【별지 제23호 서식】
|
|
- 은희 동
- 5 years ago
- Views:
Transcription
1 < 표지 > 완결과제최종보고서 일반과제 ( ), 보안과제 ( ) ( 과제번호 : PJ009065) 고추 Marker Assisted Backcross 를이용한고효율분자육종시스템구축 (Development of a high-throughput molecular breeding system using marker assisted backcross in pepper ) 주관연구기관명 : 농우바이오 연구수행기간 농촌진흥청
2
3 요약문 Ⅰ. 제목 : 고추 Marker Assisted Backcross 를이용한고효율분자육종시스템구축 Ⅱ. 연구개발의목적및필요성 - 주요선진국은일찍부터종자산업의중요성을인식하고유전자원확보와첨단생명공학을이용한신품종개발에역점을두어왔고 따라서종자산업선 후발국간에유전자원의확보및이용을위한경쟁이심화되고신품종보호권등은국가간쟁점으로대두되고있음 신속하게품종을개발하기위해서는분자표지를이용하여육종재료가지니는유용유전자의유전자형 을정확히파악함으로써 우량개체선발효율의극대화하기위한분자표지를이용한육종시스템정착이필수적임 - 다국적종자회사는육종연한을단축하기위하여이미자체적으로 유전형분석플랫폼으로시스템을구축하고있음 그러나국내종자회사는아가로즈젤을이용한 를주로활용하고있어유전형분석의효율이떨어지고 이에따라육종연한이길어짐 국내종자회사의국제경쟁력을강화하기위해서 분석시스템을개발할필요가있음 Ⅲ. 연구개발의내용및범위 을통한품종육성 유전형분석을하기위해서 분석시스템를구축함 또한 를진행하여식물계통에대한적용성을확인함 유전형분석키트개발 많은 유전형분석키트는품종을구별하거나 병원균의진단 인간유전자분석등에활용되어왔음 키트는한번에약 개이상의유전형을분석할수있는시스템으로 개의유전형을분석해야하는 시스템에활용하기에는분석할수있는유전형의수가제한적이기에적합하지않지만 둘이상의형질의 기반의 시스템에는매우유용하게사용가능함 Ⅳ. 연구개발결과 전통육종에분자마커를활용한선발기술등의첨단기술을활용한분자육종의
4 접목이이루어졌으며 보다많은분자마커를저비용 고효율로분석할수있는시스템 의개발을수행함 고추와토마토에서저항성 유전형분석키트각각개발함 Ⅴ. 연구개발결과의활용계획 최근식물분자유전학은엄청난발전을이룩하였으나 이러한유전정보와첨단기술을국내품종개발에활용하는것은이제막시작단계임 향후식물의형질을결정하는분자유전학적지식을바탕으로한유전자조작기술이품종개량과분자마커를통한선발에활용되면전통육종으로는어려웠던형질의개량이가능해질것전망이며 를이용한육종은품종개발연한을획기적으로단축할것으로전망됨
5 S U M M A R Y Next-generation sequencing (NGS) technology and fast improvement in plant genetics have elevated to massive development of molecular genetic markers through fast analysis of huge molecular biological data. Furthermore, in domestic commercial breeding of horticultural crops, the application of marker assisted breeding (MAB) has been introduced recently. For effective improvement of cultivar breeding, in this research, transcriptome analysis and single nucleotide polymorphism (SNP) comparison with high density pepper map in UC-DAVIS were performed using four lines of Capsicum annuum and C. chinense. For rapid analysis of MAB of tolerant pepper lines, 412 Fluidigm probes were newly designed in this study. These designed probes and SSR and COSII markers were applied for background selection through the MAB program. In addition, powdery mildew (PM), tomato spot wilt virus (TSWV) resistance related markers were subjected to foreground selection of BC1, BC2, and BC3 progenies. The MAB system using Fluidigm probes, and trait-related and common markers was introduced into domestic pepper breeding, which will rapidly approach to a new elite line and a commercial tolerant cultivar. Recent breeding technology is using molecular markers for genotyping of useful gene. Many breeders are generally using the MAS (Marker assisted selection) marker for selecting objective characters. On the other hand, the MAB (marker assisted backcross) marker that using SNP (Single nucleotide polymorphism), is not commonly used. SNP marker is reported that related with metabolism, function, characteristics, pathogen resistance, according to its location. Therefore, scientists are research to find the new SNP location with function. Based on the SNP information that has various pathogen resistances for pepper and tomato, we developed the test kit with multiplex PCR. In case of the kit for pepper, the SNP information that has pathogen resistance of tobacco mosaic virus (TMV), Bacterial spot (BS), Chilli venial mottle virus (ChiVMV), Phytophthora blight (Phyto) were used. And for tomato, the SNP information that has pathogen resistance of meloidogyne incognita (Mi), tomato mosaic virus (ToMV), tomato yellow leaf curl virus (TYLCV), leaf mold (Cf9), fusarium wilt (I2) were used. The test kit is appropriate to be applied for small-sized nursery company and private breeders who cannot afford MBA analysis that needs expensive machine and reagents. And furthermore, by reducing breeding time, early promoted superior cultivar would help to grow national competitiveness.
6 목 차 제 1 장서론 1 제 2 장국내외기술개발현황 4 제 3 장연구개발수행내용및결과제1세부 7 제1협동 33 제 4 장연구개발목표달성도및대외기여도 55 1절목표대비대외달성도 55 2절정량적성과 56 제 5 장연구개발결과의활용계획 57 제 6 장연구개발과정에서수집한해외과학기술정보 58 제 7 장기타중요변동사항 59
7 제 8 장국가과학기술종합정보시스템에등록한연구장비현황 60 제 9 장참고문헌 61
8 - 1 -
9 - 2 -
10 표 신속대량유전형분석의장점 항목 의다량분석분석비용 분석시약분석인력분석시간 신속대량분석법도입효과 배이상의 분석수증가 유전형분석비용감소기존 분석시약과동일 이상실험실인원감소유전형분석에소요되는시간이개선 - 3 -
11 - 4 -
12 - 5 -
13 - 6 -
14 표 2. 전사체염기서열을분석한교배조합의양친목록 교배조합 모친 부친 GMSK GMS-DCA(50-1) PI8000(4027-2) TSWV KSWP(4170-1) RPQ(4056-2) PM PCH14003(4285-1) PMR(4057-1) - 7 -
15 그림 2. 전사체염기서열을이용한 SNP 발굴파이프라인
16 - 9 -
17 그림 3. total RNA 추출사진. 18S, 28S 위치에서뚜렷한 band 가관찰되었다. 그림 4. Agilent 2100 Bioanalyzer 를이용해 QC 를분석한결과예시. 18S, 28S 지역에서높은피크값을확인했다. 표 3. 6개부모친의 NGS sequencing 결과 Lines Bases Reads Read length ,247,161,666 81,655, ,317,488,582 72,450, ,464,096,748 73,901, ,470,600,936 83,867, ,959,879,892 78,810, ,421,567,042 93,282, Average 8,146,799, ,661,
18 표 4. 6개부모친의 Quality trimming 결과 (PE : paired end reads, S : single reads) Lines Reads before Kept reads Discarded reads trimming Paired Singletons Total Paired Singletons Total ,655,066 80,027, ,861 80,827,797 27, , , ,450,382 71,248, ,893 71,838,779 21, , , ,901,948 72,809, ,691 73,345,911 19, , , ,867,336 82,471, ,908 83,158,020 22, , , ,810,692 77,354, ,703 78,074,163 16, , , ,282,842 92,063, ,109 92,663,939 18, , ,903 Average 80,661,378 76,782, ,611 79,984,768 21, , ,
19 표 5. 6개부모친의 Alignment 결과 Lines Trimmed reads (A) Aligned reads (B) Ratio (B/A X 100) ,827,797 49,710, % ,838,779 44,921, % ,345,911 45,099, % ,158,020 52,512, % ,074,163 49,079, % ,663,939 56,575, % Average 79,984,768 49,649, % 표 6. Depth에따른양친사이의 SNP 수 Parents combination Depth vs ,485 6,951 4, vs ,325 6,130 3, vs ,957 9,743 6,501 Average 10,256 7,608 4,
20 표 7. 병저항성유전자혹은연관분자표지의 SNP분석 Pathogen Locus Marker Sequence length SNP Reference CMV Cmr1 Tm-1Intr_ T1616BAC Kang et al., 2010 TEV pvr1 gene Kang et al., 2005 TSWV Tsw TSWV N Hoang et al., TSWV S unpublished ChiVMV pvr6 gene Hwang et al., 2009 TMV L gene Tomita et al., 2011 Xanthomonas Bs2 gene Thomas et al., 1999 Bs3 gene Romer et al., 2007 Phytophthora QTL5 PhytoSNP Choi et al., unpublished
21 그림 5. SNP filtering 과정. 4 단계의 filtering 과정을거쳐 58,151 개의 SNP 에서 1,910 개 의 SNP 선발
22 표 8. 교배친의다형성검정 (polymorphism test) 을위한분자표지 염색체 SNP probe 크기 (cm) 분자표지사이의간격 (cm/ 분자표지 )* Total ,910개의 SNP 중염색체별로분자표지간거리가평균 3.55 cm이되도록 412개의 SNP 를선발하여 BioMark TM probe를제작하였다. * 인접한두분자표지사이의거리를의미. 염색체크기 (cm) / SNP probe 개수
23 그림 6. 교배친의 다형성 검정(polymorphism test)을 위한 분자표지 유전자 지도. 1,910개의 SNP 중 BioMarkTM probe로 디자인 된 412개 SNP 분자표지의 유전자 지도. 염색체 의 왼 쪽은 유전적 거리(cM)을 의미하고 오른쪽은 probe의 이름을 의미한다. 나. 다형성 검정(polymorphism test) 및 단일 염기 다형성 분자표지 선발 2개 교배 조합의 양친 4계통을 두 반복으로 412개 분자표지들을 이용하여 교배친의 유 전형 분석을 실시하였다(표 9). 유전자형이 이형 접합체이거나, 각각의 교배친 사이에 다형성이 없는 분자표지를 제외한 결과 PM 저항성 교배조합의 양친에서는 다형성이 있는 분자표지가 122개였고, TSWV 저항성 교배조합의 양친에서는 107개 발견 되었다. Fluidigm사의 BioMarkTM HD System이 한 번에 분석할 수 있는 단일 염기 다형성 분
24 . 표 9. 다형성검정을실시한교배조합의양친목록 교배조합 모친 부친 PM 저항성 PCH14003 (4285-1) PMR (4057-1) TSWV 저항성 KSWP (4170-1) RPQ (4056-2) 표 10. 교배친의다형성검정과분자표지선발결과 교배조합 다형성이발견된분자표지 ( 개 ) 염색체 PM 저항성 TSWV 저항성 Total 선발된분자표지 ( 개 ) PM 저항성 TSWV 저항성 선발된분자표지사이의간격 (cm/ 분자표지 )* PM 저항성 TSWV 저항성 개 BioMark TM probe 를사용하여다형성검정결과육성집단별로양친간다형성이존재하 는 probe 를확인할수있었다. PM 저항성교배조합의양친에서는 122 개, TSWV 저항성교배조 합의양친에서는 107 개의 probe 가확인되었으며, 각육성집단별로 BioMark TM 사용될 48 개분자표지를선발하였다. 선발된분자표지간간격은평균 cm 이다. * 인접한두분자표지사이의거리를의미. 염색체크기 (cm) / SNP probe 개수. HD system 에
25 그림 7. 육성집단별단일염기다형성분자표지유전자지도. PM 저항성과 TSWV 저항성교배조합의양친에대해 412개 BioMarkTM probe로다형성검정결과선발된 48개 SNP 분자표지. 초록색이 PM 저항성육성집단에사용될분자표지를나타내고빨간색이 TSWV 저항성육성집단에사용될분자표지를나타낸다
26 그림 7. PM 저항성육성집단 ( 여교잡 1세대 ) 의 BioMarkTM HD system 분석결과. PM 저항성육성집단의 75개체에대하여 48개 SNP 분자표지를사용하여 BioMarkTM HD system 분석결과를색깔로표시하였다. 진한녹색이반복친의유전형을의미하고녹색이이형접합유전형, 노란색이공여친의유전형을의미한다. 흰색으로표시된부분은유전형분석의정확도가낮은부분을의미한다. 가장위에있는행이반복친과의유전형유사도가가장높은개체를의미하며아래로내려갈수록반복친과의유전형유사도가낮은개체를의미한다. 반복친과유전형유사도가가장높은개체의유사도는 84% 이며가장낮은개체의유사도는 63% 이며평균값은 73.5% 이다. 그림 8. BioMarkTM HD system 으로부터선발하여육성중인여교잡 1 세대 PM 저항성고추식물체사진
27 그림 10. PM 저항성육성집단 ( 여교잡 2 세대 ) 의 BioMarkTM HD system 분석결과. 그림에대한설명은그림 7. 와같다. 반복친과유전형유사도가가장높은개체의유사도는 91% 이며가장낮은개체의유사도는 84% 이며평균값은 87.5% 이다
28 그림 11. BioMarkTM HD system 으로부터선발하여육성중인여교잡 2 세대 PM 저항성고추식물체사진
29 그림 12. PM 저항성육성집단 ( 여교잡 3세대 ) 의 EP1TM system 분석결과. PM 저항성육성집단의 94개체에대하여 96개의분자표지를이용하여반복친과의유사도를측정하였다. 가로축이분자표지를의미하며세로축이개체를의미한다파란색으로표시된부분이반복친의유전형을나타내며초록색으로표시된부분이이형접합상태의유전형이다. 개체는반복친과의유사도를기준으로내림차순으로정렬하였으며유사도가가장높은개체는 99.4%, 가장낮은개체는 95.9% 이다. 그림 13. BioMarkTM HD system 으로부터선발하여육성중인여교잡 3 세대 PM 저항성고추식물체 사진
30 그림 14. TSWV 저항성육성집단 ( 여교잡 1 세대 ) 의아가로즈젤기반 COSII, SSR 의활용분석결과 그림에대한설명은그림 7 과같다. 반복친과유전형유사도가가장높은개체의유사도는 80% 이며가장낮은개체의유사도는 49% 이며평균값은 64.5% 이다
31 그림 15. TSWV 저항성육성집단 ( 여교잡 2 세대 ) 의 BioMarkTM HD system 분석결과 그림에대한설명은그림 7 과같다. 반복친과유전형유사도가가장높은개체의유사도는 96% 이며가장낮은개체의유사도는 71.1% 이며평균값은 83.2% 이다
32 그림 16. BioMarkTM HD system 으로부터선발하여육성중인여교잡 2 세대 TSWV 저항성고추식물체 사진
33 그림 17. BioMarkTM HD system 으로부터선발후육성중인 BC2F2 의 TSWV 저항성고추식물체사진 그림 18. BioMarkTM HD system 으로부터선발후육성중인 BC2F3 의 TSWV 저항성고추식물체사진
34 그림 19. 샘플수에따른반복친과의유사도최댓값. 141개의샘플중 20, 40, 60, 80, 100, 120, 140개의샘플을임의추출하였으며각각의경우에반복친과의유사도최댓값을 10,000 반복으로수행하였다. 샘플수가 100개이상일경우반복친과의유사도가가장높은개체를선발할확률이높다
35 그림 20. 마커수와샘플수에따른반복친유사도최댓값분산. 141개의샘플과 161개의분자표지를대상으로여러조합의임의추출을하여각각의경우에대해반복친유사도최댓값의분산을 10,000 반복으로측정하였다. 샘플수와분자표지수증가에따라분산의크기가감소하였다. 샘플수가 100개이상, 분자표지수가 120개이상일경우분산크기가작아 MAB의정확도가높아진다
36 그림 21. 연구결과종합. 1차년도연구를통해얻은 58,151개의 SNP에서 filtering, BioMarkTM probe design, polymorphism test를통해육성프로그램별로 48개의 SNP marker를선발하였다. 선발된 SNP marker는육성집단별로적용되어반복친과의유전형유사도가높은개체를선발하는데사용되었으며유사도가가장높은개체를선발후개체를고정시키고품종등록을진행하였다
37 표 11. Segregation analysis of resistance to chilli veinal mottle virus in NW3, NW4, F1, F2, and BC1 offsprings Population No. of phenotypes Expected ratio Resistant Susceptible Resistant Susceptible ϰ p P 1 (C. annuum NW3 ) P 2 (C. annuum NW4 ) F F BC 1 (F 1 P 1 ) BC 1 (F 1 P 2 ) 그림 21. urves from high-resolution melting (HRM) analysis of the CVMV1 (the left box) and CVMV2 (the right box) markers in parents and F1 plants. These markers were derived from the amplified fragment length polymorphism fragment sequences of
38 EcoRI AAA/MseI CGG and EcoRI ACG/MseI CTA, respectively. The HRM results contain three genotypes, homozygous resistance (RR), heterozygous resistance (RS), and homozygous susceptibility (SS), which showed different melting curves. 그림 22. Amplified bands from the CVMV3 cleaved amplified polymorphic sequences (CAPS) marker linked to ChiVMV resistance in parents (P1: NW3; P2: NW4), F1, and F2 populations. M: 1 kb plus ladder
39 그림 23. ChiVMV 저항성 CAPS 분자표지를 SNP 로전환하여분석한결과사진. 저항성 ( 빨간색 ) 및 이병성 ( 파란색 ) 동형접합체와이형접합체들 ( 초록색 ) 간에그룹을형성하여분자표지전환이잘되었음을 확인함
40 Cmr1 (R)/cmr1 (S) TGCCATAGGAGCCAGCAGAGTGAAATATGACAAGAGAGCGACTTATGATTGATCTTATCTCAGGAATTATTT[T/C]CT TACCGATAGGTTGCTGGTTATGGGATAGCTTGAAATG [T/C]
41 5 a tgagaactttcgacc 3 5 GTCTTGATA[T/A]AATCTTCAAAGCTGGCAA R S NTC R S NTC R S NTC Resistance(O); YCM334 / Susceptible(X); Tean Phyto Resistance Phyto Common 1 Taactttgccagctttgaagatta tcaaatagaaataggcaggacact 2 tataactttgccagctttgaagatta tcaaatagaaataggcaggacact 3 taactttgccagctttgaagagta tcaaatagaaataggcaggacact
42 Pep.M NTC Disease Genes Marker/Gene Genetic distance
43 CMV Cmr1 Tm-1Intr_3 1cM T1616BAC 1cM TEV pvr1 Gene - TMV L Gene - TSWV Tsw TSWV N cM TSWV S cM ChiVMV pvr6 Gene - 세균성점무늬병 (Xanthomonas) Bs2 Gene (partial) - 세균성점무늬병 (Xanthomonas) Bs3 Gene - 역병 (Phytophthora) Phyto major QTL Phyto SNP cM IBP cM
44 [primer01] Tm-1Intr_3 [ Cmr1 (R) / cmr1 (S) ] [T/C] Primer 1 (Tm-1lntr_3)
45 - 38 -
46 선충뿌리혹병 ; Mi [G/A]
47 - 40 -
48 과색 총생화서 매운맛 종 빨강 노랑 주황 갈색 총생 비총생 신미 감미 C. annuum C. chinenese C. baccatum 4 3 C. frutescens 3 Total β β
49 원예적형질 유전자 mrna 크기 (bp) Mutation Reference 노랑과색 CCS 2,159 Deletion Popovsky, S. et al 주황과색 PSY 1,295 SNP Kim, O.R. et al, 2006 LCYB 1,785 SNP Guzman, I. et al CrtZ-2 1,112 SNP Borovsky, Y. et al 갈색과색 CL 1,280 SNP Borovsky, Y. et al 총생화서 FA 600 #2 exon duplication Elitzur, T. et al, 2009 매운맛 Pun1 1, bp deletion Ben-Chaim, A. et al
50 빨강 갈색 주황 노랑 종 + - * C. annuum C. chinenese C. baccatum C. frutescens 2 1 Total * CCS 유전자에 deletion이존재할경우 +, 존재하지않을경우 로표기함
51 - 44 -
52 - 45 -
53 [primer01] Tm-1Intr_3 [ Cmr1 (R) / cmr1 (S) ] [T/C] [primer02] T1616BAC [ Cmr1 (R) / cmr1 (S) ] [C/T] [primer04] TEV [ Pvr1 (S) / pvr1 (R) / pvr1 1 (R) / pvr1 2 (R) ] [G/A/G/G] [G/G/G/A] [primer07] TSWV S-1 [ Tsw (R) /tsw (S) ] [C/T] [A/G] [T/C]
54 Primer 1 (Tm-1lntr_3) Primer 2 (T1616BAC) bp 362bp Primer 4 (TEV) Primer 7 (TSWV) bp 436bp Primer 8 (ChiVMV) bp
55 Pep.M NTC Pep.M NTC
56 - 49 -
57 - 50 -
58 - 51 -
59 (A) (B) M NTC M M NTC M M NTC M M NTC M
60 - 53 -
61 - 54 -
62 - 55 -
63 - 56 -
64 - 57 -
65 - 58 -
66 - 59 -
67 해당사항없음
68 β β
69 - 62 -
70 < 뒤표지 >
박사후연구원의 연수세부과제책임자
표지 완결과제최종보고서 일반과제 보안과제 과제번호 소규모수확후처리시설의위생관리지침개발 중앙대학교 연구수행기간 농촌진흥청 - 1 - - 2 - 요약문 제목 연구개발의목적및필요성 연구개발의내용및범위 연구개발결과 - 3 - - 4 - - 5 - - 6 - - 7 - 연구개발결과의활용계획 - 8 - - 9 - - 10 - - 11 - 목 차 제 장서론 제 장국내외기술개발현황
More information발간등록번호
발간등록번호 3. 보고서요약서 보고서요약서 - 2 - - 3 - 4. 국문요약문 - 4 - 5. 영문요약문 < SUMMARY > - 5 - 6. 영문목차 < CONTENTS > - 6 - - 7 - 7. 본문목차 목차 - 8 - - 9 - 제 1 장. 연구개발과제의개요 - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 -
More information농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 : ~ ) 과제의최종보고서로제출합니다 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 (
농림축산식품부장관귀하 본보고서를 미생물을활용한친환경작물보호제및비료의제형화와현장적용매뉴 얼개발 ( 개발기간 :2014. 7. 29 ~ 2016. 7. 28.) 과제의최종보고서로제출합니다. 2016. 7. 28. 주관연구기관명 : 고려바이오주식회사 ( 대표자 ) 김영권 ( 인 ) 협동연구기관명 : 목원대학교산학협력단 ( 대표자 ) 고대식 ( 인 ) 협동연구기관명
More information발간등록번호 학술연구용역과제최종결과보고서 국민건강영양조사제기 차년도 영양조사질관리및전자조사표도입을위한사전조사실시 Quality Control and a Preliminary Study on Computer Assisted Personal Interview System for Nutrition Survey of KNHANES (2013) 주관연구기관 한국보건산업진흥원
More information: : : : : : : : : : : : - 1 -
: : : : : : : : : : : : - 1 - Ⅰ Ⅱ Ⅲ - 2 - Ⅳ - 3 - Ⅴ - 4 - - 5 - - 6 - - 7 - - 8 - 제 1 장 연구개발과제의개요 μm mm cm cm - 9 - - 1 - - 11 - - 12 - - 13 - - 14 - 제 2 장 국내외기술개발현황 - 15 - - 16 - - 17 - - 18 - - 19 -
More information04-다시_고속철도61~80p
Approach for Value Improvement to Increase High-speed Railway Speed An effective way to develop a highly competitive system is to create a new market place that can create new values. Creating tools and
More informationCan032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
More information제출문 - 2 -
제출문 - 2 - 요약문 - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30
More information- 3 - 1 10. 10. 12 1. 12 2. 12. 13 2 14 2.1 14 2.2 17 2.3 18 2.4 19 2.5 21 (1) 21 (2) DNA 23 (3) 24 (4) 16S rrna 25 (5) (Polymerase chain reaction, PCR) 26 (6) PCR Primer 27 2.6 28. / 28-4 - (1) Bioaerosol
More information주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 제 명 주 의 ( 주의내용기재 ) 2 0 1 1 ( 글 14 point 고딕체 ) 주관연구기관 질병관리본부 질병관리본부 주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다.
More information01-15(3)-12(최장경).fm
Res. Plant Dis. 15(3) : 165-169 (2009) Research in Plant Disease The Korean Society of Plant Pathology GM s ü š w Cucumber mosaic virus v y 1 Á y Á»x 1 Á * w w, 1 w y w Comparative Analysis of Coat Protein
More information212 Research in Plant Disease Vol. 20 No. 3., 7 (Kim, 2004). Colletotrichum (Park Kim, 1992),.. (Agrios, 2008)... 1,202, 256 92, 147, 11 (RDA, 2014).
식물병연구 Research Article Open Access Res. Plant Dis. 20(3) : 211-215(2014) http://dx.doi.org/10.5423/rpd.2014.20.3.211 Protective Activity of the Mixtures of Pine Oil and Copper Hydroxide against Bacterial
More informationPJTROHMPCJPS.hwp
제 출 문 농림수산식품부장관 귀하 본 보고서를 트위스트 휠 방식 폐비닐 수거기 개발 과제의 최종보고서로 제출 합니다. 2008년 4월 24일 주관연구기관명: 경 북 대 학 교 총괄연구책임자: 김 태 욱 연 구 원: 조 창 래 연 구 원: 배 석 경 연 구 원: 김 승 현 연 구 원: 신 동 호 연 구 원: 유 기 형 위탁연구기관명: 삼 생 공 업 위탁연구책임자:
More information농림수산식품 연구개발사업 운영규정
- 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - 1. - 29 - - 30 - - 31 - -
More informationl l l l l l l l l Lee, Geon Kook None This project was designed to establish the Tumor Bank of National Cancer Center in 2000. From the first tumor sample in 2000, the total of tumor and tumor-related
More informationOutput file
240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 An Application for Calculation and Visualization of Narrative Relevance of Films Using Keyword Tags Choi Jin-Won (KAIST) Film making
More informationY 1 Y β α β Independence p qp pq q if X and Y are independent then E(XY)=E(X)*E(Y) so Cov(X,Y) = 0 Covariance can be a measure of departure from independence q Conditional Probability if A and B are
More information03-ÀÌÁ¦Çö
25 3 (2004 9 ) J Korean Oriental Med 2004;25(3):20-31 1), 2), 3) 1) 2) 3) Grope for a Summary Program about Intellectual Property Protection of Traditional Knowledge (TK)etc. Discussed in WIPO Hwan-Soo
More information- 1 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - ι κ λ β β β β β - 7 - - 8 - - 9 - - 1 - - 11 - 마. - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 2 - - 21 - - 22 - - 23 - - 24 - ι κ λ β β - 25 - - 26 - -
More information84/84
완결과제최종보고서 일반과제 보안과제 과제번호 유기농업기준에적합한착과및저장성향상기술개발 주 한국식물환경연구소 연구수행기간 농촌진흥청 목 차 제 장서론 제 장국내외기술개발현황 제 장연구개발수행내용및결과 절유기농기준에적합한착과촉진생리활성물질개발 연구개발수행내용 가 유기재배농가의착과촉진방법현황조사 나 천연물질중작물생리활성물질탐색 성분분석및 주요연구결과및고찰
More information- 1 -
11 1541000-001436-01 수출전략형신수요창출을위한홍마늘및바이오식품개발 (Development of red-garlic and its bio-food for create new market demand and develop of export items) - 1 - - 2 - - 3 - o o - 4 - o o - 5 - o α α - 6 - - 7
More information- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - 1) 통계청고시제 2010-150 호 (2010.7.6 개정, 2011.1.1 시행 ) - 4 - 요양급여의적용기준및방법에관한세부사항에따른골밀도검사기준 (2007 년 11 월 1 일시행 ) - 5 - - 6 - - 7 - - 8 - - 9 - - 10 -
More information기관고유연구사업결과보고
기관고유연구사업결과보고 작성요령 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 2001 ~ 2004 2005 ~ 2007 2008 ~ 2010 1 2/3 2 1 0 2 3 52 0 31 83 12 6 3 21 593 404 304 1,301 4 3 1 8 159 191 116 466 6 11 (`1: (1: 16 33 44 106
More informationAbstract Background : Most hospitalized children will experience physical pain as well as psychological distress. Painful procedure can increase anxie
Volume 12, Number 1, 92~102, An Intervention Study of Pain Reduction during IV Therapy in Hospitalized Children Myo-Jin Kim 1), Joung-Hae Bak 1), Won-Seok Seo 2) Mi-Young Kim 3), Sun-Kyoung Park 3), Jai-Soung
More informationDBPIA-NURIMEDIA
Kor. J. Hort. Sci. Technol. 29(2):130-134, 2011 파프리카시판품종에대한유전자적웅성불임성의대립성및분자표지의유용성검정 이준대 1 ㆍ도재왕 1 ㆍ한정헌 1 ㆍ안철근 2 ㆍ권오열 3 ㆍ김용권 3 ㆍ윤재복 1* 1 ( 주 ) 고추와육종기업부설연구소, 2 경남농업기술원수출농식품연구과, 3 농협 NH 종묘개발센터 Allelism and
More information384 Research in Plant Disease Vol. 23 No. 4,, 1. (INSV),,, (vein clearing), (Tomato spotted wilt virus, TSWV),.,,,,,, (Brisco-McCann Hausbeck, 2016; S
식물병연구 Note Open Access Res. Plant Dis. 23(4) : 383-387 (2017) https://doi.org/10.5423/rpd.2017.23.4.383 First Report of Impatiens necrotic spot virus in Hoya carnosa in Korea 1 2 1 1 1 3 1 * 1, 2, 3 *Corresponding
More information04서종철fig.6(121~131)ok
Development of Mobile Applications Applying Digital Storytelling About Ecotourism Resources Seo, Jongcheol* Lee, Seungju**,,,. (mobile AIR)., 3D.,,.,.,,, Abstract : In line with fast settling trend of
More information주의내용 주 의 1. 이보고서는질병관리본부에서시행한학술연구용역사업의최종결 과보고서입니다. 2. 이보고서내용을발표할때에는반드시질병관리본부에서시행한 학술연구용역사업의연구결과임을밝혀야합니다. 3. 국가과학기술기밀유지에필요한내용은대외적으로발표또는공개 하여서는아니됩니다.
편집순서 1 : 겉표지 학술연구용역사업최종결과보고서 과 원외폐렴원인균조사및내성감시 시스템구축 주의 ( 주의내용기재 ) ( 글 14 point 고딕체 ) 제명 2 0 0 Microbiological Etiology of Community acquired pneumonia and Surveillance network of resistance 주관연구기관 : 울산대학교의과대학
More information<32382DC3BBB0A2C0E5BED6C0DA2E687770>
논문접수일 : 2014.12.20 심사일 : 2015.01.06 게재확정일 : 2015.01.27 청각 장애자들을 위한 보급형 휴대폰 액세서리 디자인 프로토타입 개발 Development Prototype of Low-end Mobile Phone Accessory Design for Hearing-impaired Person 주저자 : 윤수인 서경대학교 예술대학
More information한국성인에서초기황반변성질환과 연관된위험요인연구
한국성인에서초기황반변성질환과 연관된위험요인연구 한국성인에서초기황반변성질환과 연관된위험요인연구 - - i - - i - - ii - - iii - - iv - χ - v - - vi - - 1 - - 2 - - 3 - - 4 - 그림 1. 연구대상자선정도표 - 5 - - 6 - - 7 - - 8 - 그림 2. 연구의틀 χ - 9 - - 10 - - 11 -
More information국립국어원 2011-01-28 발간 등록 번호 11-1371028-000350-01 신문과 방송의 언어 사용 실태 조사 연구 책임자: 남영신 국립국어원 2011-01-28 발간 등록 번호 11-1371028-000350-01 신문과 방송의 언어 사용 실태 조사 연구 책임자: 남영신 2011. 11. 16. 제 출 문 국립국어원장 귀하 2011년 신문과 방송의
More information¹ýÁ¶ 12¿ù ¼öÁ¤.PDF
논문요약 146 [ 주제어 ] 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 abstract Recent Development in the Law of DPRK on the
More information학습영역의 Taxonomy에 기초한 CD-ROM Title의 효과분석
,, Even the short history of the Web system, the techniques related to the Web system have b een developed rapidly. Yet, the quality of the Webbased application software has not improved. For this reason,
More information대한한의학원전학회지24권6호-전체최종.hwp
小兒藥證直訣 의 五臟辨證에 대한 小考 - 病證과 處方을 중심으로 1 2 慶熙大學校大學校 韓醫學科大學 原典學敎室 ㆍ 韓醫學古典硏究所 白裕相1,2*1)2) A study on The Diagnosis and Treatment Using The Theory of Five Organs in Soayakjeungjikgyeol(小兒藥證直訣) 1 Dept. of Oriental
More information#Ȳ¿ë¼®
http://www.kbc.go.kr/ A B yk u δ = 2u k 1 = yk u = 0. 659 2nu k = 1 k k 1 n yk k Abstract Web Repertoire and Concentration Rate : Analysing Web Traffic Data Yong - Suk Hwang (Research
More informationDBPIA-NURIMEDIA
FPS게임 구성요소의 중요도 분석방법에 관한 연구 2 계층화 의사결정법에 의한 요소별 상관관계측정과 대안의 선정 The Study on the Priority of First Person Shooter game Elements using Analytic Hierarchy Process 주 저 자 : 배혜진 에이디 테크놀로지 대표 Bae, Hyejin AD Technology
More information- i - - ii - - iii - - iv - - v - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - α α - 20 - α α α α α α - 21 - - 22 - - 23 -
More information장양수
한국문학논총 제70집(2015. 8) 333~360쪽 공선옥 소설 속 장소 의 의미 - 명랑한 밤길, 영란, 꽃같은 시절 을 중심으로 * 1)이 희 원 ** 1. 들어가며 - 장소의 인간 차 2. 주거지와 소유지 사이의 집/사람 3. 취약함의 나눔으로서의 장소 증여 례 4. 장소 소속감과 미의식의 가능성 5.
More information歯kjmh2004v13n1.PDF
13 1 ( 24 ) 2004 6 Korean J Med Hist 13 1 19 Jun 2004 ISSN 1225 505X 1) * * 1 ( ) 2) 3) 4) * 1) ( ) 3 2) 7 1 3) 2 1 13 1 ( 24 ) 2004 6 5) ( ) ( ) 2 1 ( ) 2 3 2 4) ( ) 6 7 5) - 2003 23 144-166 2 2 1) 6)
More informationDBPIA-NURIMEDIA
Short ommunication Journal of piculture 33(3) : 221~226 (218) DOI: 1.17519/apiculture.218.9.33.3.221 Detection of Sugar ane (Saccharum officinarum)-specific Gene from Sugar and Sugar-honey younghee Kim,
More information지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., KOSPI200.,. * 지능정보연구제 16 권제 1 호 2010 년 3 월
지능정보연구제 16 권제 1 호 2010 년 3 월 (pp.71~92),.,.,., Support Vector Machines,,., 2004 5 2009 12 KOSPI200.,. * 2009. 지능정보연구제 16 권제 1 호 2010 년 3 월 김선웅 안현철 社 1), 28 1, 2009, 4. 1. 지능정보연구제 16 권제 1 호 2010 년 3 월 Support
More information12È«±â¼±¿Ü339~370
http://www.kbc.go.kr/ k Si 2 i= 1 Abstract A Study on Establishment of Fair Trade Order in Terrestrial Broadcasting Ki - Sun Hong (Professor, Dept. of Journalism & Mass Communication,
More informationDBPIA-NURIMEDIA
27(2), 2007, 96-121 S ij k i POP j a i SEXR j i AGER j i BEDDAT j ij i j S ij S ij POP j SEXR j AGER j BEDDAT j k i a i i i L ij = S ij - S ij ---------- S ij S ij = k i POP j a i SEXR j i AGER j i BEDDAT
More informationPharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
More informationVol.258 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2017.12 Vol.258 C O N T E N T S 02 06 35 57 89 94 100 103 105 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2017.12 3 4 2017.12 * 6 2017.12 7 1,989,020 2,110,953 2,087,458 2,210,542 2,370,003 10,767,976
More information원고스타일 정의
논문접수일 : 2015.01.05 심사일 : 2015.01.13 게재확정일 : 2015.01.26 유니컨셉 디자인을 활용한 보행환경 개선방안 연구 A Study on Improvement of Pedestrian Environment on to Uniconcept Design 주저자 : 김동호 디지털서울문화예술대학교 인테리어실용미술학과 교수 Kim dong-ho
More information歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
More information09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
More information230 한국교육학연구 제20권 제3호 I. 서 론 청소년의 언어가 거칠어지고 있다. 개ㅅㄲ, ㅆㅂ놈(년), 미친ㅆㄲ, 닥쳐, 엠창, 뒤져 등과 같은 말은 주위에서 쉽게 들을 수 있다. 말과 글이 점차 된소리나 거센소리로 바뀌고, 외 국어 남용과 사이버 문화의 익명성 등
청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이 229 한국교육학연구 제20권 제3호 The Korea Educational Review 2014. 10. Vol.20. No.3. pp.229-251. 1) 청소년의 개인, 가정, 학교변인에 따른 비교육적 언어 사용의 차이* 강기수 조규판(동아대학교) [요 약] 본 연구의 목적은 청소년의 개인변인인
More information- 2 -
- 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - - 25 - - 26 - - 27 - - 28 - - 29 - - 30 -
More informationABSTRACT The new cultivars of Gymnocalycium mihanovichii, 'Yellow Boom', 'Pink Boom' and 'Red Boom' were developed at Cactus and Succulent Research In
ABSTRACT The new cultivars of Gymnocalycium mihanovichii, 'Yellow Boom', 'Pink Boom' and 'Red Boom' were developed at Cactus and Succulent Research Institute, Gyeonggi-do A.R.E.S. in 206. GG083326 and
More informationResearch in Plant Disease Vol. 23 No (Han, 2009; Kim, 1998, 2016; Lee, 2011, 2013; Tran Kim, 2012)., Fusarium, Verticillium (Hwang, 2009). R. s
식물병연구 Research Article Open Access Res. Plant Dis. 23(3): 228-233 (2017) https://doi.org/10.5423/rpd.2017.23.3.228 Resistance to Bacterial Wilt of Rootstock Varieties of Tomato and Graft Compatibility
More informationÆ÷Àå½Ã¼³94š
Cho, Mun Jin (E-mail: mjcho@ex.co.kr) ABSTRACT PURPOSES : The performance of tack coat, commonly used for layer interface bonding, is affected by application rate and curing time. In this study, bonding
More informationDBPIA-NURIMEDIA
김진주 김수연. 초등학생대상장애이해교육에활용된동화에나타난장애인관분석. 특수교육, 2013, 제12권, 제2호, 135-160... 20.,,. 4.,,.,..... 주제어 : 장애이해교육, 동화, 장애인관 1. ( 1 ) Incheon Munhak Elementary School ( )(, E-mail: sooyoun@ginue.ac.kr) Dept. of
More informationUPMLOPEKAUWE.hwp
시청공간을 넘어 새롭게 소통하기 - 인터넷 기반의 를 중심으로 - New Communication beyond Viewing Space - Focused on Social Television based on Internet - 주저자 오종서 Oh, Jongsir 동서대학교 방송영상전공 조교수 Assistant Professor of Dongseo University
More information연구분야 ( 코드 ) 과제번호 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Ide
연구분야 ( 코드 ) 과제번호 1210360 과제성격 ( 기초, 응용, 개발 ) 응용실용화대상여부비실용화 연구과제명 과제책임자 세부과제 지원목적과제프로그램공개가능여부공개 ( 공개, 비공개 ) ( 국문 ) 전장유전체유전자다형데이터를이용한표적유전자의발굴 ( 영문 ) Identification of disease-related target genes through
More information음주측정을 위한 긴급강제채혈의 절차와 법리, A Study on the Urgent Compulsory Blood
음주측정을 위한 긴급강제채혈의 절차와 법리 A Study on the Urgent Compulsory Blood Collecting for Investigation of Driving while Intoxicated 양 동 철 * (Yang, Dong-Chul) < 차 례 > Ⅰ. 서론 Ⅱ. 체내신체검사와 긴급압수ㆍ수색ㆍ검증의 허용범위 Ⅲ. 긴급강제채혈의 허용범위와
More informationuntitled
Performance Goal and Objectives Performance Goal and Objectives Technology Selection Criteria Philosophy and Program Management Source Selection Flight Test Approach and Organization Focus on Achieving
More information뉴스레터6호F?2??訝
February 2009 No.06 Roche Diagnostics Korea Co., Ltd. Focus Tech EDITORIAL February 2009 No.06 Contents Editorial 03 Focus 04 Product 10 Talk 12 Tech 14 Activity 19 Style 22 February 2009 No.06 02 03 FOCUS
More informationMicrosoft Word - pv_0602.doc
1 씨감자 생산 체계와 바이러스병 검사 (화란체계를 중심으로) 함 영 일 대관령원예농협 기술자문위원 To whom correspondence should be addressed. E-mail :yih0512430@yahoo.co.kr 목 차 1. 서언 2. 화란 씨감자 생산단계와 검사 2.1. 보증된 씨감자의 중요성 2.1.1. 최소한의 질적 요구조건 2.1.2.
More information02Á¶ÇýÁø
Analysis of Hazardous Fog and Index Development in Korea* Hye-Jin Cho** Abstract : The existing researches related to the fog have focused on mainly the fog itself and its spatial variation. This study
More informationVol.257 C O N T E N T S M O N T H L Y P U B L I C F I N A N C E F O R U M
2017.11 Vol.257 C O N T E N T S 02 06 38 52 69 82 141 146 154 M O N T H L Y P U B L I C F I N A N C E F O R U M 2 2017.11 3 4 2017.11 6 2017.11 1) 7 2) 22.7 19.7 87 193.2 160.6 83 22.2 18.4 83 189.6 156.2
More information½Éº´È¿ Ãâ·Â
Standard and Technology of Full-Dimension MINO Systems in LTE-Advances Pro Massive MIMO has been studied in academia foreseeing the capacity crunch in the coming years. Presently, industry has also started
More information(001~006)개념RPM3-2(부속)
www.imth.tv - (~9)개념RPM-(본문).. : PM RPM - 대푯값 페이지 다민 PI LPI 알피엠 대푯값과산포도 유형 ⑴ 대푯값 자료 전체의 중심적인 경향이나 특징을 하나의 수로 나타낸 값 ⑵ 평균 (평균)= Ⅰ 통계 (변량)의 총합 (변량의 개수) 개념플러스 대푯값에는 평균, 중앙값, 최 빈값 등이 있다. ⑶ 중앙값 자료를 작은 값부터 크기순으로
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:275~289 Received: 2016/12/02, Accepted: 2016/12/22 Revised: 2016/12/20, Published: 2016/12/30 [ABSTRACT] SNS is used in various fields. Although
More informationÀå¾Ö¿Í°í¿ë ³»Áö
Disability & Employment 55 Disability & Employment 56 57 Disability & Employment 58 59 Disability & Employment 60 61 Disability & Employment 62 63 Disability & Employment 64 65 Disability & Employment
More informationA
2009 4 A270412 < 차례> 1 요약 1 2 심사경위 2 3 심사경과 2 4 심사방법 3 5 심사신청자료검토 3 51 심사신청된식품의개요 3 52 식품으로의적합성검토 3 53 유전자재조합체의안전성 3 가 유전자재조합체의개발목적및이용방법에관한자료 3 나 숙주에관한자료 4 (1) 분류학적특성( 일반명 학명 계통분류등) 4 (2) 재배및품종개량의역사 4
More information탄도미사일 방어무기체계 배치모형 연구 (Optimal Allocation Model for Ballistic Missile Defense System by Simulated Annealing Algorithm)
탄도미사일 방어무기체계 배치모형 연구 (Optimal Allocation Model for Ballistic Missile Defense System by Simulated Annealing Algorithm) 이 상 헌 국방대학교 운영분석학과 우 122-875 서울시 은평구 수색동 205번지 Abstract The set covering(sc) problem
More informationIT현황리포트 내지 완
2007 Global Information Technology Development Reports 8 9 12 13 14 15 16 18 19 20 21 24 25 26 27 28 29 32 33 34 35 36 38 39 40 41 42 43 46 47 48 49 50 51 54 55 56 57 58 60 61 62 63
More informationDBPIA-NURIMEDIA
The e-business Studies Volume 17, Number 6, December, 30, 2016:237~251 Received: 2016/11/20, Accepted: 2016/12/24 Revised: 2016/12/21, Published: 2016/12/30 [ABSTRACT] Recently, there is an increasing
More informationRheu-suppl hwp
Objective: This paper reviews the existing Korean medical and public health, and nursing academy articles on disease-specific and domain-specific quality of life, and provides recommendations for the universally
More information002-022~41-기술2-충적지반
Improvement cases of waterproofing and auxiliary construction methods in alluvium soil tunnel In the past, subway tunnel is mostly applied to rock tunnel in order to secure the safety. But, in recent years,
More information<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
More informationWIDIN - Toolholding Catalogue.pdf
T CH CHUC UCK K 60 ER Strong Torque Power ER Chuck have strong torque power. Slim designed ER Nut were minimized an interruption to workpiece. If using Carbide Drill and coated drill, it can be improve
More information,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012). (2007) 26%., (,,, 2011;, 2006;
,,.. 400,,,,,,.,,, -, -, -., 3.. :, Tel : 010-9540-0640, E-mail : sunney05@hanmail.net ,,,.,,,, (, 2013).,.,, (,, 2011). (, 2007;, 2008), (, 2005;,, 2007).,, (,, 2010;, 2010), (2012),,,.. (, 2011:,, 2012).
More information., (, 2000;, 1993;,,, 1994), () 65, 4 51, (,, ). 33, 4 30, 23 3 (, ) () () 25, (),,,, (,,, 2015b). 1 5,
* 4.,, 3,,, 3,, -., 3, 12, 27, 20. 9,,,,,,,,. 6,,,,,. 5,,,,.. * (2016),. (Corresponding Author): / / 303 Tel: 063-225-4496 / E-mail: jnj1015@jj.ac.kr ., (, 2000;, 1993;,,, 1994), 2000. 2015 () 65, 4 51,
More information27 2, 17-31, , * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** ( :
27 2, 17-31, 2009. -, * ** ***,. K 1 2 2,.,,,.,.,.,,.,. :,,, : 2009/08/19 : 2009/09/09 : 2009/09/30 * 2007 ** *** (: dminkim@cau.ac.kr) 18 한국교육문제연구제 27 권 2 호, 2009. Ⅰ. (,,, 2004). (,, 2006).,,, (Myrick,
More information03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
More information11강. 교배육종법
11 강. 교배육종법 1. 이론적근거 2. 육종목표설정, 교배친의선정및교배방법 3. 계통육종법 4. 집단육종법 5. 1개체1계통법 6. 여교배육종법 11. 교배 ( 교잡 ) 육종법 Breeding by hybridization 의의 : 재배식물의품종간또는계통간교잡 ( 교배 ) 을통해서, 또는비교적근연의종속간교배를통하여희망하는유용유전자를재조합하거나새로도입함으로써우량품종을육성하는것.
More information09김정식.PDF
00-09 2000. 12 ,,,,.,.,.,,,,,,.,,..... . 1 1 7 2 9 1. 9 2. 13 3. 14 3 16 1. 16 2. 21 3. 39 4 43 1. 43 2. 52 3. 56 4. 66 5. 74 5 78 1. 78 2. 80 3. 86 6 88 90 Ex e cu t iv e Su m m a r y 92 < 3-1> 22 < 3-2>
More information248019_ALIS0052.hwp
Generation history for optimization eneration history of optimization 불평형질량 편심량 회전수 축외경 축내경 축길이 베어링간격위치 베어링강성 교배 대상이되는개체의수 집단의크기 돌연변이 대상이되는유전자수 집단내전체유전자수 와 와 Generation history
More informationJournal of Educational Innovation Research 2018, Vol. 28, No. 4, pp DOI: * A Research Trend
Journal of Educational Innovation Research 2018, Vol. 28, No. 4, pp.295-318 DOI: http://dx.doi.org/10.21024/pnuedi.28.4.201812.295 * A Research Trend on the Studies related to Parents of Adults with Disabilities
More information<BFA9BAD02DB0A1BBF3B1A4B0ED28C0CCBCF6B9FC2920B3BBC1F62E706466>
001 002 003 004 005 006 008 009 010 011 2010 013 I II III 014 IV V 2010 015 016 017 018 I. 019 020 021 022 023 024 025 026 027 028 029 030 031 032 033 034 035 036 037 038 039 040 III. 041 042 III. 043
More information00약제부봄호c03逞풚
경희대학교 동서신의학병원 약품 정보지 2 0 0 7. S P R I N G. V O L. 0 1 신약 소개 02 Journal Review 03 Special Subject 04 복약 지도 06 의약품 안전성 정보 07 약제부 알림 07 약제부 업무 소개 08 E A S T - W E S T N E O M E D I C A L C E N T E R 본 약품
More information<BCF6BDC3323030392D31385FB0EDBCD3B5B5B7CEC8DEB0D4C5B8BFEEB5B5C0D4B1B8BBF3BFACB1B85FB1C7BFB5C0CE2E687770>
... 수시연구 2009-18.. 고속도로 휴게타운 도입구상 연구 A Study on the Concept of Service Town at the Expressway Service Area... 권영인 임재경 이창운... 서 문 우리나라는 경제성장과 함께 도시화가 지속적으로 진행되어 지방 지역의 인구감소와 경기의 침체가 계속되고 있습니다. 정부의 다각 적인
More informationIKC43_06.hwp
2), * 2004 BK21. ** 156,..,. 1) (1909) 57, (1915) 106, ( ) (1931) 213. 1983 2), 1996. 3). 4) 1),. (,,, 1983, 7 12 ). 2),. 3),, 33,, 1999, 185 224. 4), (,, 187 188 ). 157 5) ( ) 59 2 3., 1990. 6) 7),.,.
More information강의지침서 작성 양식
정보화사회와 법 강의지침서 1. 교과목 정보 교과목명 학점 이론 시간 실습 학점(등급제, P/NP) 비고 (예:팀티칭) 국문 정보화사회와 법 영문 Information Society and Law 3 3 등급제 구분 대학 및 기관 학부(과) 전공 성명 작성 책임교수 법학전문대학원 법학과 최우용 2. 교과목 개요 구분 교과목 개요 국문 - 정보의 디지털화와 PC,
More information<4D F736F F F696E74202D20B1E8BCB120B1B3BCF6B4D420B0ADBFACC0DAB7E1>
Outline 2012. 1. 30 CS4HS 생물정보학 생물정보학및암정보의학 맟춤의학과생물정보학 김선 서울대학교컴퓨터공학부생물정보연구소생물정보학협동과정 유전체학, 후생유전체학을이용한암연구와맟춤의학 1 2 Central Dogma in Biology PART1. 생물정보학 http://en.wikipedia.org/wiki/central_dogma_of_molecular_biology
More information09구자용(489~500)
The Study on the Grid Size Regarding Spatial Interpolation for Local Climate Maps* Cha Yong Ku** Young Ho Shin*** Jae-Won Lee**** Hee-Soo Kim*****.,...,,,, Abstract : Recent global warming and abnormal
More informationSMARTer Sequencing Kits for Next Generation Sequencing
Simple, Fast, Powerful SMARTer Solution for NGS 다카라코리아바이오메디칼 1 페이지 표지분석 NGS Library 제작시의어려움을, SMARTer 기술로극복! FFPE Sample 과같은 Low input, degraded RNA 로부터 Sequencing 을가능하게! Single Cell sample 로부터 Library
More information` Companies need to play various roles as the network of supply chain gradually expands. Companies are required to form a supply chain with outsourcing or partnerships since a company can not
More information<C3D6C1BEBFCFB7E12D30372E3032C0DBBEF72DB1B9BEC7BFF820B3EDB9AEC1FD20C1A63139C1FD28C0FCC3BC292E687770>
한국음악의 세계화 전략 한국음악의 세계화 전략 - 일본의 경우 - 야마모토 하나코( 山 本 華 子 ) 1) 국문초록 일본에서는 1965년 한일국교 정상화 이후, 여러 가지 형태로 한국음악이 소개되 어 왔다. 더욱이 국교정상화 40주년을 맞이한 2005년은 한 일 우정의 해 2005 로 지정되어 전통음악 세계에서는 민간차원의 공연이 증가하면서 한일 교류연주회
More information서론
- i - - ii - - iii - - iv - - v - - vi - - 1 - - 2 - - 3 - - 4 - - 5 - - 6 - - 7 - - 8 - - 9 - - 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - - 20 - - 21 - - 22 - - 23 - - 24 - -
More information인문사회과학기술융합학회
Vol.5, No.5, October (2015), pp.471-479 http://dx.doi.org/10.14257/ajmahs.2015.10.50 스마트온실을 위한 가상 외부기상측정시스템 개발 한새론 1), 이재수 2), 홍영기 3), 김국환 4), 김성기 5), 김상철 6) Development of Virtual Ambient Weather Measurement
More information1. 2. 2 1. 2 2. 2 3. 3. 3 3 1. 3 2. 3 3. 4. 4 1. : 4 2. : (KSVD) 4 3. : 88 5. 36
, 1965 1994: 3 1965 (Konstfackskolan). 1996. (, 2004) :, (, 2010), 20 (, 2005), :,, (, 2005), 02: (, 2008), (KDF, 2009), (, 2011), (, 2011). ( _, 2011 3 ), : ( 前 史 ) (, 102, 2012). 35 1. 2. 2 1. 2 2. 2
More information........pdf 16..
Abstract Prospects of and Tasks Involving the Policy of Revitalization of Traditional Korean Performing Arts Yong-Shik, Lee National Center for Korean Traditional Performing Arts In the 21st century, the
More informationProduct A4
2 APTIV Film Versatility and Performance APTIV Film Versatility and Performance 3 4 APTIV Film Versatility and Performance APTIV Film Versatility and Performance 5 PI Increasing Performance PES PPSU PSU
More information歯49손욱.PDF
2002 14 C Inventory An Estimation of 14 C Inventory on Each Unit of Wolsong NPP,,, 103-16 14 C 14 C Inventory 14 C Inventory 14 C 14 C, [Inventory] = [ 14 C ] - [ 14 C ] 14 C 14 C 13 C, 14 N 17 O [ 13
More information06_ÀÌÀçÈÆ¿Ü0926
182 183 184 / 1) IT 2) 3) IT Video Cassette Recorder VCR Personal Video Recorder PVR VCR 4) 185 5) 6) 7) Cloud Computing 8) 186 VCR P P Torrent 9) avi wmv 10) VCR 187 VCR 11) 12) VCR 13) 14) 188 VTR %
More information<BABBB9AE2E687770>
253 단소산조 퉁소산조 피리산조 형성시기 재검토 49) 이진원* Ⅰ. 머리말 Ⅱ. 기존 연구성과 검토 Ⅲ. 단소산조 퉁소산조 피리산조 형성시기 검토 Ⅳ. 단소산조 퉁소산조 피리산조 형성시기 재검토의 의의 Ⅴ. 맺음말 Ⅰ. 머릿말 우리나라의 대표적인 종취관악기(縱吹管樂器)에는 무황악기(無簧樂器)인 퉁소 단소가 있 고, 유황악기(有簧樂器)로 피리와 쇄납 등이
More information