J Korean Soc Food Sci Nutr 한국식품영양과학회지 4(1), ~9(214) http://dx.doi.org/1.746/jkfn.214.4.1. 퇴행성골관절염에대한 의효과 나지영 1 송기쁨 1 김석호 1 권영배 2 김대기 이준경 4 조형권 4 권중기 1 1 전북대학교수의과대학실험동물의학교실, 2 전북대학교의학전문대학원약리학교실 전북대학교의학전문대학원면역학교실, 4 한풍제약 Effects of on Degenerative Osteoarthritis Ji-Young Na 1, Ki-Bbeum Song 1, Sukho Kim 1, Young-Bae Kwon 2, Dae-Gi Kim, Jun-Kyoung Lee 4, Hyoung-Kwon Jo 4, and Jungkee Kwon 1 1 Dept. of Laboratory Animal Medicine, College of Veterinary Medicine, 2 Dept. of Pharmacology, Institute for Medical Science, and Dept. of Immunology, Institute for Medical Science, Chonbuk National University, Jeonbuk 561-756, Korea 4 Central Research and Developement, Hanpoong Pharm & Foods, Jeonbuk 561-841, Korea ABSTRACT HanPoong Leading (HPL)-4 were prepared with different oriental medicines (balk of Kalopanax pictus balk, Chaenomelis Fructus, Angelica gigas root, Zingiber officinale, Raphanus sativus Linne and Saururus chinensis Baill.) to investigate the protective effects of on cartilage degradation in knee osteoarthritis (OA). Rat articular chondrocytes incubated with rhil-1α markedly increased matrix metalloproteinase (MMP)-2 and 9 activities, decreased cell viability and reduced chondrogenic gene expression. -(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, MMP-2 and 9 activities and real time RT-PCR indicated that counteracted these harmful effects in dose-dependent manner. In addition, for experimental OA in vivo, monosodium iodoacetate (,.5 mg/5 μl) was injected into knee joints of rats and administered to rats for 4 consecutive weeks after treatment. The experimental data showed that treatment with significantly prevented of MMP-2 and 9 activities in articular cartilage. Histopathological and micro-ct evaluations of the knee joints also revealed that effectively ameliorated -induced degenerative OA. In conclusion, has potential applicability for the prevention and treatment of degenerative OA. Key words:, osteoarthritis, monosodium iodoacetate, chondrocytes, matrix metalloproteinase 서 최근들어한의학에서도 EBM( 근거중심의학 : evidence based medicine) 에입각한연구및교육그리고의사의수행평가필요성이제기되고있다. 근거중심의학 (EBM) 은권위가아닌근거에입각하여치료하고, 그치료를 DB화하여체계적으로관리하면서의사의수행평가와대학교육에도반영하는것을말한다 (1-). 한의학의과학화및표준화 와 한의약의 EBM 도입 은교육및임상수행평가뿐만아니라연구개발방법론에서도새로운방향을제시하고있으며이러한노력과시도를통해천연물신약개발에새로운가능성을제시하고자한다. (HanPoong Leading- 4) 처방은이러한 EBM에입각하여철저한고문헌사료조사와기초실험문헌, 임상자료및임상활용현황등의자료들을수집하고조사, 분석하여선정된골관절염의개선및 Received 2 September 21; Accepted 1 November 21 Corresponding author. E-mail: jkwon@jbnu.ac.kr, Phone: 82-6-27-884 론 치료또는관절건강에도움을주는천연물유래기능성복합처방이다. 골관절염은퇴행성관절염 (degenerative arthritis) 으로도불리는흔한관절질환이지만통상적으로노화에따른퇴행현상으로보는시각이있기때문에치료나질병관리에서간과되어온면이있다 (4). 하지만골관절염은고령화사회와비만인구의증가로인해유병률이지속적으로증가하고있으며국민건강영양조사를기초로한보고에따르면 28년기준한국성인중 1.7% 가골관절염을앓고있으며연령에따라비율이증가하여 8대에서는 4.5% 에이르는것으로추정된다 (5). 주로연골하부와골소주및관절연골의병리적대사로발생하며경증의활막염증, 관절연골의국소적인퇴행성변화, 연골하골의비대, 주변골연골부의과잉골형성, 관절의변형등과함께통증이동반되는질환이다 (6,7). 골관절염의원인과병태생리는다양하며현재까지도정확하게알려져있지않지만성인특히중장년층에게흔하게나타나는대표적인노인성질환으로써연령과비만도가증가할수록증가되며, 발병과악화에있어특정관절의과도한
퇴행성골관절염에대한 의효과 1 사용과반복적인자세및외상등생활요인과도관련성이높다고알려져있다 (8,9). 골관절염의치료는비약물적치료, 약물치료, 수술적치료세가지가있으며약물치료로써흔히쓰이는아세트아미노펜및비스테로이성항염제 (NSAID; non-steroidal anti-inflammatory drug) 는소화기계및혈액응고기전의부작용으로장기복용시속쓰림, 위출혈등을유발할수있으며, 질병완화골관절염치료제 (disease modifying osteoarthritis drugs) 의경우질환의초기에사용되어관절의파괴를예방하는데일부유효성에대한논란이있으며골수억제, 간기능손상과더불어발암의가능성이있다 (1). 이처럼현재까지골관절염의적절한치료법은미흡한수준이며, 특히기존약물들에대한부작용으로인하여한약재및생약등의천연물신약치료제를개발하려는노력이최근활발하게진행되고있다 (11-1). 한의학적관점에서관절염은크게는비증 ( 痺證 ), 작게는관절풍 ( 關節風 ) 에해당하는질병으로볼수있다 (14). 비증 ( 痺證 ) 이나관절풍 ( 關節風 ) 은인체의정기가허한상태에서기육 ( 肌肉 ) 과경락 ( 經絡 ) 에풍한습 ( 風寒濕 ) 의사기 ( 邪氣 ) 가침습하여발생하는질환이며, 실증인경우와허증인경우에따라증상에차이를나타내지만동통, 종창, 발적, 발열및운동장애등의관절염과비슷한양상을나타낸다. 처방은한의학적으로는거풍습 ( 祛風濕 ) 효능으로허리및무릎등의관절통을치료하는해동피와뭉친근육을이완시키고붓기를가라앉히는모과, 보혈 ( 補血 ) 및온경지통 ( 溫經止痛 ) 의효능으로혈액순환을돕고통증을멎게하는당귀, 해독소종 ( 解毒消腫 ) 의효능으로염증을억제하는삼백초 ( 三白草 ) 등 (15) 6가지약재로구성되어진골관절염개선및치료또는관절건강에도움을주는천연물유래기능성복합처방이며, 본실험에서는골관절염동물모델을이용하여 의유효성및과학적근거를확립하기위하여다음과같이실시하였다. 재료및방법 제조본실험에사용한 처방의구성약물은옴니허브및원광허브 (Iksan, Korea) 에서구입하여정선한후사용하였다. 각각원료들의원료시험성적서를통해기원을확인하였으며잔류농약, 잔류이산화황, 중금속시험등의유해물질검사에서모두적격품임을확인한후 제조에사용하였다. 각각의 6가지생약을해동피, 모과, 당귀, 내복자, 삼백초, 생강각각의생약원료에 1배수의정제수를넣고 95~1 C, 시간환류추출 2회실시후추출액을 25 μm 필터로여과한후여과액을 6 C 이하에서감압농축 건조하여각각의건조엑기스를얻었고, 각각의해동피 : 모과 : 당귀 : 생강 : 내복자 : 삼백초를 Table 1과같은비율로혼합하여건조엑기스를제조하였다. Table 1. The composition of Herbal medicine name Kalopanax pictus bark Chaenomelis Fructus Angelica gigas root Saururus chinensis Raphanus sativus Zingiber officinale Ratio 슬관절에서연골세포의분리연골채취를위한실험동물은 ~4주령무게약 18~2 g 정도의 male Sprague-Dawley rat(damul science, Dae jeon, Korea) 을경추탈구하여 7% 알코올로피부를소독하여절개한후관절연골을 2~ mm 정도크기로채취하였고채취한연골조직은 phosphate buffer saline(pbs) 용액에서보관하여 clean bench로옮겼다. 2 mg/ml collagenase type Ⅱ(Sigma-Aldrich Co., St. Louis, MO, USA) 를첨가하여 shaker에 1,2 rpm으로 시간동안처리하였다. 이렇게해서얻어진세포부유액을 7 μm pore size cell strainer(bd Falcon, Flanklin Lakes, NJ, USA) 에여과한후 1,6 rpm으로 1분간원심분리하여원심분리된세포를 PBS로 회세척한후연골세포를분리하였다. 분리된연골세포는 1% FBS와 DMEM에 1% penicillinstreptomycin을첨가하여 75T flask에넣고 7 C, 5% CO 2 의조건하에서배양하였다. 이때 2~일에한번씩배지를갈아주고약 4~5일에계대하여사용하였다. 약물독성및세포생존율측정세포독성및세포생존율을측정하기위해 MTT assay 를실시하였다. 2 1 4 cells/well의세포를 96 well plate에넣어준뒤 24시간안정화시켜준다. 안정화된세포는농도별로 (1~2 µg/ml) 를 24시간동안단독처리한군과 (1~2 µg/ml) 를 1시간전처리한뒤 rhil-1 α(5 ng/ml) 를넣고 24시간동안배양한다. 24시간뒤에 2 µl MTT solution을처리하여최대 시간 7 C incubator 에서배양한후배지와 MTT 시약을제거하고 DMSO 시약 2 μl를가하여 microplate reader(biotek, Winooski, VT, USA) 를이용하여 56 nm에서흡광도를측정하였다. 연골흡수지표 (matrix metalloproteinase(mmp)-2, 9) 활성측정 MMP-2, 9의발현확인을위해실험동물에서분리한연골세포를 96 well plate에 5 1 4 cells/well의농도로 1% FBS를첨가한 DMEM 배양액에분주하여 12시간동안안정화시킨후 HPL-, 를농도별로처리하고 rhil-1 α(5 ng/ml) 를처리하여 24시간배양한후에상층액을이용해 MMP-2, 9를측정하였다 MMP-2, 9 측정을위해 MMP ELISA kit(mybiosource, San Diego, CA, USA) 를이용하 2 2 2
2 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 Table 2. Primer sequences for real-time reverse transcription polymerase chain reaction Gene name Sequences Collagen type Ⅱ SOX9 Aggrecan β-actin Forward: GAGTGGAAGAGCGGAGACTACTG Reverse: CTCCATGTTGCAGAAGACTTTCA Forward: AGAGCGTTGCTCGGAACTGT Reverse: TCCTGGACCGAAACTGGTAAA Forward: GATGTCCCCTGCAATTACCA Reverse: TCTGTGCAAGTGATTCGAGG Forward: ATCGTGGGCCGCCCTAGGCA Reverse: TGGCCTTAGGGTTCAGAGGGG 였고 general ELISA protocol을따라서실험한뒤 56 nm 에서흡광도를측정하였다. 연골형성지표 (collagen type II, SOX9, aggrecan) 활성측정실험동물에서분리한연골세포를 6 well plate에 5 1 6 cells/well의농도로 1% FBS를첨가한 DMEM 배양액에분주하여 24시간동안안정화시킨후 를농도별로 1시간전처리해준뒤 rhil-1α(5 ng/ml) 를연골세포에 24 시간동안처리한후세포를수집하여 Ribo EX(GeneAll, Daejeon, Korea) 로제조사의 manual에따라 total RNA를추출하고 cdna의합성을위해 iscript Select cdna synthesis kit(maxime RT PreMix; Intron, Seongnam, Korea) 를이용하였다. 각 primer의염기서열은 (Table 2) primer express software(applied Biosystems, Carlsbad, CA, USA) 를이용해디자인되었다. Real-time PCR 실험시사용한기계는 Step One Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) 이며 SYBR Green Supermix(BIO-RAD, Hazelwood, MO, USA) 로제품의 protocol에따라반응하였다. PCR은 48 well plate에서 ABI Step One Plus Sequence Detection System (Applied Biosystems) 을사용하였다. 동물실험에사용된 rat는 SD-rat 8주령 (25~28 g) 이고모두수컷을사용하였다. 좌측슬관절에연골연화성관절염을유도하였으며우측슬관절은비교군으로사용하였다. 모든대상실험쥐는사료와음수를사육기간에마음대로섭취하도록하였으며사육장내에서제한없이운동하도록하였다. 퇴행성골관절염모델은 monosodium iodoacetate().5 μg/5 μl를슬관절관절낭에직접투여하여유발시켰다. 약물투여및관절염유발실험동물은군당 5마리씩 4그룹으로구분하였고모든투여군에서는 를멸균증류수에용해시켜존데가부착된 1 ml 주사기를이용하여경구투여하였다. 실험동물실에 (A) (B) Fig. 1. A schematic diagram of degenerative osteoarthritis induced by intra-articular injection of monosodium iodoacetate (). 서적응된 rat은조레틸 (zoletil) 로전신마취후수술대에고정시키고 를왼쪽슬관절의슬개골인대를통해관절낭내주사 (intraarticular injection) 를실시하였다. 는 sterile saline에마리당.5 mg/5 μl의농도로 26 gauge 를이용하여주사하였다. 정상군은동일한위치에 sterile saline 5 μl씩주사하였다 (Fig. 1). 연골흡수지표 (MMP-2, 9) 활성측정연골염증성인자중 MMP-2, 9의발현확인을위해 rat 에서분리한연골을 phosphate buffer saline로세척한후분쇄기로잘게분쇄해준다. 분쇄된연골은 RIPA buffer를처리해준뒤에 15, rpm에서원심분리후상층액을이용해 MMP-2, 9를측정하였다. MMP-2, 9 측정을위해 MMP ELISA kit(mybiosource) 를이용하여 general ELISA protocol을따라서실험한뒤 56 nm에서흡광도를측정하였다. 슬관절 micro CT를이용한평가모든실험쥐들은 주입및 의경구투여 4주후에조레틸 (zoletil) 로마취시킨뒤양쪽슬관절에대해각각관절면을중심으로 micro-ct(skyscan, Aartselaar, Belgium) 촬영을시행하였다. 조직학적관찰및평가관절염유발 4주째치료종료후모든 rat을부검하여슬관절을군별로채취하였다. 채취한슬관절은 1% 포르말린으로 24시간고정하였고그후파라핀포매전 1% formic acid로 72시간동안탈회하였다. 탈회후파라핀블록을제작하였고 5 µm로박절하여슬라이드에부착시켰다. 슬관절절편은관절조직및주변조직의염증성침윤 (inflammation) 정도를평가하기위해슬라이드에부착시켜 hematoxylin&eosin(h&e) 염색을실시하였고연골의퇴행성정도를측정하기위하여 safranin-o fast green(sofg) 염색을실시하였다. 또한퇴행성골관절염부위의보호정도를평가하기위하여조직병리학적평가를 개의등급에의해
퇴행성골관절염에대한 의효과 표현하였다. 등급은 Medplan Pathology Laboratories (Seoul, Korea) 에의해실시하였다 (16). 통계학적분석모든실험결과는평균 ± 표준오차로표시하였다. 그리고각실험군간의차이를검정하기위하여 Student's t-test를실시하였다. 실험의분석시유의수준은 P<.5로설정하여검정하였다. 결과세포독성및생존율평가 Primary culture된연골세포에대한 의세포독성및생존율을평가하기위해 MTT assay를수행하였다. rhil-1α를단독처리한군에서는생존율이유의성있게증가하였고, (1 µg/ml) 를 1시간전처리후 rhil-1 α(5 ng/ml) 를 24시간처리한군에서는생존율이유의성있게감소하는것이보였다 (Fig. 2A, B). 본실험의결과 HPL- 4가 rhil-1α에의해감소되는세포생존율을증가시키는것으로사료된다. In vitro에서염증성인자인 MMP-2, 9의활성도평가 rhil-1α는연골염증성인자인 MMP-2, 9를유발시킨 다. rhil-1α를단독처리한군에서는 MMP-2, 9이증가하였고, (1 µg/ml) 를 1시간전처리후 rhil-1α(5 ng/ml) 를 24시간처리한군에서는 MMP-2, 9가감소하는것이보인다 (Fig. 2C, D). 본실험의결과 가 rhil- 1α에의해유발된염증성인자인 MMP-2, 9의활성도를감소시키는것으로사료된다. 에대한연골형성지표 (collagen typeⅡ, SOX9, aggrecan) 활성화평가 rhil-1α(5 ng/ml) 를단독처리한군에서는연골유전인자인 collagen type Ⅱ, SOX 9 및 aggrecan의활성도가감소하는반면에 (1~2 μg/ml) 를 1시간전처리하고, rhil-1α(5 ng/ml) 를 24시간처리한군에서는연골유전인자 collagen type Ⅱ, SOX 9 및 aggrecan의활성도가증가하는것으로보인다. 이두군을비교하였을때 rhil-1α 를단독처리한군보다 를처리해준군에서연골형성유전인자인 collagen type Ⅱ, SOX 9 그리고 aggrecan 이활성화되는것으로보아, 가연골세포보호효과가있는것으로사료된다 (Fig. ). In vivo에서염증성인자인 MMP-2, 9의활성도평가 는연골파괴를일으키는물질이며연골염증성인자인 MMP-2, 9를유발시킨다. 를단독투여한실험군에 (A) 12 (B) 12 Cell viability (% of control). (C) Absorbance (ng/ml). 1 8 6 4 2 18 16 14 12 1 8 6 4 2 1 1 1 2 μg/ml ug/ml MMP-2 (1) (1) (2) Cell viability (% of control). (D) Absorbance (ng/ml). 1 8 6 4 2 14 12 1 8 6 4 2 (1) (1) MMP-9 (1) (1) (1) Fig. 2. Effects of on cell viability and MMP-2, 9 activity in chondrocytes incubated with or without rhil-1α on concentration. (A) Chondrocytes were treated with 1~2 μg/ml for 24 h. The cell viability was assessed with a MTT assay. (B) Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. (C, D) Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. MMP-2, 9 activity was assessed with ELISA kit. P<.5, as compared with control; P<.5, as compared with positive control (rhil-1α alone treatment). (2) (2)
4 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 (A) 1.4 Collagen type II (B) 1.2 SOX9 Relative expression. 1.2 1.8.6.4.2 Relative expression. 1.8.6.4.2 (1) (1) (2) (1) (1) (2) (C) 1.2 Aggrecan Relative expression. 1.8.6.4.2 (1) (1) (2) Fig.. Effects of on chondrogenic gene expression in chondrocytes incubated with or without rhil-1α on concentration. Chondrocytes were treated with 1~2 μg/ml in with rhil-1α for 24 h. P<.5, as compared with control; P<.5, as compared with positive control (rhil-1α alone treatment). (A) 18 MMP-2 (B) 14 MMP-9 Absorbance (ng/ml). 16 14 12 1 8 6 4 2 Absorbance (ng/ml). 12 1 8 6 4 2 (1) () (.5 μg/5 μl) (1) (1) () (.5 μg/5 μl) (1) Fig. 4. Effects of on cartilage MMP-2, 9 activity on -treated knee joint. Rats were administrated with 1~1 mg/kg for 4 weeks prior to treatment. MMP-2, 9 activity was assessed with ELISA kit. Data are presented as mean±sem (n=5). P<.5, as compared with control; P<.5, as compared with positive control ( alone treatment). 서는 MMP-2, 9가증가하였고 (1,, 1 mg/ kg) 를 4주간투여후 rhil-1α(5 ng/ml) 를 24처리한군에서는 MMP-2, 9가감소하는것이보인다. 본실험의결과 가 에의해유발된염증성인자인 MMP-2, 9의활성도를감소시키는것으로사료된다 (Fig. 4). 조직학적평가본연구에서는 로유도된골관절염에 가미치는영향을확인하기위하여골관절염유발 4주째실험종료후각실험군의무릎관절 H&E 염색을실시하여조직학적으로관찰하였다 (Fig. 5). 그결과 주입후 투여 4주째인골관절염유발군의무릎관절에서는관절연골의파괴와골침식등의소견을관찰할수있었으며 투여군에서의연골은골침식등의연골의변성이정상군과유사한것을확인할수있었다. 또한 safranin-o fast green 염색을실시하여 proteoglycan의함유량을확인하였다. 연골의침습정도를관찰한결과정상군의관절연골은적색으로전층이염색되어 proteoglycan 함유량이풍부한상태로관찰되었으며 투여군에서는관절연골의파괴나미란이심하고정상군에비해서 proteoglycan의소실이많았다. 투여군에서는정상군과유사하게연골의손상이회복되었으며 proteoglycan의소실이줄어들었음을확인할수있었다 (Fig. 5). 마지막으로전체적인 pathologic finding scores를볼때.5 mg/5 μl 단독처리군과 처리군에서각각 15.8±.5과 1.4±.4의수치가나왔다 (Table ). 따라서본연구결과 는
퇴행성골관절염에대한 의효과 5 (1) (1) H&E Safranin-O Coronal -D Fig. 5. Effect of on -treated degenerative osteoarthritis. Histopathological (H&E and safranin-o stain) and micro-ct (coronal and D analyses) evaluation of -injected knee joint. -treated cartilages represent severely damaged cartilage showing marked cartilage loss, fibrillation and the depletion of proteoglycan (H&E and safranin-o stain). Micro-CT of -treated knee joint shows a severely damaged joint with rough edges around the tibia and femur, indicative of bone lysis, swelling and tendency of patellar displacement. However, these damages were reduced significantly by treatment with 1 mg/kg. Scale bar: 2 μm. 에의해유도된골관절염에서 proteoglycan의소실을줄임으로써퇴행성관절염을완화시키는데효과가있는것으로사료된다. 골소주평가 Micro-CT 횡단면영상에서경골골단의원통형 VOI에서얻은골소주지표값들에대해 단독투여군과 HPL- 4 투여군의슬관절을비교하였을때 BV, BV/TV, Tb.Th 수치는 단독투여군에서증가하는것이관찰되었고 Tb.N과 Tb.Sp 값은감소하는경향을보였으나, 투여후 투여군에서는 BV, BV/TV, Tb.Th 수치를정상군에가깝게감소시켰으며 Tb.N과 Tb.Sp 값은정상군에가깝게수치를증가시켰다 (Fig. 6). 결과적으로골소주를비교분석한결과 투여는 에의해유발된경골골단의여러지표의변화를억제해주는것으로사료된다. 고찰퇴행성관절염환자의 8% 이상이움직임의제한을겪고있으며, 25% 에서는일상생활수행에도영향을받고있다. 퇴행성관절염은관절연골세포와세포외기질간의형태적, 생화학적, 분자적그리고생역학적변화가분명하고임상적으로관절통, 압통, 움직임의제한, 뼈마찰음, 염증등을특징으로한다 (17). 에서많은부분을차지하는해동피의주성분으로는 saponin, phenolic 배당체등의성분이알려져있으며사포닌성분가운데 kalopanaxsaponin A가분리되었으며류마티스성관절염에억제효과가있다는연구가있다 (18). 해동피는소염작용, 진통작용, 항기생충작용등이알려져있으며민간에서는해동피를신경통의치료및당뇨병과성인병치료에널리사용되고있다 (18). 실제임상에서퇴행성관절염환자에게여러가지한약성분들이
6 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 Table. Summary of microscopic findings Structural changes in the joint Surface irregularities Fibrillation of cartilage surface Disorganization of chondrocytes Exposure of subchondral bone Degeneration/necrosis Safranin-O staining Reduction of staining in cartilage /5 /5 5/5 /5 4/5 2.8 2.2 1.8 /5 /5 5/5 (1 mg/kg) /5 /5 5/5 4/5 /5 1.8 Total pathology score (average±se) 15.8±.5 1.4±.4 : mild, : moderate, : severe. Significantly different (P<.1) from vehicle-treated. /5 1.6 /5 2.4 /5 /5 1.4 4/5 /5 1.2 2 치료에이용되고있으나해동피를포함하는기능성복합처방을가지고연골세포와동물실험에서의평가는미비하다. 연골의항상성유지에중요한연골세포의변화와사멸로인하여 collagen type Ⅱ, aggrecan, SOX 9 등세포외기질의생산이감소하고분해가촉진되면연골의기본구조가파괴되어관절은체중부하를견디지못한다 (19). 본실험에서연골조직세포에대한 rhil-1α 5 ng/ml의처리는유의적인 collagen type Ⅱ의발현을감소시킨것으로확인되었고 (Fig. A), 를처리한결과 2 μg/ml의농도에서거의정상세포의수준으로유의적인증가를나타낸것이확인되었다. 또한 를처리한후 rhil-1α를처리하여 SOX9 유전자의발현을측정한결과 2 μg/ml 범위에서유의적으로증가한것으로나타났으며 (Fig. B), 를처리한후 rhil-1α를처리하여 aggrecan의발현을측정한결과 2 μg/ml 범위에서유의적으로증가한것으로나타났다 (Fig. C). 염증성관절에서연골및골파괴에중요한역할을하는것이 matrix metalloproteinase(mmp) 같은단백분해효소이며그작용은 tissue inhibitor of metalloproteinases(timp) system에의해길항된다 (2). MMP는생체내에서 extracellular matrix protein으로작용하고골관절염에서는 proteoglycan의분해와관련이있으며 (21), MMP 활성조절이관절염치료에서중요하다 (22). 본실험에서 MMP-2, 9의유전자발현을측정한결과, 전반적으로 rhil-1α의처리는 MMP-2, 9의발현이정상세포군에비해증가한것으로확인되었다. 반면에 MMP-2, 9의두경우 를처리한결과, rhil-1α 단독처리군에비해 2 μg/ml의농도에서정상세포군의수준으로유의성있게감소시킨것으로확인되었다 (Fig. 2C, D). 이러한결과는 가 MMP-2, 9의유전자발현을억제함으로연골세포조직의파괴를억제시키는효과가있을것으로생각된다. In vitro 상의연구결과를토대로하여 in vivo 상에서사람과유사한퇴행성골관절염동물모델을제작하여조직학적평가를실시하였다. 골관절염유발물질로사용된
퇴행성골관절염에대한 의효과 7 (A) (1) (1) (B) 9 1 8 9 BV (mm 2 ). 7 6 5 4 2 BV/TV (%). 8 7 6 5 4 2 1 1 25.9.8 2.7 Tb.Th (μm). 15 1 Tb.N (1/mm)..6.5.4. 5.2.1 12 1 Tb.Sp (μm). 8 6 4 2 Fig. 6. Plots of morphometric parameters of subchondral trabecular bone determined by micro-ct. BV, bone volume; BV/TV, bone volume fraction; Tb.Th, trabecular thickness; Tb.N, trabecular number; Tb.Sp, travecular spasing. Data are presented as mean±sem (n=5). P<.5, as compared with control; P<.5, as compared with positive control ( alone treatment). 는관절연골세포의해당과정의 glyceraldehyde--phosphate dehydrogenase 활성을억제하여변성을일으켜골관절염을유발시키는물질로, 쥐를대상으로한골관절염유발실험에서관절연골의손상, 관절의기능장애, 통증등이인체의골관절염과매우유사하다고알려져있다 (2). 에의한골관절염은 proteoglycan의소실 (24) 과연골및연골하골의기질붕괴가일어나며 MMP, 아교질분해효소, gelatinase의활성이증가한다 (25). 또한파골세포와골아세포의활동이증가하면서관절연골의소실로인해연골하골에부하가증가하여변형및경화와골곡형성등이 보고되고있다 (19,26). 본연구에서도 in vitro 실험결과와유사한결과를보였다. 동물실험에서 MMP-2, 9의경우도 (.5 mg/5 μl) 단독처리군에비해 1 mg/kg의농도에서정상군의수준으로유의성있게감소가확인되었다 (Fig. 4A, B). Micro-CT 촬영분석결과 군이대조군에비해연골량파괴가현저하게감소하였으며 H&E 및 safranin-o 염색을통한병리 조직학적검사에서도 군이증가된 proteoglycan 양과감소된염증세포소견을보여활막의손상정도를감소시켰다 (Fig. 5). 또한골소주지표값들을
8 나지영 송기쁨 김석호 권영배 김대기 이준경 조형권 권중기 분석한결과에서는 BV, BV/TV, Tb.Th 수치는 단독투여군에서증가하는것이관찰되었고 Tb.N과 Tb.Sp 값은감소하는경향을보였으나, 투여후 투여군에서는 BV, BV/TV, Tb.Th 수치가정상군에가까운수치를보였으며 Tb.N과 Tb.Sp 값도정상군에가까운수치로회복되었다 (Fig. 6B). 이는 가뼈와연골의침윤을감소시켜골관절염의진행을억제하고있다는것을의미한다. 본연구의결과를바탕으로 는 로유도된퇴행성관절염에서연골의변성과퇴행을줄이고 proteoglycan의소실을줄이는등퇴행성골관절염예방과치료에뛰어난효과가있다고사료된다. 요 본연구에서는 가골관절염의예방및치료약물로서의가능성을탐색하여다음과같은결론을얻었다. HPL- 4는연골세포생존율과연골형성과관련된 collagen type Ⅱ, SOX 9 그리고 aggrecan의유전자발현을유의성있게증가시킬뿐만아니라염증성인자와관련있는 MMP-2, 9도유의성있게감소시켰다. 는 에의해유도된퇴행성골관절염에서관절연골의파괴와골침식등연골의변성을억제했으며 proteoglycan의소실을유의성있게감소시켰다. 이에본연구는 가부작용이적고약리효과가뛰어나골관절염예방및치료제개발에활용될수있을것으로본다. 약 감사의글 본연구는지식경제부, 한국산업기술진흥원, 호남광역경제권선도산업지원단의광역경제권선도산업육성사업으로수행된연구결과임. REFERENCES 1. Jang JH, Kawakita K, Hahn SK, Park HJ, Lee SD, Kim YS, Takahashi N, Shichidou T, Itoh K, Sumiya E, Furuya E, Yamashita H. 26. Report: report of the rd Japan- Korea workshop on acupuncture and EBM-protocol development for the acupuncture trial on the osteoarthritis of the knee. J Korean Acupuncture & Moxibustion Medicine Society 2: 29-254. 2. Lee KG, Huang DS, Yu YB, Ma JY, Ha HK, Shin HK. 26. A study on compositions, dosages and usages of Sagunjatang, Samultang, Palmultang, Sipjeondaebotang in literature. J Oriental Medical Classics 19: 219-225.. Lee RM, Nam SS, Lee SH, Kim YS. 29. Research trends in evidence based medicine on acupuncture -Randomized controlled trial-. J Korean Acupuncture & Moxibustion Medicine Society 26: 147-158. 4. Jang YO. 27. Pathogenesis of osteoarthritis. Diagnosis and Treatment 27: 95-99. 5. Jhun HJ, Ahn K, Lee SC. 21. Estimation of the prevalence of osteoarthritis in Korean adults based on the data from the fourth Korea national health and nutrition examination survey. Anesth Pain Med 5: 21-26. 6. Altman R, Asch E, Bloch D, Bole G, Borenstein D, Brandt K, Christy W, Cooke TD, Greenwald R, Hochberg M, Howell D, Kaplan D, Koopman W, Longley III S, Mankin H, McShane DJ, Medsger Jr T, Meenan R, Mikkelsen W, Moskowitz R, Murphy W, Rothschild B, Segal M, Sokoloff L, Wolfe F. 1986. Development of criteria for the classification and reporting of osteoarthritis: classification of osteoarthritis of the knee. Arthritis Rheum 29: 19-149. 7. The Korean Orthopaedic Association. 1994. Orthopedics. 4th ed. Newest Medicine Company, Seoul, Korea. p 1-91. 8. Janf SK. 27. The effect on intra-articular administration of hyaluronic acid and growth hormone on arthritis in osteoarthritis rat model. MS Thesis. Dongshin University, Naju, Korea. 9. Das SK, Faroqi A. 28. Osteoarthritis. Best Pract Res Clin Rheumatol 22: 657-675. 1. Yoon CH. 212. Current clinical practice: osteoarthritis update. Korean J Med 82: 17-174. 11. Wenz W, Breusch SJ, Graf J, Stratman U. 22. Ultrastructural findings after intraarticular application of hyaluronan in a canine model of arthropathy. J Orthop Res 18: 64-612. 12. Zahmatkash M, Vafaeenasab MR. 211. Comparing analgesic effects of a topical herbal mixed medicine with salicylate in patients with knee osteoarthritis. Pak J Biol Sci 14: 715-719. 1. Lechner M, Steirer I, Brinkhaus B, Chen Y, Kirst-Dungl C, Koschier A, Grantschacher M, Neumann K, Zauner- Dungl A. 211. Efficacy of individualized Chinese herbal medication in osteoarthritis of hip and knee: a double-blind, randomized-controlled clinical study. J Altern Complement Med 17: 59-547. 14. Jang JK. 1994. JoongKyung collection. Daesung press, Seoul, Korea. p 85. 15. Herbal medical professor coeditorship. 1999. Herbal medicine. YoungLim, Seoul, Korea. p 1-775. 16. Kobayashi K, Imaizumi R, Sumichika H, Tanaka H, Goda M, Fukunari A, Komatsu H. 2. Sodium iodoacetate-induced experimental osteoarthritis and associated pain model in rats. J Vet Med Sci 65: 1195-1199. 17. An HJ, Lee CK, Park JH, Kim KH, Lee WR, Park IY, Han SM, Lee KG, Park KK. 212. Effects of bee venom on papain-induced osteoarthritis in an animal model. Korean J Phamacogn 4: 167-172. 18. Kim TJ. 1996. Korean resources plants. Seoul National University Press, Seoul, Korea. p 169. 19. Guzman RE, Evans MG, Bove S, Morenko B, Kilgore K. 2. Mono-iodoacetate-induced histologic changes in subchondral bone and articular cartilage of rat femorotibial joints: an animal model of osteoarthritis. Toxicol Pathol 1: 619-624. 2. Bresnihan B. 1999. Pathogenesis of joint damage in rheumatoid arthritis. J Rheumatol 26: 717-719. 21. Nagasa H, Woessner JF. 1999. Matrix metalloproteinases. J Biol Chem 274: 21491-21494. 22. Halliwell B. 2. Oral inflammation and reactive species: a missed opportunity? Oral Dis 6: 16-17. 2. Cho HJ, Chang CB, Jung JW, Seong SC, Kim TK. 29. Prevalence of radiographic knee osteoarthritis in elderly Koreans. Knee Surgery & Related Research 21: 22-21. 24. Kim W, Choi J. 21. Effects of bee venom and Cervi cornu parvum pharmacoacupuncture in monosodium iodoacetate ()-induced osteoarthritis rat. The Korean Academy of
퇴행성골관절염에대한 의효과 9 Oriental Rehabilitation Medicine 2: 61-77. 25. Janusz MJ, Hookfin EB, Heitmeyer SA, Woessner JF, Freemont AJ, Hoyland JA, Brown KK, Hsieh LC, Almstead NG, De B, Natchus MG, Pikul S, Taiwo YO. 21. Moderation of iodoacetate-induced experimental osteoarthritis rats by matrix metalloproteinase inhibitors. Osteoarthritis Cartilage 9: 751-76. 26. van der Kraan PM, Vitters EL, van de Putte LB, van den Berg WB. 1989. Development of osteoarthritis lesions in mice by "metabolic" and "mechanical" alterations in the knee joints. Am J Pathol 15: 11-114.