RESEARCH ARTICLE https://doi.org/10.12972/kjhst.20180086 노푸름 여상민 김욱진 양선규 박인규 문병철 * 한국한의학연구원한약연구부 Authentication of Brassicae Semen and Brassicae Campestris Semen by DNA Barcode Analysis Pureum Noh, Sang Min Yeo, Wook Jin Kim, Sungyu Yang, In Kyu Park, and Byeong Cheol Moon * Herbal Medicine Research Division, Korea Institute of Oriental Medicine, Daejeon 34054, Korea *Corresponding author: bcmoon@kiom.re.kr Received: April 4, 2018 Revised: May 10, 2018 Accepted: May 16, 2018 OPEN ACCESS HORTICULTURAL SCIENCE and TECHNOLOGY 36(6):885-898, 2018 URL: http://www.kjhst.org pissn : 1226-8763 eissn : 2465-8588 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Copyrightc2018 Korean Society for Horticultural Science. Abstract Brassica juncea and Brassica napus are economically important crops used for oilseed and forage who s seed is also used for herbal medicines, namely Brassicae Semen and Brassicae Campestris Semen, respectively. Morphological discrimination of these two herbal medicines is difficult because the seeds of the Brassica species have similar shapes. Since the descriptions of the different Brassicae Semen in the Korean and Chinese pharmacopoeia can be confused, it is necessary to develop an accurate method for identification of the different species. Therefore, DNA barcodes of six Brassica species, B. juncea, B. napus, B. nigra, B. oleracea, B. rapa, and Sinapis alba, collected from various locations and markets, were analyzed to develop a molecular marker for distinguishing Brassicae Semen and Brassicae Campestris Semen. Nucleotide sequence comparison and phylogenetic analysis of internal transcribed spacer (ITS) regions based on the amphidiploid types and U's triangle provide useful genetic information for the identification of these two herbal medicines and Brassica species. However, the sequences of the chloroplast maturase K (matk) gene showed species-specific insertions and deletions or substitutions only for B. nigra, B. oleracea, and S. alba but not for B. juncea, B. napus, and B. rapa. The use of genome-specific marker nucleotides in ITS regions provide an objective and accurate method for authentication of Brassica species and valuable information for further molecular marker development. Additional key words: Brassica species, internal transcribed spacer (ITS), maturase K (matk), molecular marker, molecular phylogenetics 본연구는한국한의학연구원주요사업 기원검증체계구축을통한한약자원국내생산기반기술개발 과제 (K17403) 의지원에의해수행되었습니다. 본연구수행에필요한연구시료종자를분양해주신국립농업과학원농업유전자원센터 (National Agrobiodiversity Center) 와기원식물표본을제공해주신한국한의학연구원한약표준표본관 (Index Herbariorum code KIOM) 에감사드립니다. 서언배추과식물은 338속, 약 3,709여종으로전세계에분포하고있으며, 경제적가치가매우높은작물에속한다 (Warwick and Sauder, 2005; Al-Shehbaz et al., 2006; Warwick et al., 2006). 그중갓 (Brassica juncea (L.) Czern.) 은배추 (B. rapa L., AA genome, 2n=2x=20) 와흑갓 (B. nigra (L.) K.Koch, BB genome, 2n=2x=16) 의자연교잡및염색체배가로생성된복이배체 (amphidiploid) 작물로 AABB Horticultural Science and Technology 885
genome(2n=4x=36) 을가지고있으며, 유채 (B. napus L.) 는배추와양배추 (B. oleracea L., CC genome, 2n=2x=18) 의자연교잡및염색체배가로생성된복이배체작물로 AACC genome(2n=4x=38) 을가지고있다 (Nagaharu, 1935; Johnston et al., 2005). 갓과유채각각의종자는개자 ( 芥子 ), 운대자 ( 蕓薹子 ) 라는한약재로사용된다. 우리나라대한민국약전외한약 ( 생약 ) 규격집 (Korea Food & Drug Administration, 2012) 에서개자는십자화과 (Cruciferae = Brassicaceae) 의갓또는그변종의잘익은씨로규정하고있으며, 운대자는유채의잘익은씨로규정하고있다. 반면, 중국약전 (China Pharmacopoeia Committee, 2010) 에서는십자화과식물백개 ( 白芥, 백겨자 ; Sinapis alba L.) 또는갓의잘익은씨를말린것으로전자를흔히 백개자 ( 白芥子 ) 라고부르며, 후자를흔히 황개자 ( 黃芥子 ) 라고부른다 (Korea Institute of Oriental Medicine, 2017). 하지만이들의종자가형태적으로유사하여유통되고있는한약재개자와운대자의정확한구별이어렵다. 또한같은속의배추, 양배추, 중국에서정품한약재개자로이용하는백겨자, 그리고흑개자 ( 黑芥子 ) 라는명으로이용되는흑갓의종자도이와같은이유로형태구별이매우어렵다. 국내에서는일반농가에서다양한갓품종이식용목적으로재배되고있는데, 농지단위가작고, 좁은지역에다양한근연종배추과작물을재배하는한국의농업특성상, 화분을통한유전자이동이비교적빈번하고, 이에따라근연종과의교잡에의한교잡종의발생가능성이더높을것으로예상되고있다 (Lim et al., 2015). 실제로배추속종자는종간, 종내잡종에의해중간형질이많이관찰되어외부형태적형질에기초하여종을동정하는데어려움이많기때문에객관적이고정확한동정법이필요한현실이다. DNA barcode는 DNA의짧은표준범위로부터염기서열을얻어종간비교를통하여빠르고정확한종동정을가능하게해주는 DNA 상의특정유전자또는특정부위로서, Hebert et al. (2003) 에의해처음용어가고안된이후로생물학전범위에서활발하게사용되고있다 (Lee et al., 2015). 식물에서주로사용되는범용성 DNA barcode 부위는핵내 45S ribosomal RNA gene(rdna) 에존재하는 internal transcribed spacer(its) 부위와엽록체 genome에존재하는 matk, rbcl, psba-trnh 등이있는데, 국제생물바코드컨소시엄 (CBOL, Consortium for Barcode of Life) 에서는고등식물의 core DNA barcode로엽록체의 matk와 rbcl조합의이용을권고하였다 (CBOL Plant Working Group, 2009). 약용식물분야에서도오동정으로인한약재의오용을막기위해형태적으로종감별이어려운종들과그근연종들에대하여 DNA barcode 분석및 barcode 데이터베이스구축의중요성이대두되어, 최근이를통해약재로사용되는기원식물의종을동정하고계통분류학적근연관계를분석하는연구가활발하게진행되고있다 (Zhang et al., 2015; Kim et al., 2016; Moon et al., 2016). 배추과에속하는배추와양배추, 유채는산업적이용가치가높아다양한산업분야에서이용되고있으며, 이에따라 DNA barcode 및유전체연구가활발히진행중이다 (Cheng et al., 2014). 하지만갓에대한연구는최근에시작되어유전자와유전체에대한연구가상대적으로미비하여 (Yang et al., 2016a), 갓의계통유연관계및유전적다양성에대한분석은 ITS 영역, SSR(simple sequence repeat), RAPD(random amplified polymorphic DNA) 및 AFLP(amplified fragment length polymorphism) marker를이용한소수의연구만이진행되었다 (Srivastava et al., 2001; Kwon et al., 2007; Khan et al., 2008; Ramchiary et al., 2011; Chen et al., 2013; Yang et al., 2016b). 따라서본연구에서는개자와운대자로사용되는갓과유채와함께이들과혼 오용되거나혼 오용우려가있는배추과식물인흑갓, 양배추, 배추, 백겨자 6종을대상으로, 핵내 ITS 부위와엽록체의 matk 유전자의 DNA barcode 부위로서의적합성을확인하고종감별을위한 marker nucleotide를발굴함으로써, DNA 바코드를이용한정확한종감별법을제시하고자한다. 재료및방법 분석용연구재료 본연구에사용한갓 (B. juncea), 유채 (B. napus), 흑갓 (B. nigra), 백겨자 (Sinapis alba) 시료는국립농업과학원유전자원센 886 Horticultural Science and Technology
터 (National Agrobiodiversity Center) 에서분양받은종자를파종하여약 3개월동안생장상에서키운식물체와국내자생지에서수집하여 -70 C 초저온냉동고에보관되어있던시료를이용하였다 (Table 1). 분양받은시료와수집된시료는본초학, 생약학, 식물분류학등의전문가로구성된분류 동정자문회의의동정을거쳐그종을최종확증하였다. 국립농업과학원유전자원센터에서분양받은시료는분양당시의자원번호를표기하였으며, 종자를제외한시료의증거표본은건조식물표본으로제작하여한국한의학연구원한약표준표본관 (Index Herbariorum code KIOM) 에표본번호를부여하여보관하였다 (Table 1). 배추 (B. rapa) 와양배추 (B. oleracea) 시료는동부팜흥농, 경신종묘주식회사, 성우종묘, 아시아종묘, 제일종묘농산에서구입한종자를사용하였다 (Table 1). 분석에이용된재료의식물명과학명은 The Plant List(http://www.theplantlist.org/) 를기준으로정리하였다. DNA 추출 -70 C에보관중인기원식물생체시료와유통되고있는품종종자 100 mg을 Lysing Matrix A TM tube(mp Biomedicals, USA) 에담아 Precellys TM Grinder(Bertin Technologies, France) 를이용하여 5,500rpm으로 30초동안곱게마쇄한후, DNeasy Plant Mini Kit(QIAGEN, USA) 을이용하여제작자가제공한 protocol에따라추출정제하였다. 정제된 DNA의순도와질을확인하기위하여 1.5% agarose gel에서전기영동한후, EcoDye Nucleic Acid Staining Solution(BIOFACT, Korea) 로염색하여 UV light 상에서 DNA band를확인하였으며, UV spectrophotometer(nanodrop DN-1000, Nanodrop, USA) 를이 Table 1. Information of the 22 plant and seed samples used in this study No. Sample Name Scientific name Location of collection or manufacturer NAC z Voucher number 1 Brassica juncea-j1 Pyeongchang, Gangwon IT101269 KIOM201801020723 2 Brassica juncea-j2 Iho, Jeju IT109008 KIOM201801020720 Brassica juncea (L.) 3 Brassica juncea-j3 Unknown, Canada IT119632 KIOM201801020722 Czern.. 4 Brassica juncea-j4 Jeonmin, Yuseong, Daejeon - KIOM201701019396 5 Brassica juncea-j5 Gwanpyeong, Yuseong, Daejeon - KIOM201701019394 6 Brassica napus-na1 Unknown, Canada IT279193 KIOM201801020733 7 Brassica napus-na2 Brassica napus L. Gwanpyeong, Yuseong, Daejeon - KIOM201701019397 8 Brassica napus-na3 Gwanpyeong, Yuseong, Daejeon - KIOM201701019398 9 Brassica nigra-ni1 Unknown, India IT119376, KIOM201801020729 Brassica nigra (L.) 10 Brassica nigra-ni2 Unknown, Afghanistan IT119398 KIOM201801020732 K.Koch 11 Brassica nigra-ni3 Unknown, Netherlands IT134983 KIOM201801020731 12 Brassica oleracea-o1 Asia Seed Co., LTD., Korea - KIOM_SEED_95 13 Brassica oleracea-o2 Asia Seed Co., LTD., Korea - KIOM_SEED_94 Brassica oleracea L. 14 Brassica oleracea-o3 Jeil Seed Co., Korea - KIOM_SEED_93 15 Brassica oleracea-o4 Sungwoo Seeds, Korea - KIOM_SEED_92 16 Brassica rapa-r1 FarmHannong, Korea - KIOM_SEED_100 17 Brassica rapa-r2 Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_99 18 Brassica rapa-r3 Brassica rapa L. Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_98 19 Brassica rapa-r4 Kyoungshin Seeds Co., LTD., Korea - KIOM_SEED_97 20 Brassica rapa-r5 Sungwoo Seeds, Korea - KIOM_SEED_96 21 Sinapis alba-s1 Unknown, Sweden IT297305 KIOM201801020725 Sinapis alba L. 22 Sinapis alba-s2 Unknown, Germany IT297306 KIOM201801020726 z Accession number of National Agrobiodiversity Center. Horticultural Science and Technology 887
용하여흡광도를측정한뒤, 최종 20mg L -1 로희석하여분석에이용하였다. DNA barcode 부위의증폭 ITS 부위의증폭을위하여약 20ng의 genomic DNA와각 10pmole의정방향의 ITS1과역방향의 ITS4 primer를이용하였으며 (Table 2), 18S rrna와 26S rrna의염기서열을제외한 ITS1+5.8S rrna+its2 구간을각시료의 ITS 부위로정의하였다. 엽록체 genome에존재하는 matk 유전자의증폭을위하여 matk-af 와 matk-8r의 primer set을이용하였는데 (Järvinen et al., 2004), 증폭이원활하지못한문제가있어 NCBI GenBank 에등록된흑갓 (NCBI accession no. AB354272.1) 과갓 (NCBI accession no. AB354274.1) 의염기서열을비교하여 primer(brassica-matk-f2, Brassica-matK-R1) 를제작하여증폭에사용하였다 (Table 2). 반응조건은 ITS 부위와 matk 유전자에서모두 95 C에서 2분간 pre-denaturation 한후, 95 C에서 1분간 denaturation, 53 C에서 40초간 annealing, 72 C에서 2분간 extension을총 35회반복수행하고마지막으로 72 C에서 5분동안 final-extension하여해당부위를증폭하였다. 염기서열분석각시료당전체 40µL의증폭산물을 EcoDye Nucleic Acid Staining Solution(BIOFACT, Korea) 으로염색한 1.5% agarose gel 상에서 100 bp DNA ladder(solgent, Korea) 와함께전기영동하여증폭여부를확인한후, 정확하게증폭된증폭산물을 agarose gel로부터회수하여 Gel Extraction Kit(QIAGEN, USA) 를이용하여정제하였다. 정제된증폭산물을 pgem-t Easy Vector Systems(Promega, USA) 에삽입하고, 증폭산물이삽입된 vector를 JM109 competent cell(rbc, USA) 에형질전환한뒤, 100mg L -1 ampicillin, 40mg L -1 X-gal, 그리고 0.5mM IPTG가첨가된 LB agar 배지에도말하여약 18시간배양하였다. 갓과유채의경우, 각각 AABB, AACC genome 을가지므로두가지 type의염기서열이존재할수있기때문에, 두가지 type 의염기서열모두를얻기위하여각시료별로 5개이상의 white colony를취하여분석에사용하였다. 그리고 pgem-t Easy vector의 T7과 SP6 primer를이용한 colony PCR을통해예상된크기로증폭된것을확인한 clone을 sequencing 하였다. Sequencing 후, 두가지염기서열 type이관찰되지않은경우는 white colony 5개를추가적으로분석하였다. 염기서열의정확성과신뢰성을확립하기위한가이드라인에따라 (Nilsson et al., 2012), 4개의 clone으로부터얻은각각의염기서열정보를비교분석하고 PCR 증폭과정에서의오류를판별한후, NCBI GenBank BLAST 검색을통해키메라유무를판별하고종을확인하는과정을거쳐각시료의최종 ITS 및 matk 바코드염기서열을확정하였다. 계통유연관계분석및종판별용 marker nucleotide 탐색 22개체의시료로부터확보한 ITS와 matk 유전자최종염기서열, 그리고각부위별로 NCBI GenBank 에서참조가되는염기서열을추가하여분석에이용하였다 (Table 3). 이들염기서열을각 DNA barcode 종류별로 MEGA version 7(Kumar et al., Table 2. Primers used in this study Barcode region Primer Primer sequences (5' - 3') Reference ITS1 TCCGTAGGTGAACCTGCGG ITS White et al., 1990 ITS4 TCCTCCGCTTATTGATATGC matk-af CTATATCCACTTATCTTTCAGGAG Järvinen et al., 2004 matk-8r AAAGTTCTAGCACAAGAAAGTCGA matk Brassica-matK-F2 ACCTTATTTTGACTGTATCGCAC - Brassica-matK-R1 AACCCCATTATTCATGATTGAC 888 Horticultural Science and Technology
2016) 프로그램의 ClustalW 정렬법을이용하여정렬하고, 동프로그램에서 intra- 및 inter-specific distance 를계산하였다. ITS 와 matk의 GC 비율은 DnaSP version 5.10.01(Librado and Rozas, 2009) 프로그램을사용하여계산하였다. ITS 부위의경우, 갓과유채의 genome이각각 AABB, AACC로, 두가지 type의염기서열이모두검출되기때문에, 이러한경우에는 1차적으로 AA 염기서열과 BB 또는 CC 염기서열을하나의시료에서얻은두가지 type으로보고각염기서열을독립된데이터로분석하였고, 2차적으로는하나의시료에서얻은두가지 type의염기서열을 AA 염기서열의마지막염기뒤에 BB 염기서열또는 CC 염기서열의첫번째염기가위치하도록수평직선상으로배치하여유합된데이터로계통유연관계분석을수행하였다. 이경우에나머지이배체종 ( 배추, 양배추, 흑갓, 백겨자 ) 의 ITS 염기서열은해당종의염기서열의 copy를위와같은방법으로수평직선상으로배치하였다. 분석대상시료의계통유연관계분석을위하여 MEGA version 7 프로그램을이용하여각부위별로 model test를수행하였고, ITS 부위는 K2+G(Kimura-2-parameter + Gamma), matk 유전자는 T92(Tamura 3-parameter) 의 best fit model이도출되었다. 동프로그램상에서각부위염기서열의 best fit model을적용한 Maximum Likelihood 계통추론방법으로 1,000회 bootstrapping을통하여계통수를도출하였고, 이를기반으로분기군형성유무와분기군간의근연관계를비교 분석하였다. 도출된계통수는 PowerPoint 2013(Microsoft, USA) 에서편집하였다. ITS 부위와 matk 유전자의염기서열을유합한 combined data의적합성을판단하기위하여 PAUP version 4.0 (Swofford, 2002) 에서 Incongruence Length Difference(ILD) test(farris et al., 1994) 를수행하였다. 정렬된 matk와 ITS 염기서열의종내개체별비교와종별비교를통해종특이성을갖는염기 (marker nucleotide) 의삽입 (Insertions), 결실 (Deletions) 및치환 (Substitutions) 을정렬된위치별로분석하여정리하였으며, 이를토대로 marker nucleotide를탐색하였다. Table 3. GenBank accession numbers used in the marker nucleotide analyses and the phylogenetic analyses DNA Barcode region Species Genome (-type z ) GenBank accession number B. juncea AABB-A DQ003681, GQ202247 B. juncea AABB-B DQ003674, DQ340651 B. napus AACC-A JQ085860, DQ003667 B. napus AACC-C DQ003668, DQ003669 ITS B. nigra BB DQ003644, DQ340645, EF601911, GQ268057 B. oleracea CC AY833603, DQ003652, KM538957 B. rapa AA DQ340644, KF704394, KM538956, JN564039 S. alba - AF128106, FJ609733 Arabidopsis thaliana - X52320 B. juncea AABB AB354274, LC064390 B. napus AACC KJ872515, KM454973, LC064393, AB354273 B. nigra BB KT878383, NC030450 matk B. oleracea CC AB354271, LC064392 B. rapa AA AB354276, LC064391 S. alba - AB354277, LC064389 Arabidopsis thaliana - AP000423, NC000932 z Sequence type corresponding to the amphidiploid species. Horticultural Science and Technology 889
결과및고찰 ITS 및 matk 부위의특성각시료로부터추출한 gdna를주형으로하여 ITS1과 ITS4 primer 조합과 matk-af 와 matk-8r primer조합으로증폭한결과, 약 600 bp 크기의 ITS 증폭산물은확인되었으나약 1250 bp 크기의 matk 유전자의증폭은확인되지않았다. Hollingsworth et al. (2011) 과 Ghahramanzadeh et al. (2013) 에서 matk 유전자의변이율이높아 matk 유전자증폭시에 universal primer로는증폭이어려운경우가많음을보고하였는데, 본연구에서도 matk universal primer가 Brassica속에서는적합하지않았던것으로판단된다. 이러한이유로본연구에서제작한 Brassica-matK-F2 와 Brassica-matK-R1 primer 조합으로 matk 부위를증폭하였으며, 그결과약 1.5 kb의 matk 유전자절편을증폭할수있었다. 각시료로부터증폭된 ITS 염기서열을분석한결과, 갓과유채는두가지 type의염기서열이나타났으며, 갓은 608 bp와 622 bp로구성되었고, 유채는 608 bp의서로다른두가지 type의염기서열로구성되었다. 흑갓은 622 bp, 배추와양배추는 608 bp, 백겨자는 617 bp로구성되어있음을확인하였다. 갓과유채에서획득된서로다른 type의염기서열이 sequencing 오류인지확인하기위해 NCBI GenBank BLAST 검색을수행하였고, 각각갓과유채와일치하는염기서열이존재하는것을확인하였다. 증폭산물의 G+C 비율은전체적으로 51.81-54.82% 로나타났다. 본연구를통해새로제작한 primer 조합을이용하여증폭된 matk 유전자염기서열을분석한결과, 모든증폭산물은 1509 bp로구성되어있었고, G+C 비율은 31.17-31.62% 로확인되어 6종모두바코드부위의 DNA 구조와물리적특성은큰차이를보이지않았다 (Table 4). 종내변이율을분석한결과, ITS 부위에서가장높은종내변이율을보였으며, 갓, 유채, 흑갓, 양배추, 배추, 백겨자의 6종에대한종내평균변이율은각각 0.030, 0.026, 0.002, 0.000, 0.000, 0.002으로나타났다 (Table 4). 갓과유채에서높은종내변이율이나타난것은갓과유채가복이배체식물로두가지 type의염기서열이존재하기때문인것으로판단된다 (Table 4 and 5). matk의경우유채에서종내평균변이율이 0.001로나타났지만, 나머지 6종은종내변이가보이지않았다. matk에서유채의종내변이율이 0.001로나타난것은유채의 AA genome 상에서 822 bp에서 T A, 889 bp에서 C A, 1132 bp에서 A C로바뀌는 3개의염기치환이있는두가지 type의염기서열이존재하기때문인것으로판단된다 (Table 6). 종간변이율은 ITS에서백겨자가 0.068로가장높았으며, 그다음으로양배추 0.050, 흑갓 0.047, 배추 0.040, 유채 0.040, 그리고갓 0.039 순서였다. matk 유전자의종간변이율도백겨자가 0.025로가장높았으며, 그다음으로흑갓 0.024, 양배추 0.010, 배추 0.009, 갓 0.009, Table 4. Characteristics and variation of the ITS and matk region DNA Barcode region ITS matk Species Length (bp) G+C (%) Intra-specific distance Inter-specific distance GenBank accession number B. juncea 608, 622 51.81, 54.66-54.82 0.030 ± 0.005 0.039 ± 0.007 MG923961-MG923970 B. napus 608, 608 51.81-51.97, 52.96 0.026 ± 0.005 0.040 ± 0.007 MG923971-MG923974 B. nigra 622 54.50-54.82 0.002 ± 0.001 0.047 ± 0.008 MG923975-MG923980 B. oleracea 608 52.96 0.000 ± 0.000 0.050 ± 0.009 MG923981-MG923984 B. rapa 608 51.81 0.000 ± 0.000 0.040 ± 0.007 MG923985-MG923989 S. alba 617 52.67-53.00 0.002 ± 0.002 0.068 ± 0.011 MG923990-MG923992 B. juncea 1509 31.62 0.000 ± 0.000 0.009 ± 0.002 MG923993-MG923997 B. napus 1509 31.62 0.001 ± 0.001 0.009 ± 0.002 MG923998-MG924000 B. nigra 1509 31.62 0.000 ± 0.000 0.024 ± 0.004 MG924001-MG924003 B. oleracea 1509 31.62 0.000 ± 0.000 0.010 ± 0.002 MG924004-MG924007 B. rapa 1509 31.62 0.000 ± 0.000 0.009 ± 0.002 MG924008-MG924012 S. alba 1509 31.17 0.000 ± 0.000 0.025 ± 0.004 MG924013-MG924014 890 Horticultural Science and Technology
Table 5. Summary of marker nucleotides obtained from the comparison of ITS sequences. Sequence positions indicate the number of aligned ITS region nucleotide positions of all species. The marker nucleotides on each position are shaded Sequence position 6 21 25 32 33 41 52 60 65 66-72 73 81 83 88 100 104 105 106 108 109 110 111 Brassica juncea C G T G A T A T A - - - - - - - C G T - C C - A C C T T C G C G A T/C G C A GCCGATT C G C T T C C G C C C C Brassica napus C G T G A T A T A - - - - - - - C G T - C C - A C C T T A G C G T T G T A GCTGATT T A C - C C - G C A C C Brassica nigra C G C G A T/C G C A GCCGATT C G C T T C C G C C C C Brassica oleracea A G C G T T G T A GCTGATT T A C - C C - G C A C C Brassica rapa C G T G A T A T A - - - - - - - C G T - C C - A C C T T Sinapis alba T A C A A T G T T GCTGATT C G C - C A A G T C C C Sequence position 112 114 115 117 118 119-123 124-127 128 129 138 141 144 152 163 197 207 208 209 210 212 217 244 Brassica juncea G C C A G - - - - - ACTT C A T A G A A A A A C A C T T G T T A A GACTT ACTT A G C A G A T C A A C A T T T Brassica napus G C C A G - - - - - ACTT C A T A G A A A A A C A C T T G C C A - - - - - - - - - - - - T A A A A C A A C G C T T Brassica nigra G T T A A GACTT ACTT A G C A G A T C A A C A T T T Brassica oleracea G C C A - - - - - - - - - - - - T A A A A C A A C G C T T Brassica rapa G C C A G - - - - - ACTT C A T A G A A A A A C A C T T Sinapis alba A C C G T - - - - - ACTT C A/G T G T T A C G G T A C T/G G Sequence position 251 252 258 466 479 517 526 527 530 531 532 561 562 564 571 573 576 582 587 592 594 595 603 Brassica juncea C A G G A G A C C A - T A T C T A A C C A A T T A G G G G G C C A - C A G A T C T C C A A/G C Brassica napus C A G G A G A C C A - T A T C T A A C C A A T C A G C G T A T C A - C A T C A C T T C G A T Brassica nigra T A G G G G G C C A - C A G A T C T C C A A/G C Brassica oleracea C A G C G T A T C A - C A T C A C T T C G A T Brassica rapa C A G G A G A C C A - T A T C T A A C C A A T Sinapis alba C T G/C G G G A C T T T G T A C T T T C T A A T 그리고유채 0.009 순서였다. 획득된염기서열은 NCBI GenBank 에업로드하였으며각각의 accession number를 Table 4에표기하였다. 배추속식물의종간유연관계분석 ITS 부위의계통유연관계분석결과 (Fig. 1), 독립적인분기군을형성한백겨자와 Brassica속에속하는 5종으로크게분기되었다. Brassica속은 genome type에따라분기군을형성하였는데, 배추, 그리고갓과유채에서분리된 AA genome이하나의분기군을형성하였고 (Group 1), 흑갓과갓의 BB genome이하나의분기군을형성하였으며 (Group 3), 유채와양배추의 CC genome이또하나의분기군을형성하여 (Group 2) 총 3개의 group으로나뉘었다. 그중, AA와 CC genome이 BB genome보다는더가까운유연관계에있는것으로나타났다. 이는핵 DNA의 CHS(chalcone synthase) 유전자를이용하여분석한타연구결과와일치한다 (Chen et al., 2016). 그러나종별로분기군이형성되지않고각 genome type 별로분기군이형성되었기때문에 Brassica속의종동정에는적합하지않은것으로판단된다. Horticultural Science and Technology 891
Table 6. Summary of marker nucleotides obtained from the comparison of matk gene sequences. Sequence positions indicate the number of aligned matk region nucleotide positions of all species. The marker nucleotides on each position are shaded Sequence position 201 208 330 333 407 429 465 597 681 822 834 889 Brassica juncea T T T C G T A T A T T C Brassica napus T T T C G T A T A T/A T C/A Brassica rapa T T T C G T A T A T T C Brassica oleracea C T T C G T A T A T T A Brassica nigra T G G C A C C T A A T A Sinapis alba T T T G G T G C T A A A Sequence position 934 1030 1031 1041 1057 1078 1132 1136 1157 1183 1447 Brassica juncea C A A A C C A T C G C Brassica napus C A A A C C A/C T C G C Brassica rapa C A A A C C A T C G C Brassica oleracea C T T A C C A T C G C Brassica nigra C A A C C C A T C A T Sinapis alba A A A T T T A G A G C ITS 부위의두가지 type 및 copy를수평직선상에배치하여분석한결과 (Fig. 2), 총 6개의 group으로분기군이형성되었다. 각분기군 (Group 1-6) 은각각단일종만으로이루어져있었으며, 그중백겨자는기저에서분지되어독립적인분기군을형성하면서 Brassica속의종들과구분되는형태를보였다. 또한, Brassica 속에서는크게두개의 clade로나뉘었는데, 첫번째 clade는배추, 유채, 양배추로구성되었고, 두번째 clade는흑갓과갓으로구성되었다. AA genome과 CC genome이 BB genome보다가까운계통유연관계를보이는것은 ITS의두가지 type 부위를수평배치하지않고각각의 sequence로작성한계통수 (Fig. 1) 에서의결과와일치하였다. 그리고, 갓과유채는각각 AABB, AACC genome 을가지고있으며 AA genome을배추와공유함에도불구하고갓, 유채, 배추는분기군을형성하지않고서로 paraphyly 관계에있는양상을보였다. 반면에 BB genome을공유하는갓과흑갓이분기군을형성하고 CC genome을공유하는유채와양배추가분기군을형성하면서, BB genome간, CC genome간의관계가 AA genome간의관계보다는좀더강한유연관계에있는것으로보인다 (Fig. 2). matk 부위의계통유연관계분석결과 (Fig. 3), 백겨자를포함하여크게두개의 clade로나뉘었다. 첫번째 clade는배추, 유채, 갓, 양배추로구성되어있었는데, 그중배추, 유채, 갓은구분되지않고하나의분기군 (Group 1) 을형성하였으며양배추만이독립적인분기군 (Group 2) 을형성하였다. 그리고유채중일부는다른분기군 (Group 3) 을형성하는결과를보였다. 두번째 clade는흑갓과백겨자로구성되어있었다. 이러한결과는 Li et al. (2017) 이보고한 Brassica속식물의전체엽록체 genome 분석결과, Lü et al. (2008) 이보고한 Raphanus 및 Brassica 속식물의 trnk/matk 염기서열을이용한 Neighbor-joining tree 분석결과, 그리고 Arias and Pires(2012) 가보고한 chloroplast genome 상의 intergenic Regions(rpl32-trnL, atpi-atph, psbd-trnt, ycf6-psbm) 의분석결과와유사한양상을나타낸다. 따라서배추과식물의 chloroplast genome을이용하여유연관계를분석한여러논문에서보고된바와같이배추, 양배추, 갓, 유채가하나의 lineage를이루고, 흑갓, 백겨자가다른 lineage를이루어진화했기때문에 chloroplast genome 상에서갓, 유채, 배추 3종은같은분기군을형성하는것으로판단된다. 또한, 이결과로써엽록체유전자로는배추, 유채, 갓의뚜렷한구분이어렵다는것을확인하였다. 갓, 유채, 흑갓, 양배추, 배추와백겨자 6종의종간유연관계분석을위하여 ITS와 matk 염기서열을유합한 combined data의적합성을판단하고자 ILD test를수행하였다. 그결과, p-value 가 0.03으로 ITS와 matk 부위가 homogeneous한관계에있다는귀무가설을기각하므로 combined data로서적합하지못한것으로판단되었다. 따라서 ITS와 matk 부위는유합하여분석하지않았다. 892 Horticultural Science and Technology
Fig. 1. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the ITS sequences of the Brassica species. The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. Horticultural Science and Technology 893
Fig. 2. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the Brassica ITS sequences arranged horizontally (the ITS sequence of the second genome type was situated right behind the final base of that of the first genome type). The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. 종합적으로, ITS를단순분석한것과 matk 유전자로는분기군의양상에서 Brassica 속종들의정확한종별 grouping이어려웠으나, ITS 부위의두가지 type 및 copy를수평배치하여분석했던경우에서 Brassica 5종과백겨자의정확한종별 grouping 이가능하였다. 이로써 Brassica 5종과백겨자의정확한종동정과종별 grouping을위해서는 ITS 부위의두가지 type 및 copy 를수평배치하여분석하는것이가장바람직한방법임을확인하였다. 894 Horticultural Science and Technology
Fig. 3. Molecular phylogenetic tree inferred using the Maximum Likelihood method based on the chloroplast matk sequences of the Brassica species. The numbers above branches indicate bootstrap values. Branches in less than 50% bootstrap values are collapsed. Horticultural Science and Technology 895
종감별용 marker nucleotide 발굴우리나라와중국약전의개자기원식물의차이와흑갓의혼 오용방지를위한종감별용 marker로활용할수있는 nucleotide 발굴을위해, 본연구에서분석한개자및운대자를포함하는 6종 22개시료로부터증폭한 ITS, matk 염기서열과 NCBI GenBank 의기보고된갓, 유채, 흑갓, 양배추, 배추, 백겨자의 ITS, matk 염기서열을확보하여종내비교와종간비교를통해종특이적인염기서열을분석하였다. ITS 부위의염기서열분석결과 (Table 5), 백겨자종특이적인염기삽입이 532 위치에서확인되었으며, 염기치환이 26개존재하였다. 배추속식물인나머지 5종은종특이적인염기서열이존재하지않았으며, 총 3가지 type의염기서열이존재하였다. 배추 (AA genome), 흑갓 (BB genome), 양배추 (CC genome) 의염기서열을각각 A type, B type, C type으로확정한후갓 (AABB genome) 과유채 (AACC genome) 를분석한결과, 갓은 A와 B type, 유채는 A와 C type의염기서열이존재하였다. 각 type 별특이적인삽입 / 결실은 A type이 66-72위치, B type이 88, 119-123위치, C type이 124-127, 128, 129위치에있었으며, 염기치환은 A type이 12개, B type이 17개, C type이 13개존재하였다 (Table 6). 종특이적인염기치환은아니지만 Brassica속의복이배체종에서두가지 type의염기의조합으로종을동정할수있는 marker nucleotide를탐색한결과, 갓과유채에서각각 15개, 13개의 marker nucleotide가확인되었다. 또한, 이배체종들에서도흑갓 15개, 양배추 13개, 배추 11개의 marker nucleotide가확인되었다. 즉, ITS 부위염기서열의해당위치의염기조합정보를이용하면 Brassica속을종단위에서동정할수있다는결과를얻었다. 본연구결과와는다르게 Yang et al.(2016b) 이보고한갓품종구분을위한 ITS 분석결과에서는배추의 ITS 서열과유사한 10품종과흑갓의 ITS 서열과유사한 5품종을구분하였다. 이연구결과에서는복이배체식물의두가지 genome type 중한가지의염기서열만이나타나있는데, sequencing sample 의수가적어각 genome이가진모든 ITS 염기서열이확인되지않은것인지여부를추가적으로확인해볼필요가있다고생각된다. 이와관련하여배추속복이배체식물인갓, 유채, 그리고에티오피아겨자 (Brassica carinata) 의 DNA 염기서열분석시에는두가지 type의염기서열이모두관찰될수있기때문에 cloning 이필수적이며, cloning 후에 PCR 증폭산물이삽입된 white colony를취할때에도충분한수 (7개-10개이상 ) 를취하여분석에사용하는것이두가지 type의염기서열을모두얻기에바람직한방법으로사료된다. 종감별을위한 matk 유전자의염기서열분석결과 (Table 6), 종특이적인삽입 / 결실은없으며백겨자, 흑갓, 양배추에서염기치환이각각 11개, 8개, 3개존재하였다. 이염기치환부위를 marker nucleotide로하여백겨자, 흑갓, 양배추의종감별에사용할수는있으나, 배추와갓그리고일부유채의경우염기서열상에차이가없어, 기보고된중국패모 (Fritillaria thunbergii) 와달리 matk 유전자염기서열만으로는종감별이어려울것으로판단된다 (Moon et al., 2018). 이것은갓 (AABB genome) 과유채 (AACC genome) 의경우모계유전을하는 chloroplast genome의특성상같은모계, 즉 AA genome의유전자를획득하여진화된것으로판단되며기존에보고된다른연구결과와일치하였다 (Li et al., 2017). matk는엽록체에존재하는유전자로분자계통학적연구에서는상당히높은변이율을보이나 PCR 증폭률이낮은어려움이있어 rbcl과결합하여사용하길추천하고있다 (CBOL Plant Working Group, 2009). 기존의몇몇연구에서분류군에따라이들두조합만으로는종변별력이떨어지는문제점과 matk의 PCR 증폭의어려움을보고하며추가적으로다른 DNA barcode 부위의필요성을제기하였다 (Hollingsworth et al., 2011; Ghahramanzadeh et al., 2013). 본연구에서도 matk의단일바코드를이용한배추과의종감별은어려운것으로판단되어, NCBI Genbank의 rbcl 유전자의염기서열을확인하였으나 matk 유전자분석결과와같이갓, 배추, 유채를감별할수있는변이가나타나지않았다 ( 분석결과첨부안함 ). 따라서 Brassica속식물의종을감별하는데있어 matk +rbcl 조합의 DNA barcode는적절치않은것으로생각된다. 종의합성 은우장춘박사가배추와양배추의교배를통해기존에존재하는유채를인공적으로합성하여종은달라도속이같으면새로운식물을만들수있다는것을최초로증명한것으로흔히 우장춘의삼각형 (U s triangle) 이라불린다 (Nagaharu, 1935). 896 Horticultural Science and Technology
이 우장춘의삼각형 에따르면배추속에는이배체식물인배추 (AA genome), 흑갓 (BB genome), 양배추 (CC genome) 가있으며, 자연교잡에의해생성된복이배체식물인갓 (AABB genome), 유채 (AACC genome), 에티오피아겨자 (BBCC genome) 가있다. 복이배체식물인갓과유채의경우자연교잡에의해서로다른 genome에서얻어진 ITS 염기서열이존재하며 AA genome인배추, BB genome인흑갓, CC genome인양배추의 3가지염기서열 type을비교해본결과우장춘의삼각형을따르는결과를얻었다. 따라서 ITS 부위는배추속식물의우장춘의삼각형을설명할수있는 DNA barcode 로, 복이배체종의 ITS 부위에서얻어지는두가지 type의염기서열을함께분석한다면, chloroplast matk 유전자보다정확하게배추속식물의종동정이가능하기때문에, 약재로유통되는갓과유채의종자인개자와운대자를감별하는데효과적으로이용할수있을것으로판단된다. 초록배추속 (Brassica) 에속하는갓과유채는유지및사료작물등다방면으로이용되며그종자는개자와운대자라는한약재로사용되는경제적으로중요한작물이다. 배추속식물의종자는형태적으로유사하여개자와운대자의경우형태적종감별에어려움이있다. 또한우리나라대한약전과중국약전에서개자에대한규정에차이가있어이로인하여개자와백개자가혼용될우려가있기때문에정확한동정방법이필요한현실이다. 본연구는국내 외다양한지역에서수집되거나현재유통되고있는갓 (B. juncea), 유채 (B. napus), 흑갓 (B. nigra), 양배추 (B. oleracea), 배추 (B. rapa), 그리고백겨자 (Sinapis alba) 를분석하여개자및운대자의종을구별할수있는유전자마커를개발하기위해수행하였다. 우장춘의삼각형 에따라복이배체 type을확인할수있는 ITS 부위의염기서열비교와계통분석을통하여 ITS 부위가두약재의감별및배추속의종동정에유용한유전적정보를제공한다는것을확인하였다. 하지만 matk 유전자의경우에는흑갓, 양배추, 백겨자 3종을구분할수있는염기치환은존재하였으나, 갓, 유채, 배추에서는종특이적인염기삽입 / 결실및치환이나타나지않았다. 따라서 ITS 부위의각 genome 특이적인 marker nucleotide를이용하여개자및운대자의객관적이고정확한종동정이가능하며, 향후분자마커개발에유용한정보로활용할수있을것으로기대된다. 추가주요어 : 배추속, Internal transcribed spacer(its), Maturase K(matK), 분자마커, 분자계통분류 Literature Cited Al-Shehbaz IA, Beilstein MA, Kellogg EA (2006) Systematics and phylogeny of the Brassicaceae (Cruciferae): an overview. Plant Syst Evol 259:89-120. doi:10.1007/s00606-006-0415-z Arias T, Pires JC (2012) A fully resolved chloroplast phylogeny of the brassica crops and wild relatives (Brassicaceae: Brassiceae): Novel clades and potential taxonomic implications. Taxon 61:980-988 CBOL Plant Working Group (2009) A DNA barcode for land plants. Proc Natl Acad Sci 106:12794-12797. doi:10.1073/pnas.0905845106 Chen F, Liu H, Yao Q, Fang P (2016) Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene. Genet Mol Res: GMR 15. doi:10.4238/gmr.15028045 Chen S, Wan Z, Nelson MN, Chauhan JS, Redden R, Burton WA, Lin P, Salisbury PA, Fu T, et al (2013) Evidence from genome-wide simple sequence repeat markers for a polyphyletic origin and secondary centers of genetic diversity of Brassica juncea in China and India. J Hered 104:416-427. doi:10.1093/jhered/est015 Cheng F, Wu J, Wang X (2014) Genome triplication drove the diversification of Brassica plants. Hortic Res 1:14024. doi:10.1038/hortres.2014.24 Farris JS, Källersjö M, Kluge AG, Bult C (1994) Testing significance of incongruence. Cladistics 10:315-319. doi:10.1111/j.1096-0031.1994.tb00181.x Ghahramanzadeh R, Esselink G, Kodde L, Duistermaat H, Valkenburg J, Marashi S, Smulders M, Wiel C (2013) Efficient distinction of invasive aquatic plant species from non invasive related species using DNA barcoding. Mol Ecol Res 13:21-31. doi:10.1111/1755-0998.12020 Hebert PD, Ratnasingham S, de Waard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B Biol Sci 270:S96-S99. doi:10.1098/rsbl.2003.0025 Hollingsworth PM, Graham SW, Little DP (2011) Choosing and using a plant DNA barcode. PLoS One 6:e19254. doi:10.1371/journal.pone.0019254 Horticultural Science and Technology 897
Järvinen P, Palmé A, Morales LO, Lännenpää M, Keinänen M, Sopanen T, Lascoux M (2004) Phylogenetic relationships of Betula species (Betulaceae) based on nuclear ADH and chloroplast matk sequences. Am J Bot 91:1834-1845. doi:10.3732/ajb.91.11.1834 Johnston JS, Pepper AE, Hall AE, Chen ZJ, Hodnett G, Drabek J, Lopez R, Price HJ (2005) Evolution of genome size in Brassicaceae. Ann Bot 95:229-235. doi:10.1093/aob/mci016 Khan MA, Rabbani MA, Munir M, Ajmal SK, Malik MA (2008) Assessment of genetic variation within Indian mustard (Brassica juncea) germplasm using random amplified polymorphic DNA markers. J Integr Plant Biol 50:385-392. doi:10.1111/j.1744-7909.2007.00630.x Kim W, Ji Y, Choi G, Kang Y, Yang S, Moon B (2016) Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rdna-its, matk, and rbcl DNA barcode sequences. Genet Mol Res: GMR 15. doi:10.4238/gmr.15038472 Korea Food and Drug Administration (2012) The Korean Herbal Pharmacophoeia 4th edition. 1st supplement, 2013. Partial amendment, 2016, 2017. The Korea Food and Drug Administration, Seoul, Korea, pp 8-9 Korea Institute of Oriental Medicine (2018) Defining dictionary for medicinal herbs [Korean, Hanyak Giwon Sajeon ]. Published on the Internet; http://boncho.kiom.re.kr/codex/. Accessed 7 February 2018 Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870-1874. doi:10.1093/molbev/msw054 Kwon S, Lim K, Lim M, Park J, Kim J, Kim J, Lee S, Park B, Jin Y (2007) Molecular genetics of Brassicaceae based on AFLP display. Korean J Hortic Sci Technol 25:75-81 Lee J, Kim CS, Lee IY (2015) Molecular identification of Pooideae, Poaceae in Korea. Weed Turf Sci 4:18-25. doi:10.5660/wts.2015.4.1.18 Li P, Zhang S, Li F, Zhang S, Zhang H, Wang X, Sun R, Bonnema G, Borm TJ (2017) A phylogenetic analysis of chloroplast genomes elucidates the relationships of the six economically important Brassica species comprising the Triangle of U. Front Plant Sci 8:111. doi:10.3389/fpls.2017.00111 Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451-1452. doi:10.1093/bioinformatics/btp187 Lim Y, Yook MJ, Zhang CJ, Nah G, Park S, Kim DS (2015) Dormancy associated weedy risk of the F1 hybrid resulted from gene flow from oilseed rape to mustard. Weed Turf Sci 4:35-43. doi:10.5660/wts.2015.4.1.35 Lü N, Yamane K, Ohnishi O (2008) Genetic diversity of cultivated and wild radish and phylogenetic relationships among Raphanus and Brassica species revealed by the analysis of trnk/matk sequence. Breed Sci 58:15-22. doi:10.1270/jsbbs.58.15 Moon B, Kim W, Ji Y, Lee Y, Kang Y, Choi G (2016) Molecular identification of the traditional herbal medicines, Arisaematis Rhizoma and Pinelliae Tuber, and common adulterants via universal DNA barcode sequences. Genet Mol Res 15(1):gmr.15017064. doi:10.4238/ gmr.15017064 Moon B, Park I, Kim W, Yang S, Kang Y (2018) The complete chloroplast genome sequence of Fritillaria thunbergii Miq., an important medicinal plant, and identification of DNA markers to authenticate Fritillariae Bulbus. Hortic. Environ. Biotechnol 59:71-80. doi:10.1007/s13580-018-0008-0 Nagaharu U (1935) Genome analysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode of fertilization. Jpn J Bot 7:389-452 Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JA, Bergsten J, et al (2012) Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. MycoKeys 4:37. doi:10.3897/ mycokeys.4.3606 Ramchiary N, Nguyen VD, Li X, Hong CP, Dhandapani V, Choi SR, Yu G, Piao ZY, Lim YP (2011) Genic microsatellite markers in Brassica rapa: development, characterization, mapping, and their utility in other cultivated and wild Brassica relatives. DNA Res 18:305-320. doi:10.1093/dnares/dsr017 Srivastava A, Gupta V, Pental D, Pradhan A (2001) AFLP-based genetic diversity assessment amongst agronomically important natural and some newly synthesized lines of Brassica juncea. Theor Appl Genet 102:193-199. doi:10.1007/s001220051635 Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0. Sinauer Associates, Sunderland, Massachusetts, USA Warwick SI, Francis A, Al-Shehbaz IA (2006) Brassicaceae: species checklist and database on CD-Rom. Plant Syst Evol 259:249-258. doi:10.1007/s00606-006-0421-1 Warwick SI, Sauder CA (2005) Phylogeny of tribe Brassiceae (Brassicaceae) based on chloroplast restriction site polymorphisms and nuclear ribosomal internal transcribed spacer and chloroplast trn L intron sequences. Can J Bot 83:467-483. doi:10.1139/b05-021 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. Academic Press, Inc., NY, USA, pp 315-322. doi:10.1016/b978-0-12-372180-8.50042-1 Yang J, Liu D, Wang X, Ji C, Cheng F, Liu B, Hu Z, Chen S, Pental D, et al (2016a) The genome sequence of allopolyploid Brassica juncea and analysis of differential homoeolog gene expression influencing selection. Nat Genet 48:1225-1232. doi:10.1038/ng.3657 Yang K, Yi G, Arif Hasan Khan R, Jeong N, Lee Y, Park J, Kim H, Chung M, Nou I (2016b) Development of molecular markers for varietal identification of Brassica juncea on the basis of the polymorphic sequence of ITS regions and MITE families. Korean J Hortic Sci Technol 34:305-313 Zhang Z-L, Song M-F, Guan Y-H, Li H-T, Niu Y-F, Zhang L-X, Ma X-J (2015) DNA barcoding in medicinal plants: testing the potential of a proposed barcoding marker for identification of Uncaria species from China. Biochem Syst Ecol 60:8-14. doi:10.1016/j.bse.2015.02.017 898 Horticultural Science and Technology