Microsoft Word - 05-구승엽.doc

Size: px

Start display at page:

Download "Microsoft Word - 05-구승엽.doc"

현진 사
6 years ago
Views:

1 대한생식의학회지 : 제 36 권제 4 호 2009 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 서울대학교의과대학산부인과학교실 1, 서울대학교의학연구원인구의학연구소 2 김용진 1,2 구승엽 1,2 * 김윤영 2 오선경 2 김석현 1,2 최영민 1,2 문신용 1,2 Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture Yong Jin Kim 1,2, Seung-Yup Ku 1,2 *, Yoon Young Kim 2, Sun Kyung Oh 2, Seok Hyun Kim 1,2, Young Min Choi 1,2, Shin Yong Moon 1,2 1 Department of Obstetrics and Gynecology, College of Medicine, 2 Institute of Reproductive Medicine and Population, Medical Research Center, Seoul National University Objective: MicroRNAs (mir) are known to repress target genes at post-transcriptional level and play important roles in development and maturation of cell. However, the expression profiles of mir during ovarian follicle maturation have not been fully elucidated. Here, we designed this study to investigate the expression profiles of mir in oocytes and granulose cells (G-cells) after in vitro culture according to gonadotropins and adding hcg. Methods: Ovaries from 12-day-old mice (C57BL6) were removed and preantral follicles were isolated and cultured in 20 μl-drop of culture media with supplementation of either rfsh, rlh, or rfsh + rlh. After their full maturation, follicles were incubated with rhcg and regf. RNA was isolated from oocytes and G-cells, and real-time PCR were performed with primers of mir known to be expressed in the mouse ovary (mmu-mir-16, -mir-27a, -mir-126, -mir-721). Results: FSH + LH group showed the highest ovulation and MII rates among gonadotropin groups. The profiles of mirs in oocytes and G-cells differed according to gonadotropin groups and adding hcg. The profiles of mirs showed divergent changes between oocytes and G-cells. Conclusion: mir expression profiles are altered by gonadotropins and supplementation of hcg during in vitro maturation of murine follicles. Target gene study must be necessary to validate these findings.[korean. J. Reprod. Med. 2009; 36(4): ] Key Words MicroRNAs, Gonadotropins, In vitro culture, Mouse 난자의성숙과정은생식의학분야에있어서매우중요한연구대상이다. 생식샘자극호르몬 (gonadotropin) 인난포자극호르몬 (follicle stimulating hormone, FSH) 과황체형성호르몬 (luteinizing hormone, LH) 의자극이난포및난자의발달에중요한역할을한 주관책임자 : 구승엽, 우 ) 서울특별시종로구연건동 28, 서울대학교의과대학산부인과학교실 Tel: (02) , Fax: (02) jyhsyk@snu.ac.kr * 본논문의요지는제 57 차대한생식의학회추계학술대회에서우수 포스터로선정되었음. 다는것과 1,2 사람융모성생식샘자극호르몬 (hcg) 을이용한실험을통해 LH 쇄도 (surge) 가난자성숙과배란에핵심작용을한다는것은 3,4 주지의사실이다. 그러나이러한호르몬변화에따른난포및난자성숙조절기전에대해서는아직많은부분이명확하지않다. 이러한연구를위해사용될수있는방법론으로난포의체외배양실험모델을들수있다. 최근들어난포체외배양은난자성숙및난포성장조절의용이성과다양한활용가능성때

2 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 문에훌륭한연구모델로일부활용되고있다. 5,6 미세리보핵산 (microrna, mir) 은 22 염기이하크기의매우작은내인성비암호 (noncoding) RNA로서전사 (transcription) 억제및전달자 (messenger) RNA 분쇄 (cleavage) 를통하여다른유전자발현을조절한다고알려져있으며, 7~10 유핵세포에있어서염기서열특징적인유전자조절을설명하는기전으로최근많은관심을모으고있다. 11 지금까지여러연구들을통해세포내신호전달과정, 12 세포자멸과정, 13 대사과정, 14 조직형성 과정 15 등주로세포의조절기능에많은역할을 하는것으로알려져있으나, 그기능이명확하게이해되기까지는아직많은연구가수행되어야할것으로예상되고있다. 소 (Bovine) 을이용한최근연구에서미성숙난자와성숙난자사이에 mir 발현의차이가있음이보고되어, 16 mir이난자의성숙과정조절기전에대한이해에있어서도중요한역할을할것으로기대되나, 난자및난구세포에서의호르몬에따른 mir 양상의변화에대해서는알려진바가없다. 본연구는생쥐난포의체외배양을통해 FSH, LH, FSH+LH 등의 gonadotropin과 hcg 첨가에의한난자및난구세포에서의 mir 발현양상을확인하기위하여시행되었다. 연구대상및방법 1. 연구대상생후 12일된생쥐 (C57BL6) 암컷 20마리의난소를적출한후, 28-gauge 주사기 (Becton Dickinson & Co., Franklin Lake, NJ) 를이용하여전동난포 (preantral follicle) 를분리하였다 (Figure 1). 분리한전동난포를현미경으로관찰하여난자가중앙에서관찰되고주위의난구세포가완전하게관찰되는난포만을수집하여각실험군별로 500개씩체외배양을시행하였다. 2. 연구방법 1) 체외배양배양접시 (Falcon 3002; mm) 에 20 μl의배양액점적 25개를만들어수집된전동난포를각배양액 group들로무작위배정후, 한점적당한난포씩넣은후 mineral oil로덮고 37, 5% CO 2 의조건으로 12일간배양하였다. 각배양액조성별실험군은 insulin 10 μg/ml와 5% FBS를첨가한 Opti-MEM medium (Invitrogen, Carlsbad, CA, USA) 의기본배양액군 (media-only, control group), 기본배양액에 recombinant FSH (Gonal-F, Merck Serono) 를첨가한군 (FSH group), 기본배양액에 recombinant LH (Luveris, Merck Serono) 를첨가한군 (LH group), 기본배양액에 recombinant FSH와 recombinant LH 를같이첨가한군 (FSH+LH group) 으로나누었다. 각실험군의배양액교체를위하여 2일마다각점적에서 10 μl의이전배양액을빼낸후 10 μl의새로운배양액을넣어주었다. 2) 배란유도및난자난구세포복합체, 성숙난포확인 12일배양후각난포의성장및퇴행 (degeneration) 여부를현미경으로판단하였다 (Figure 1). 성장된난포는난포내공간이충분히부풀어오르고형태가잘유지되는경우로판단하였고, 난포내공간이생성되지않거나커지지않고, 난자및난구세포의색이어두어지거나분절 (fragmentation) 이생성되고, 난구세포없이난자만난포에서분출되는경우는 degeneration으로판단하였다. 성장된난포는이전배양액 10 μl를제거하고 recombinant hcg (Ovidrel, Merck Serono) 와 human epidermal growth factor (EGF) 를첨가한기본배양액 10 μl를점적에첨가하여배란을유도하였다. 배란은 hcg 첨가 36시간후배양중이던난포에서분출되어나온난자난구세포복합체 (cumulus oocyte complex, COC) 의관찰여부로판단하였으며 (Figure 1), 각군간배란된난포및 COC의유의한형태적인차이는없었다. 각군의배란율및퇴행율, 배

제 36 권제 4 호, 2009 김용진 구승엽 김윤영 오선경 김석현외 2 인 Figure 1. Maturation of mouse follicle during in vitro culture (Culture day 1, 400, Bar=1.

Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med 2009.

분출된 COC에서 28-gauge 주사기를이용하여난자를분리하여, 일차극체 (first polar body) 와배아소포 (germinal vesicle) 존재여부로이차중기 (metaphase II, MII) 와일차중기 (metaphase I, MI), 미성숙난자 (GV)

3 제 36 권제 4 호, 2009 김용진 구승엽 김윤영 오선경 김석현외 2 인 Figure 1. Maturation of mouse follicle during in vitro culture (Culture day 1, 400, Bar=1.0 μm; Culture day 12 and after hcg, 40, Bar=10 μm; MII oocyte, 600, Bar=5.0 μm). Yong Jin Kim. Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med 란되지않은난포율은배란된난포수, 퇴행된난포수, 배란되지않은난포수를각각체외배양을시행한총난포수로나누어계산하였다. 분출된 COC에서 28-gauge 주사기를이용하여난자를분리하여, 일차극체 (first polar body) 와배아소포 (germinal vesicle) 존재여부로이차중기 (metaphase II, MII) 와일차중기 (metaphase I, MI), 미성숙난자 (GV) 로난자의성숙도를판단하였으며 (Figure 1), 각군간 MII 및 MI, GV 난자의유의한형태적인차이는없었다. 각군의 MII 및 MI, GV rate는각각 MII, MI, GV의수를배란된난포의수로나누 어계산하였다. 3) Total RNA 추출 Total RNA은 hcg 첨가전성장된난포와 hcg 첨가후 MII 난자를포함한 COC에서추출하였다. hcg 첨가전성장된난포에서의 total RNA 추출은체외배양 12일째에현미경으로확인한성장난포를 28-gauge 주사기를이용하여난자와난구세포로분리하고, TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) 를이용하여각각 total RNA를추출하였다. hcg 첨가후 MII 난자를포함한 COC에서의 total RNA 추출은 hcg 첨가 36시간후분출된 COC에

4 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 Table 1. List of primers used for real-time PCR Primer Mouse U6 mmu-mir-16 mmu-mir-27a mmu-mir-126 mmu-mir-721 qrt-pcr CTCGCTTCGGCAGCACA CCCTAGCAGCACGTAAATATTGGCGA GGTTCACAGTGGCTAAGTTCCGCAAA CCCCCCATTATTACTTTTGGTACGCG CGCAGTGCAATTAAAAGGG Yong Jin Kim. Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med 서 28-gauge 주사기를이용하여난자와난구세포로분리하여 MII 난자로확인된 COC의난자와난구세포도 TRIzol Reagent를이용하여각각의 total RNA를추출하였다. 4) Poly A tailing 및 cdna 합성추출된 total RNA는상용 kit (The NCode TM VILO TM mirna cdna Synthesis Kit, Invitrogen, Carlsbad, CA, USA) 를이용하여 mir에대한 Poly A tailing 및 cdna 합성을시행하였다. 간략히설명하면, 10 pg의 total RNA를 5X Reaction Mix (Invitrogen, Carlsbad, CA, USA; 4 μl), 10X SuperScript Enzyme Mix (Invitrogen, Carlsbad, CA, USA; 2 μl) 와혼합하여 37 에서 60분, 95 에서 5분처리하여합성하였다. 5) 실시간중합연쇄반응합성된 mir에대한 cdna는상용 kit (EXPRESS SYBR GreenER TM qpcr SuperMix Universal, Invitrogen, Carlsbad, CA, USA) 를이용하여실시간중합연쇄반응에따른정량적분석을시행하였다. 간략히설명하면, 합성된 mir에대한 cdna 2 μl 에 EXPRESS SYBR GreenER TM qpcr SuperMix Universal 10 μl, 10 μm mir-specific forward primer 0.4 μl, 10 μm Universal qpcr Primer 0.4 μl, DEPC-treated water의 20-μl 혼합액을만들어서 Rotor-gene instrument (Corbett Life Science, Sydney, New South Wales, Australia) 를이용하여 2분간 50, 2분간 95 처리후, 95 와 60 로각각 15초와 1분동안 40회반복하는과정으로중합연쇄반응을시행하였다. 실시간중합연쇄반응에사용할 mir은생쥐난소에서 발현된다고알려진 mmu-mir-16, -mir-27a, -mir- 126, -mir-721 등의시발체 (primer) 를합성하여사용하였다 ( Table 1). 각 mir의발현정도는 U6 발현에대한비 (ct ratio) 를구한후, 대조군에대한상대적인발현 ( / ct ratio) 을비교하였다. 3. 통계분석본연구는각기다른개체군을이용하여 3회실험하였으며, 각수치는 Pearson's chi-square와 Fisher's test, Mann-Whitney test 등을이용하여통계처리하였고, p>.05인경우에유의한것으로판단하였다. 결과 FSH+LH군에서의배란율은 34.8% (174/500) 로대조군 (5.4% [27/500], p<.001), FSH군 (27.2% [136/ 500], p=.006), LH군 (17.8% [89/500], p<.001) 에비해유의하게높았다 (Figure 2). Degeneration rate도 FSH+LH군에서 18.4% (92/500) 로대조군 (72.8% [364/500], p<.001), FSH군 (41.0% [205/500], p<.001), LH군 (41.4% [207/500], p<.001) 에비해유의하게낮았다. FSH+LH군에서의 MII 생성율은 39.7% (69/ 174) 로대조군 (7.4 [2/27], p<.001), FSH군 (29.4% [40/136], p=.039), LH군 (20.2% [18/89], p=.001) 에비해유의하게높았다 (Figure 3). 난포성장중대조군에대한각 gonadotropin군난자의상대적 mir 발현은 FSH군에서는 mmu

5 제 36 권제 4 호, 2009 김용진 구승엽 김윤영 오선경 김석현외 2 인 Figure 2. Comparisons among control (media-only), FSH, LH, and FSH+LH groups in rates of degenerated, fully-grown without ovulation, and ovulated follicle of in vitro culture after hcg supplementation. Yong Jin Kim. Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med Figure 3. Comparisons among control (media-only), FSH, LH, and FSH+LH groups in rates of MII, MI and GV in ovulated COC. Yong Jin Kim. Profiles of MicroRNAs in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med mir-27a, LH군에서는 mmu-mir-27a, FSH+LH군에서는 mmu-mir-27a가유의하게증가하였고, FSH군과 LH군에서 mmu-mir-721, FSH+LH군에서 mmumir-16, -mir-721이유의한감소하였다 (Figure 4). 같은시기의난구세포에서는대조군에비해 FSH 군에서는 mmu-mir-721, LH군과 FSH+LH군에서는 mmu-mir-16, -mir-721이유의하게증가하였고, 모든군에서 mmu-mir-27a, -mir-126이유의한감소를보였다. hcg 첨가후의난자에서의 mir 변화는대조군에비해 FSH군에서는 mmu-mir-16, -mir-27a, LH군에서는 mmu-mir-16가유의하게증가하였고, FSH+ LH군에서는유의한증가를보인 mir이없었다 (Figure 5). 또한, FSH군과 LH군에서각각 mmumir-721이유의하게감소하였고, FSH+LH군에서는 mmu-mir-126, -mir-721 등이유의하게감소하였다. 같은시기에, 대조군에대한각 gonadotropin군난구세포의상대적 mir 발현은 FSH군에서는 mmumir-16, -mir-27a, -mir-126, -mir-721, LH군에서는 mmu-mir-16, -mir-126, -mir-721, FSH+LH군에서는 mmu-mir-721이유의하게증가하였고, LH군에서는 mmu-mir-27a이유의하게감소하였으나, FSH군과 FSH+LH군에서는유의한감소를보인 mir이없었다. 고찰본연구는생쥐난포배양중 gonadotropin의종류에따라난자및난구세포에서의 mir 발현양상의차이를확인하는것을목적으로하였다. 본연구의결과는 gonadotropin에따라생쥐난포는배양중 mir 발현의양상에차이를보이며, 이러

생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 Figure 4.

after hcg supplementation corrected by control (media-only) group, bar=sd, * p<.

Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture.

6 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 Figure 4. Comparisons in profiles of mirs in oocytes and G-cells among FSH, LH, and FSH+LH groups after hcg supplementation corrected by control (media-only) group, bar=sd, * p<.05 in oocyte; p<.05 in G-cells Yong Jin Kim. Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med Figure 5. Comparisons in profiles of mirs in oocytes and G-cells among FSH, LH, and FSH+LH groups after hcg supplementation corrected by control (media-only) group, bar=sd, * p<.05 in oocyte; p<.05 in G-cells Yong Jin Kim. Profiles of micrornas in Mice Follicles According to Gonadotropins during in vitro Culture. Korean J Reprod Med

7 제 36 권제 4 호, 2009 김용진 구승엽 김윤영 오선경 김석현외 2 인 한차이는난자와난구세포간에도다르고, hcg에의한성숙유도에따라서도그양상이변화한다는것을보여주었다. 이러한 mir의변화와목표유전자발현의변화간의연관성에대한추후연구가필요하지만, 결론적으로난자의성숙과정이 mir의변화와연관되어있다는가설이가능할것으로사료된다. 본연구의 FSH+LH군의배란율및난자성숙률은이전연구의결과와유사하다. 17 본연구결과는 FSH+LH군에서가장높은배란율및 MII 생성율을보여, FSH군및 LH군에비해더적절한생쥐난포배양조건임을증명하였다. 이러한결과는생쥐난포배양의조건에대한많은이전연구들과상응하는것이다. 18~21 FSH와 LH는각각난포배양시중요한성장인자이나, 18,19 두 gonadotropin이동시에첨가될때가가장적정한배양조건이며, 20 난자의성숙률도향상되는것으로알려져있다. 21 그러나, 본연구결과를통해이미성숙과정을마친경우현미경관찰하의난포와 MII의형태는군간유의한차이가없음을알수있었다. 즉, 적정한배양조건에비해낮은효율의배양조건에서성장한난포와그난자의경우도형태학적인관찰로는구분할수없었다. 형태학적인관찰에의한난자의능력 (competence) 평가방법은가장보편적으로사용되기는하나한계가있다. 22 본실험에서도형태학적인차이가없는각군간난자및난구세포사이에 mir 발현양상에차이가있음을알수있었다. 그러나, 난자의능력평가에서의 mir 의의의에대해서는추가적인연구가필요하다. 본연구결과는유전자발현의내인적조절인자로알려진 23 mir의동적변화를매개로 gonadotropin 에따른난자및난구세포의유전자발현이조절될수있음을시사한다. 수정 (fertilization) 이후착상전배아의발달과정중에는전체 mir 발현양의증가와함께다양한 mir의변화가있다고보고되었으나, 24 난포성장기의난자및난구세포성숙과정에서의 mir 변화에대해서는아직많은연구가필요한실정이다. 특히 LH surge에의한난자및 난구세포의변화는성숙과정에있어서핵심단계이며이후난자의수정능과도밀접한관계를갖기때문에, 25 이시기의 mir 변화는종자세포 (germ cell) 의발달과정을이해하는데매우중요하다고할수있겠다. 본연구에서관찰되었듯이난자성숙과정중의 mir 발현양상은매우다양하다. 특히, gonadotropin에의한성장과정중의 mmu-mir-721 와 hcg 첨가후의 mmu-mir-27a 및 -mir-721 등이난자와난구세포간에대상적인 (reciprocal) 증감양상을나타낸다는것은흥미로운결과라고할수있다. 이러한현상은난포의성장과정에서난자와난구세포간의일부유전자의발현이 mir 발현을통해상호대응되는양상이있음을함의한다. 이러한각 mir 증감의방향과의미에대해서는실제목표유전자발현의변화를통한추후연구가필요할것이다. 이때에는대부분의 mir이조절대상으로예상되는목표유전자수가매우많기때문에, 발현을확인할목표유전자의선택이매우중요하다고할수있겠다. 본연구에서는생쥐난소에서발현되는것으로알려진 mir 중에서 4가지 (mmu-mir-16, -mir-27a, -mir-126, -mir-721) 의발현양상을살펴보았다. mmu-mir-16는세포주기의중요한조절인자로알려진 cyclin E1 및 cyclin D1의발현을감소시킨다고보고되었는데, 26,27 본연구결과에서는 gonadotropin에의한난포성장중난자에서는감소, 난구세포에서는증가하는추세이나, hcg 첨가후배란된난자에서는증가하는추세를보였다. 또한난자와난구세포사이에는대상적인변화방향을보였다. mmu-mir-27a는조혈세포들의발달및성장, 분화의주조절인자로알려진 Runx1 발현의전사후 (post-transcriptional) 단계하향조절 (down regulation) 한다고알려져있는데, 28 본연구에서는성장중과 hcg 첨가이후모두증가의양상을보였고, 성장중에더유의한증가양상을보였다. 미세혈관의내피세포에서도발현되는것으로알려진 mmu-mir-126은 29 혈관내피성장인자 (vascular endothelial growth factor) 의발현증가와관련있다

8 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 고보고되었는데, 30 난자에서는 hcg 첨가후감소하는양상으로본연구결과에서나타났다. 신경계및수정후배아의발달및분화에관련된것으로처음보고된 mmu-mir-721은 24,31 본연구결과수정전 gonadotropin 및 hcg의영향에의해서는감소된다는것을확인할수있었다. mir 생성에중요한역할을담당하는리보핵산분해효소인 Dicer에대한유전자결손실험을통해 mir 생성이차단되는경우난포생성에장애가있을수있다는이전연구는 32 본연구에서나타난 mir의역동적발현변화가난자성숙과정을조절한다는가능성을뒷받침한다고할수있을것이다. 본연구는몇가지제한점을가지고있다. 첫째로 mir의발현양상이 gonadotropin군과 hcg 첨가에따라변화한다는것은확인하였으나이러한각각의 mir 증감과난포성장과의관련성을명확히설명할수없었다. 이는추후각 mir의세포내첨가실험을통해확인해야할것으로사료된다. 둘째는, hcg 첨가전난자의분석에있어서형태학적으로충분히성장한난포에서만 mir을측정하였으나, 이러한난자들의이후성숙능에차이가있었을가능성을배제할수없다는것이다. 결론적으로생쥐난자의배양중 mir의발현양상은 gonadotropin의종류및, hcg에의한난자의성숙에따라변화하며, 난구세포에서의 mir의변화양상과도다르다. 이는 mir의발현양상이난자및난포의성장과정및성숙여부에따라변화되며세포성장에대한조절기능을수행할수있음을시사하는것이며, 추후목표유전자연구를통한증명이필요할것으로사료된다. 감사의글이논문은서울대학교병원 ( [ ]) 과보건복지가족부 (Korea Health 21 R&D project, 01-PJ10-PG6-01GN ) 의지원을받았음. 참고문헌 1. Vegetti W, Alagna F. FSH and folliculogenesis: from physiology to ovarian stimulation. Reprod Biomed Online 2006; 12: Zhang M, Ouyang H, Xia G. The signal pathway of gonadotrophins-induced mammalian oocyte meiotic resumption. Mol Hum Reprod 2009; 15: Kawashima I, Okazaki T, Noma N, Nishibori M, Yamashita Y, Shimada M. Sequential exposure of porcine cumulus cells to FSH and/or LH is critical for appropriate expression of steroidogenic and ovulation-related genes that impact oocyte maturation in vivo and in vitro. Reproduction 2008; 136: Humaidan P, Papanikolaou EG, Tarlatzis BC. GnRHa to trigger final oocyte maturation: a time to reconsider. Hum Reprod 2009; 24: Fan L, Ling J, Ma X, Cui YG, Liu JY. Involvement of HSP10 during the ovarian follicular development of polycystic ovary syndrome: Study in both human ovaries and cultured mouse follicles. Gynecol Endocrinol 2009; 25: Hasegawa A, Kumamoto K, Mochida N, Komori S, Koyama K. Gene expression profile during ovarian folliculogenesis. J Reprod Immunol 2009; 83: Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell 2009; 136: Ambros V. The functions of animal micrornas. Nature 2004; 431: Du T, Zamore PD. microprimer: the biogenesis and function of microrna. Development 2005; 132: Heo I, Kim VN. Regulating the regulators: posttranslational modifications of RNA silencing factors. Cell 2009; 139: Lai EC, Tam B, Rubin GM. Pervasive regulation of Drosophila Notch target genes by GY-box-, Brd-box-, and K-box-class micrornas. Genes Dev 2005; 19: Xu P, Vernooy SY, Guo M, Hay BA. The Drosophila microrna Mir-14 suppresses cell death and is required for normal fat metabolism. Curr Biol 2003; 13: Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, et al. A pancreatic islet-specific microrna regulates insulin secretion. Nature 2004; 432:

9 제 36 권제 4 호, 2009 김용진 구승엽 김윤영 오선경 김석현외 2 인 15. Sokol NS, Ambros V. Mesodermally expressed Drosophila microrna-1 is regulated by Twist and is required in muscles during larval growth. Genes Dev 2005;19: Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, et al. Identification and expression profiling of micrornas during bovine oocyte maturation using heterologous approach. Mol Reprod Dev 2009; 76: Liu HC, He Z, Rosenwaks Z. Correlation of somatic cell steroid secretion and quality of generated oocytes after in-vitro stimulation of mouse follicles. J Assist Reprod Genet 2006; 23: Cortvrindt R, Smitz J, Van Steirteghem AC. Assessment of the need for follicle stimulating hormone in early preantral mouse follicle culture in vitro. Hum Reprod 1997; 12: Cortvrindt R, Hu Y, Smitz J. Recombinant luteinizing hormone as a survival and differentiation factor increases oocyte maturation in recombinant follicle stimulating hormonesupplemented mouse preantral follicle culture. Hum Reprod 1998; 13: Eppig JJ. Maintenance of meiotic arrest and the induction of oocyte maturation in mouse oocyte-granulosa cell complexes developed in vitro from preantral follicles. Biol Reprod 1991; 45: Liu HC, He Z, Rosenwaks Z. In vitro culture and in vitro maturation of mouse preantral follicles with recombinant gonadotropins. Fertil Steril 2002; 77: Patrizio P, Fragouli E, Bianchi V, Borini A, Wells D. Molecular methods for selection of the ideal oocyte. Reprod Biomed Online 2007; 15: Lynn FC. Meta-regulation: microrna regulation of glucose and lipid metabolism. Trends Endocrinol Metab 2009; 20: Yang Y, Bai W, Zhang L, Yin G, Wang X, Wang J, et al. Determination of micrornas in mouse preimplantation embryos by microarray. Dev Dyn 2008; 237: Lonergan P, Gutierrez-Adan A, Rizos D, Pintado B, de la Fuente J, Boland MP. Relative messenger RNA abundance in bovine oocytes collected in vitro or in vivo before and 20 hr after the preovulatory luteinizing hormone surge. Mol Reprod Dev 2003; 66: Wang F, Fu XD, Zhou Y, Zhang Y. Down-regulation of the cyclin E1 oncogene expression by microrna-16-1 induces cell cycle arrest in human cancer cells. BMB Rep 2009; 42: Salerno E, Scaglione BJ, Coffman FD, Brown BD, Baccarini A, Fernandes H, et al. Correcting mir-15a/16 genetic defect in New Zealand Black mouse model of CLL enhances drug sensitivity. Mol Cancer Ther 2009; 8: Feng J, Iwama A, Satake M, Kohu K. MicroRNA-27 enhances differentiation of myeloblasts into granulocytes by posttranscriptionally downregulating Runx1. Br J Haematol 2009; 145: Larsson E, Fredlund Fuchs P, Heldin J, Barkefors I, Bondjers C, Genove G, et al. Discovery of microvascular mirnas using public gene expression data: mir-145 is expressed in pericytes and is a regulator of Fli1. Genome Med 2009; 1: Liu B, Peng XC, Zheng XL, Wang J, Qin YW. MiR-126 restoration down-regulate VEGF and inhibit the growth of lung cancer cell lines in vitro and in vivo. Lung Cancer 2009; 66: Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T. Identification of new central nervous system specific mouse micrornas. FEBS Lett 2006; 580: Lei L, Jin S, Gonzalez G, Behringer RR, Woodruff TK. The regulatory role of Dicer in folliculogenesis in mice. Mol Cell Endocrinol

10 생쥐난포의체외배양중생식샘자극호르몬에따른미세리보핵산발현양상 대한생식의학회지 = 국문초록 = 목적 : 미세리보핵산 (microrna, mir) 은전사후 (post-transcriptional) 단계에서목표유전자 (target gene) 의발현을억제하여세포의발달과성장에중요한역할을하는것으로알려져있다. 그러나난포의성장과정중의 mir 발현양상에대해서는잘알려져있지않다. 따라서존연구는생쥐난포의체외배양후생식샘자극호르몬 (gonadotropin) 과사람융모성생식샘자극호르몬 (hcg) 첨가에따른난자와난구세포에서의 mir 발현양상을살펴보고자수행되었다. 연구방법 : 생후 12일된생쥐 (C57BL6) 의난소적출후, 전동난포 (preantral follicle) 를분리하여무작위로 20 μl 점적의배양액만있는군 (control group), 재조합난포자극호르몬을첨가한군 (FSH group), 재조합황체형성호르몬을첨가한군 (LH group), FSH와 LH를같이첨가한군 (FSH+LH group) 으로나누어배양하였다. 난포가충분히성장하였을때, 다시 hcg를첨가한군 (hcg (+) group) 과첨가하지않은군 (hcg (-) group) 으로나누어 hcg (-) group에서난자와난구세포를각각분리하여 RNA를추출하였다. 36시간후, 배란된난자난구세포복합체 (cumulus oocyte complex, COC) 에서난자와난구세포를각각분리하여 RNA를추출하고, mmu--mir-16, -mir-27a, -mir-126, -mir-721 등의 mir 에대한 primer를이용하여실시간중합연쇄반응을시행하였다. 결과 : 배란율과 MII 난자생성율은다른군들에비해 FSH+LH군에서유의하게높았다. 각군내의난자와난구세포사이에서도 mir 발현양상의차이가관찰되었다. 또한, 난자와난구세포에서의 mir 발현양상은각군간차이가있었으며, hcg (+) 군과 hcg (-) 군간에도차이를나타냈다. 결론 : 생쥐난포의체외배양중난자및난구세포에서의 mir 발현양상은 gonadotropin의종류및난자의성숙도에따라다르다. 이러한결과는표적유전자의발현에대한추후연구를통한확인이필요할것으로사료된다. 중심단어 : 미세리보핵산, 생식샘자극호르몬, 체외배양, 생쥐

歯 PDF

歯 PDF * * The Effects of Oocyte Oocytes Intracytoplasmic ICSI) Kee TaekHoo Hai * SikChun Department of Obstetrics and Gynecology, School of Medicine, Kyungpook Taegu, *Department of Animal Science, Taegu Kyungbuk,