The Krean Jurnal f Micrbilgy, Vl. 45, N. 2, June 2009, p. 126-132 Cpyright 2009, The Micrbilgical Sciety f Krea ü Leginella spp. w w ½ *Á xá½ Á Á Áw» p y w q ³ e s k ³,»z ùy wì ƒ š ³. 2008 6 l 8 ¾ ü 25 w ³ 73 w x x, Dt/cm f š Pulsed field gel electrphresis (PFGE) w x q w. 73 69 Leginella pneumphila x x s sg1 43, sg6 9, sg5 8, sg3 8, sg2 1 q, Leginella spp. 4 Leginella nautarum. Leginella pneumphila wš, Leginella nautarum ƒ v. PFGE pattern w, Leginella pneumphilaƒ w x x w y, s ¾. Key wrds ý dt/icm, Leginella, pathgenicity, PFGE (Leginellsis) s (s x) y sp ( s x) 2ƒ ƒ y» y ³ w w (7). p ù, y w e s w. ³ m y (w, y, ) ü (Ž)y w y w (8). w ³ ƒ mw œ ³ w. œ þƒ y þƒk w, k,,, w w. û wš p š ùyƒ ƒ y þ» w ƒ wš y ³ w ƒ v w, q w w. ³ w w ƒ w mip (macrphage infectivity ptentiatr)ƒ t, Leginella pneumphila ³ w w w t» w (1, 14). mip z» macrphage ü j w w w (5, 10). w ³ s ü s phagsme-lyssme fusin s ü w s ùkü, *T whm crrespndence shuld be addressed. Tel: 82-10-5133-3624, Fax: 82-2-570-3418 E-mail: kja0324@seul.g.kr phagsme-lyssme fusin w w ƒ icm (intracellula multiplicatin) (3, 12, 18). dt (defective fr rganelle traficking) s plasmid DNA ƒ w ò w s w. dt ƒ v s w (2, 18). icm/dt ³ s ü,, v, w macrphage apptsis wš(20) w ùkü (4, 9, 13). 2008 6 l 8 ¾ 25 x w k, x þƒk l ³ w. š x x, q Pulsed field gel electrphresis (PFGE) pattern wš ƒ q wš w. x wš ³ w w w. ³ 2008 6 l 8 ¾ 25 x, k, ù kü,, Õ, x þƒk 708 w ³ x w. 1L w w ³ 20 ml w w, 50 C 30 w 126
Vl. 45, N. 2 Leginella w š 127 z w. 0.1 ml 0.01 ml GVPC (glicine-vancmycin-plymyxin B-clisitin) ƒw BCYE-α (buffered charcal yeast extract-ketglutarate) k ƒƒ w z, 37 C 7 w. z w x cut-glass xk w BCYE-α, L-cystein v BCYE-α, x w w BCYE- w, z 2ƒ w ³ ³ w (16). Sertype Leginella pneumphila w sertype sertyping kit (Denka Seiken, Japan) w w. ³ w t 100 C 1 120 C 15 ƒ w z, x w wx -w 1 ü w x x x w (6, 16). Leginella spp.» w z NCB GenBank w sertype y w. PCR w mip, icm, dt ³ w 16S rrna mip (Table 1) w PCR (plymerase chain reactin) w Leginella pneumphila Leginella spp. w. 95 C 5 initial denaturatinw z, 95 C 1, 60 C 1, 72 C 1 cycle 30z w z 72 C 5 s g. ³ w icmtsrq, icmjb, icmwx, icmlk, dtdcb primer (17)(Table 1) w ƒƒ ƒ w y w. 95 C 5 initial denaturatinw z, 95 C 1, 55 C 1, 72 C 1 30 cycle 30z w z 72 C 5 s g. PCR 1.5% agarse gel w» w z y w. Pulsed field gel electrphresis (PFGE) BCYE w 72 w x³ cell suspensin TE buffer (100 ml Tris, 100 mm EDTA, ph 7.5) xkw k 13~15%ƒ w z, prteinase 10 µl ³ xk 200 µl yww. ³ xk yw 200 µl 1.2% agarse slutin ƒw plug mld 4 C, 5 x k. Prteinase K (20 mg/ml stck) 40 µl ES buffer 1.5 ml yw plug 55 C k w 2 w z, 55 C ³ 15 1z, 55 C Plug Wash TE buffer 30 5z w. óù plug 1mm Ì, Sfi ƒ yw 50 C w 2 g. óù z plug gel x cmb e k, 1% agarse gel xp z CHEF Mapper PFGE system (BiRad, USA) w gradient 6.0 V/cm, included angle 120, initial time 2.16 sec, final time 54.17 sec 14 C 18» w. EtBr (0.5 µg/ml) gel 30 w z, k e transilluminatr w y w. PFGE BiNumerics sftware versin 3.5 (Applied Maths, Belgium) w dendrgram w w. ³ x x Leginella pneumphila ³ x x s 1 x 43 (62.3%), 6x 9 (13.0%), 5x 8 (11.6%), 3x 8 (11.6%), 2x 1 (1.4%) y (Table 2). Seung (16) w Leginella spp.ƒ 4, Leginella pneumphila x x s w y wš ƒ š, 4x Table 1. Primer sequence used in this study Primer Sequence (5 3 ) Prduct size 16S rrna mip icmtsrq icmjb icmwx icmlk dtdcb F : AGGGTTGATAGGTTAAGAGC R : CAACAGCTAGTTGACATCG F : GGTGACTGCGGCTGTTATGG R : GGCCAATAGGTCCGCCAACG F : CACAGTTAAAACTTCAAGCTGAACC R : CTGCTCAGAGCTATTTTT F : TGCCATGTTCTTTTTTGTGCTATTAC R : GAGCGTAAACCAGATCAATCCAAGTAG F : TGGGTTGGTTCCTGAGGTATGA R : TGGGGCGCTGAAATTTTGATAT F : CGGAAGGCTGGGACCAATT R : CCACTCGATAATCCACGGCTTTC F : CGATTGGTCTGGTCCGATTGA R : TCTCGAATAATGGAAGCTAACAATGTC 386 bp 630 bp 2.1 kb 1.8 kb 1.0 kb 1.0 kb 1.6 kb
128 Jin-Ah Kim et al. Kr. J. Micrbil Table 2. Descending rder f sergrup f L. pneumphila Species Sergrup Number f islates (%) L. pneumphila 1 6 3 5 2 4 43(62.3%) 9(13.0%) 8(11.6%) 8(11.6%) 1(1.4%) 0 Ttal 69. 6x 2007 6x ƒ w w. 6x ƒ 1x w x x ùkù, ù w w x x dw. Leginella spp. ³ wš wx» w. 4 Leginella nautarum. PCR w ³ 73 16S rrnaƒ š 4 Leginella spp. w 68 mip ƒ Leginella pneumphila y. Leginella pneumphila 22-kb DNA lcus ewš 18 16 ƒ icm macrphage killing ù w (cnjugatin) w š(15), dt 20-kb j» regin ù w w ù, s ƒ ³ DNA (18). icm/dt ³ w s l s l k ¾ w öe w. Leginella pneumphila icmtsrq, icmjb, icmwx, icmlk, dtdcbƒ ³ 20 š, ƒ ³ 39, ƒ ³ 10 š w ³. 5ƒ w w,,, V, V, Nx w. x icmtsrq-icmjb-icmwx-icmlk-dtdcb, icmtsrq-icmjbicmwx-icmlk-nd, x icmtsrq-icmjb-nd-icmlk-dtdcb, Vx ND-icmJB-ND-icmLK-dtDCB, š»k Vx w ü ƒ š ³ š, w ƒ ƒ w ³ Nx t w (Fig. 1). x Leginella nautarum y w. w ƒ ³ ƒ 1 š, ù 3 w ƒ. Leginella spp.ƒ Leginella pneumphila wš Terry Alli (17), x Leginella spp. Leginella pneumphila w Fig. 1. A cumulative bar graph shwing cntributin f pathgenic gene patterns t each pulstype. A, B, D, E, F, G, and pulstype cnsist f their ne pathgenic pattern. The number in each bar means the number f islates. w. Seung (16) w, 2007 w Leginella spp.ƒ 2008 4. Leginella spp.ƒ wš, ü wš ³ xƒ wš. ³ ³ w v w w. PFGE ql Fig. 2 plug Sfi w w PFGE clustering w. 65%» w A~J¾ 10 x pulstype ù š, 82%» A A1~A2, B B1~B2, C C1~C4, D D1~D2, E E1~E2, F F1~F2, G G1~G5, H H1~H2, J J1~J3 subtype ƒƒ w. Leginella pneumphila ƒ x C pulstype 69 32 46.4%, G pulstype 17.4%, E pulstype 13.0%, F pulstype 5.8%, A, B, H pulstype 4.3%, D, pulstype ƒƒ 2.9%, 1.4% w. Lee (11) ƒ ³ x w ùküš. C pulstype w (Table 3 and Fig. 2), 32 29 ƒ sergrup 1 ùküš ù, sergrup 6 C1, sergrup 3 C2 C ³ 66.3%. C3 28 89.5% w ³ š, š xw, ³ ƒ r dw. C4 ³ 90% ³. D ³, F 4³ sergrup 1 ùkû D1, D2 69.6% ³, F1 ³ û ³ 82.6% ³ w. w F2 F ³ ³. H ³
Vl. 45, N. 2 Leginella w š 129 Fig. 2. Dendrgram shwing the clustering f PFGE patterns after Sfi digestin fr the Leginella spp. H1 ³ 88%, sergrup 6 ³, H2 sergrup 6 ù w ³ w. Seung (16) w, pulstype sergrup p ù œm ³ sergrup w x w y š. w xw sergrup 2 ƒ Leginella pneumphila w 40% w x x wš. w 4 Leginella nautarum w Leginella pneumphila w û (37.2%) š.
130 Jin-Ah Kim et al. Kr. J. Micrbil Table 3. Categries f PFGE pattern, sergrup, and pathgenic gene pattern f Leginella spp. islates PFGE pattern PFGE sub-pattern Sample name Sergrup Pathgenic gene pattern A A1 A2 Gangnam-9 Jung-3 Geumchen-3 B B1 B2 Gangnam-3 Gangbuk-3 Gangnam-8 C C1 C2 C3 C4 Sngpa-7 Yungdeungp-3 Yangchen-1 Yangchen-3 Yangchen-4 Yangchen-6 Jung-4 Gur-1 Geumchen-1 Map-1 Map-3 Map-4 Sengdng-1 Sengdng-2 Sengdng-3 Sengdng-4 Sngpa-1 Sngpa-5 Yungdeungp-1 Eunpyeng-1 Jngn-1 Jngn-2 Jngn-3 Sech-1 Sengbuk-1 Sengbuk-3 Gangse-1 Sedaemun-1 Gangnam-5 Gangdng-1 Gwangjin-1 Sngpa-2 D D1 D2 Gangnam-6 Geumchen-4 E E1 E2 Geumchen-2 Dbng-1 Dbng-2 Gwangjin-3 Gangnam-4 Map-2 Sngpa-3 Sngpa-4 Sngpa-6 V V V V V V V V V F F1 F2 Gangnam-1 Gangnam-12 Gangnam-13 Jung-1
Vl. 45, N. 2 Leginella w š 131 Table 3. Categries f PFGE pattern, Sergrup, and Pathgenic gene pattern f Leginella spp. islates (cntinued) G š ³ y w ³ w ³, k Leginella spp. w ƒ Leginella pneumphila w x x ƒ, œ w ³ dw (11, 16). Fig. 1 Table 3 A pulstype w ³ sergrup x pathgenic pattern ƒ š š, B x, D x, E 9 ƒ Vx, F x, G 12 ƒ x. ƒ ³ ƒ Cx 32 27 ƒ x pathgenic pattern š x Leginella nautarum Vx Nx q. PFGE pattern pathgenic gene pattern w š, PFGE pattern w d ƒ w w. cm/dt ³ w w t, ³ w w ò w v (3, 18, 19 etc). d w, cm/dt œ Œ, ³ ƒ w. x ~Vx, Nx pathgenic gene pattern w, >=>V>V>N ƒ w. ³ pathgenic gene pattern x ƒ 30 41.1% wš, x 20 27.4%, Vx 10 13.7%, x 8 11%, Nx 3 4.1%, Vx 1 1.4% ùkû. Leginella nautarum Leginella pneumphila 3 ƒ ³ ƒ 100%. w ƒ sergrup 2 pathgenic gene pattern V, Leginella pneumphila sergrup 2 w w ƒ dw. 3 Leginella nautarum G1 G2 G3 G4 G5 Yangchen-7 Yangchen-8 Gangnam-14 Jung-2 Yangchen-2 Gur-2 Gangnam-10 Gangnam-11 Gangbuk-1 Eunpyeng-2 Gangnam-2 Gangbuk-2 H1 Dngjak-1 H Jung-5 H2 Gwangjin-2 1 Yungdeungp-2 sg 2 V Vx ù Nx w. 73 w PFGE w w, x x p pattern ùkü pulstype w ù, x x pulstype pathgenic gene pattern ùkù, Leginella spp.ƒ w y dw. w pulstype pathgenic gene pattern w y w, PFGE mw Leginella spp. d w œw. ³ w ƒwš y ³ w x d œ w. y w ³ wì, w š, genetic pathgenicity intracellular pathgenicity ww ³ w w w yw, x q w œw. š x 1. Amemura-Maekawa, J., F. Kura, B. Chang, and H. Watanabe. 2005. Leginella pneumphila sergrup 1 islates frm cling twers in Japan frm a distinct genetic cluster. Micrbil. mmunl. 49, 1027-1033. 2. Berger, K.H., J.J. Merriam, and R.R. sberg. 1994. Altered intracellular targeting prperties assciated with mutatins in the Leginella pneumphila dta gene. Ml. Micrbil. 14, 809-822. 3. Brand, B.C., A.B. Sadsky, and H.A. Shuman. 1994. The Leginella pneumphila icm lcus: a set f genes required fr intracellular mutiplicatin in human macrphages. Ml. Micrbil. 14, 797-808. 4. Ciancitt, N.P. 2001. Pathgenicity f Leginella pneumphila. nt. J. Med. Micrbil. 291, 331-343. 5. Ciancitt, N.P., B.. Eisenstein, C.H. Mdy, and N.C. Engleberg. 1990. A mutatin in the mip gene results in an attenuatin f
132 Jin-Ah Kim et al. Kr. J. Micrbil Leginella pneumphila virulence. J. nfect Dis. 162, 121-126. 6. Denka Seiken C. 1998. Bacterilgy prduct infrmatin. Denka Seiken C. Ltd. 7. Field, B.S., R.F. Bensn, and R.E. Besser. 2002. Leginella and Leginnaires disease: 25 Years f investigatin. Clin. Micrbil. Rev. 15, 506-526. 8. Fliermans, C.B., W.B. Cherry, L.H. Orrisn, S.J. Smith, D.L. Tisn, and D.H. Ppe. 1981. Eclgical distributin f Leginella pneumphila. Appl. Envirn. Micrbil. 41, 9-16. 9. Gal-Mr, O., T. Zusman, and G. Segal. 2002. Analysis f DNA regulatry elements required fr expressin f the Leginella pneumphila icm and dt virulence genes. J. Bacteril. 184, 3823-3833. 10. Khler, R., J. Franghnel, B. Knig, E. Lneberg, and M. Frsch. 2003. Bichemical and functinal analyses f the Mip prtein: nfluence f the N-terminal half and f peptidylprlyl ismerase activity n the virulence f Leginella pneumphila. nfect. mmun. 71, 4389-4397. 11. Lee, H.K., H.S. Yang, S.R. Hng, M.S. Park, S.K. Sim, B.C. Lee, and M.Y. Park. 2001. Mlecular typing f Leginella pneumphila Krean islates frm 1985 t 2001. The Reprt f Natinal nstitute f Health 38, 18-30. 12. Marra, A., S.J. Blander, M.A. Hrwitz, and H.A. Shuman. 1992. dentificatin f a Leginella pneumphila lcus required fr intracellular multiplicatin in human macrphages. Prc. Natl. Acad. Sci. USA 89, 9607-9611. 13. Mlmeret, M., M. Santic, R. Asare, R.A. Carabe, and Y. Abu- Kwaik. 2007. Rapid escape f the dt/icm Mutants f Leginella pneumphila int the cytsl f mammalian and prtzan cells. nfect. mmun. 75, 3290-3304. 14. Nintasen, R., F. Utrarachkij, K. Siripanichgn, A. Bhumiratana, Y. Suzuki, and O. Suthienkul. 2007. Enhancement f Leginella pneumphila culture islatin frm micrenvirnments by macrphage infectivity ptentiatr (mip) gene-specific nested plymerase chain reactin. Micrbil. mmunl. 51, 777-785. 15. Segal, G., M. Purcell, and H.A. Shuman. 1998. Hst cell killing and bacterial cnjugatin required verlapping sets f genes within a 22-kb regin f the Leginella pneumphila genme. Prc. Natl. Acad. Sci. USA 95, 1669-1674. 16. Seung, H.J., J.H. Jung, S.J. Kim, Y.H. Jin, S.M. Lee, M.S. Kim, and J.G. Kim. 2007. Mlecular epidemilgical study f Leginella pneumphila islated frm water systems in Seul. The Reprt f Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment 43, 283-293. 17. Terry Alli, O.A., S. Zink, N.KU vn Lackum, and Y. Abu-Kwaik. 2003. Cmparative assessment f virulence traits in Leginella spp. Micrbilgy 149, 631-641. 18. Vgel, J.P., H.L. Andrews, S.K. Wng, and R.R. sberg. 1998. Cnjugative transfer by the virulence system f Leginella pneumphila. Science 279, 873-876. 19. Vgel, J.P. and R.R. sberg. 1999. Cell bilgy f Leginella pneumphila. Curr. Opin. Micrbil. 2, 30-34. 20. Zink, S.D., L. Pedersen, N.P. Ciancitt, and Y. Abu-Kwaik. 2002. The Dt/cm type V secretin system f Leginella pneumphila is essential fr the inductin f apptsis in human macrphages. nfect. mmun. 70, 1657-1663. (Received March 27, 2009/Accepted April 28, 2009) ABSTRACT : Mlecular Epidemilgical Relatinship f the Pathgenicity f Leginella spp. slated frm Water Systems in Seul Jin-Ah Kim*, Ji-Hun Jung, S-Jin Kim, Yung-Hee Jin, Yung-Hee Oh, and Gi-Yung Han (Seul Metrplitan Gvernment Research nstitute f Public Health and Envirnment, Gwachen 427-070, Republic f Krea) Leginella spp. is the causative agent f Leginellsis, which induces a ptentially fatal frm f pneumnia. With a cncentrated perfrmance during the summer f 2008, we secured 73 islates frm the water systems f 25 wards in Seul. We analysed sertypes, pathgenic genes (Dt/cm), and patterns f pulsed-field gel electrphresis (PFGE) in an attempt t cnfirm relatinships amng them. Different frm the previus year's pattern (2007), amng the islates, 69 were Leginella pneumphila and 4 were Leginella sppug The sertype distributin f Leginella pneumphila was sg1 43, sg6 9, sg5 8, sg3 8, and sg2 1. The sertype fr the 4 Leginella spp. was Leginella nautarum. Mst f the Leginella pneumphila had several pathgenic genes. On the ther hand, the 4 Leginella spp. were defective in pathgenicity in genmic terms. The PFGE patterns f the sertypes shwed a tendency fr diversity f Leginella pneumphila and a clse crrelatin with genetic pathgenicity.