 1121 μ μ 1122 생명과학회지 2011,