207.fm
|
|
- 유비 육
- 6 years ago
- Views:
Transcription
1 Lab. Anim. Res. 2010: 26(2), Aspectual Comparison of the Skin Changes in Hairless Mice According to the Aging Type Kyoung-Hwa Choi, Young-Chul Kim* and Bae-Hwan Kim* Department of Public Health, Keimyung University, Daegu, Korea The purpose of this study was to compare the skin changes in female SKH-1 hairless mice between UVB irradiated photo-aged group and endogenous aged group. The UVB irradiation and endogenous aged groups showed poor skin conditions when compared with normal (N) group in terms of the skin erythema, water content and TEWL (transepidermal water loss). For the changes in gross observation and replica image analysis on wrinkle of the skin tissue, UVB irradiation group showed thicker, wider and deeper wrinkles than the changes seen in N group, whereas endogenous aged group showed thinner, narrower and shallower wrinkles than that of UVB irradiation group. In histopathological findings, UVB irradiation group and endogenous aged group showed thickened epidermis, increased dermal inflammatory cells, decreased collagen and elastic fiber content, increased number of degranulated dermal/subcutaneous mast cells, and lower expression quantity of TGF-β in dermal layer when compared with N group, but to a lesser extent in aged group than the changes in UVB irradiation group. UVB irradiation group and endogenous aged group showed significantly higher xanthine oxidase activity, lower superoxide dismutase and catalase activities, and higher expression of MMP-3 mrna in skin than N group. Therefore, aspectual comparison of the skin change in hairless mice between photo-aged and endogenous aged groups showed different each other, and these results will be useful for skin aging research. Key words: Hairless mice, skin aging, photo-aging, endogenous aging Received 25 March 2010; Revised version received 10 May 2010; Accepted 10 June 2010 ¼ ùš š, y w w ƒwš. y w x ƒ w y v ü, w y x w»». ù w v w, v ww» ú y Ÿ y w y hairless Ÿ y š (Kligman, 1996). *Corresponding authors: Young-Chul Kim, Department of Public Health, Keimyung University, 1000 shindang-dong, Dalseogu, Daegu , Korea Tel: Fax: yckim@kmu.ac.kr Bae-Hwan Kim, Department of Public Health, Keimyung University, 1000 shindang-dong, Dalseogu, Daegu , Korea Tel: Fax: kim9399@kmu.ac.kr v yƒ w» p yw ü y y. ü y ù ƒ ù y» y w v w, y UVB y w y w (El- Domyati et al., 2002). ü y w, v, k w (Seo et al., 2001), w tv v ƒ r sw ƒ ùš(waller and Maibach, 2006), s w s w v» w w (Sunderkötter et al., 1997). w Ÿ y ü y w š ¾ w, v ³ew e y ƒ k. v eš, w, k w w v w (Seo et al., 2001). w v w ƒw, k 173
2 174 Kyung-Hwa Choi et al.» v ü w š k ƒ š (Rittie and Fisher, 2002). v ƒ, y (reactive oxygen species, ROS) s (apoptosis) mw jš s DNA,, w (Matsumura and Ananthaswamy, 2004). y ww» wš, matrix metalloproteinase (MMP) y y j ù MMP w w w w. w j w MMP in vivo in vitro x UVA UVB w y, MMP-3 4x g, v l e, q p, w w (Inomata et al., 2003). Transforming growth factor-beta(tgf-β) s s,» w, x w w y me x q w s, s, sy s, s w ƒ j (Peltonen et al., 1990). s w w insulin-like growth factor (IGF), epidermal growth factor (EGF), interleukin-1 tumor necrotic factor (TNF)-α sww w w in vivo TGF-βƒ ƒ w w (Fitzpatrick and Rostan, 2003). TGF-β e v me (Martin et al., 1992), yv v w x (Schmid et al., 1993). Ÿ y ü y y w y, y(premature aging) y (accelerated aging) š» w (Yaar and Gilchrist, 1999).» v Ÿ y v ü y w ƒ š w ƒ ú Ÿ y ü y wš. l ü y Ÿ y v w y w ƒ š ù ü ƒ. hairless 6 UV w Ÿ y y w v y y v y sƒ x w š w d t wš w. lò x 9 (12 ) 41 (6 ) SKH-1 hairless mouse (Charles-River, Japan) 1 k z, 9 e (Normal, N) e Ÿ y (Experiment 1, E1) 6 w wš, y (Experimental 2, E2) 6 sww 3, 18 x w. x» œ w, 22±3 o C, 50±10%,» 12 w. x x z e wš y 3R d š w ww. j m e Ÿ 302 nm UVB w sunlamp (UVM-225D, Mineralight Lamp UVP, USA) w. UV-radiometer (HD 9021, Delta OHM, Italy) d w, cage ƒ z 1 3z, 6 [1 : 60 mj/cm 2 (1 MED), 2 : 2 MED, 3 : 3 MED, 4-6 : 4 MED] w. j m Ð j 5&8- y, w, v (transepidermal water loss, TEWL) CK electronic (Germany) Mexameter (MX18), Corneometer (CM825) Tewameter (TM300) w ƒƒ e x 6 1z d w. j l j 6 ú fk (100 mg/kg BW) ƒ wš l e w z replica Visioline (VL650, CK electronic GmbH, Germany) w (total winkle area), (no. of wrinkles), ¼ (total length), s³¼ (mean length), s³¾ (mean depth) t 5 w w. j j w v 10% s š w z m, k, n, en e paraffin s wš 4µm Ì r
3 . r hematoxylin and eosin (H&E) z v y w, Masson s trichrome z vd ü (collagen fiber) xk w. Verhoeff mw v vd ü k (elastic fiber) y, nw y wš, Toluidine blue z vd vwd ü mast cell s k w. w ü TGF-β x w» w yw w.»(ventana Medical Systems Inc., USA, NEXES IHC) w, 1 w TGF-β (Dako, Japan, dilution 1:100), 2 w iview DAB Detection kit (Ventana Medical Systems Inc., USA, ) w š, Hematoxylin II (Ventana Medical Systems Inc., USA, ) Bluing Reagent (Ventana Medical Systems Inc., USA, ) w x w. j k m³ v e w z M sucrose š glass teflon homogenizer w 20%(w/v) ³. ³ 600 g 10 w w w d 10,000 g 20 w z d z y d w. v w Lowry (1951) d w. v Xanthine oxidase (XO) y xanthine» w 30 C 20 g o 292 nm Ÿ d w Stripe Della (1969) w d w. y z w 1mg 1 w» xanthine l uric acid nmole t w. v Superoxide dismutase (SOD) y hematoxylin y w Martin (1987) 0.1 mm EDTAƒ w 50 mm (ph 7.5) 10 µm hematoxylin z ƒw 25 C g hematein o 560 nm Skin changes of hairless mice by the aging type 175 d w z y w. y z hematoxylin y 50% w 1unit 1mg 1 w unit t w. v Catalase (CAT) y hydrogen peroxide» w y q 240 nm Ÿ š Ÿ (E=0.04 mm 1 cm ) 1 w y w Aebi (1974) w. y v w 1mg 1 w hydrogen peroxide nmole t w j..1 l Deep freezer þ w v trizol (Invitrogen, USA) ƒw w z RNA w. BioNEER cyclescript RT PreMix kit w cdna w w z PCR (Accupower PCR PreMix kit, BioNEER)» ww. Template 2 µl, forward primer reverse primer (10 pmole/l, BioNEER, Korea) ƒƒ 1.4 µl, ³ 15.2 µl š PCR (Bio-RAD, Mycycler TM thermal cycler, USA) w. Primer GAPDH (57 o C, 35 cycle), x MMP-3 (60 o C, 35 cycle) w primer» Table 1. Tris-acetate ethylenediaminetetra acetic acid (TAE) buffer w 1.5% agarose gel» g ethidium bromide w z wš UV w DNA band y w š Gel Logic 100 Imaging System (Kodak, USA) w x eyw m w m SPSS 17.0 for windows (SPSS Inc., USA) w one-way ANOVA w š,, x (E1, E2) w» w Duncan s multiple range test w z w. m w α=0.05 w w. Table 1. Nucleotide sequence of the primers and expected size of PCR products Items Primers Expected size (bp) 3) Forward (5' 3') CCCACTAACATCAAATGGGG GAPDH 1) Reverse (5' 3') ACACATTGGGGGTAGGAACA Forward (5' 3') TAGCAGGTTATCCTAAAAGCA MMP-3 2) Reverse (5' 3') CCAGCTATTGCTCTTCAAT ) GAPDH: Glyceraldehyde-3-phosphate dehydrogenase 2) MMP-3: Matrix metalloproteinase-3 3) bp: basepair
4 176 Kyung-Hwa Choi et al. Table 2. Comparison of erythema index, water capacity, TEWL in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment Items Normal Experimental N E1 E2 Erythema index 1) 98.07± ±68.85*** ±31.01** Water capacity 1) 61.83± ±10.87* 49.42±6.19 TEWL 2) 6.67± ±20.95 *** 6.43±1.73 ### Values are mean±sd of 6 mice. 1) Unit: AU (Arbitrary Unit) 2) Unit: g//h TEWL: Transepidermal water loss, N: non-treatment group, E1: UVB irradiation group, E2: aged group *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ###P<0.001 compared to the E1 group by ANOVA and Duncan's multiple range test. j m Ð j 5&8- y w Ÿ y y w ƒ y Ÿ y w. w w Ÿ y w y e ƒ û ù w. y Ÿ y w. tv w Ÿ y w ƒ y w e. y w Ÿ y w ƒ (Table 2). j l j w Ÿ y ̃ š ¾ x, y Ÿ y w ̃ š x (Figure 1A). v Visioline w d w, (total winkle area), (No. of wrinkles), ¼ (total length), s³¼ (mean length), s³¾ (mean depth) 5 t w Ÿ y y w ƒw y w Ÿ y w ƒw (Table 3). j j H&E mw v xk s w, tv vd ³e s, Ÿ y tv vƒ É š vd ü v, y ƒ, tvd z v Table 3. Comparison of wrinkle parameters in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment Items Total wrinkle area (mm 2 ) No. of wrinkles Total length (mm) Mean length (mm) Mean depth (m) Normal Experimental N E1 E2 0.36± ±0.21*** 0.67±0.15** ### 18.80± ±4.42*** 30.80±7.43** ### 5.04± ±2.06*** 9.10±2.15** ### 0.27± ±0.03*** 0.30±0.02* ### 47.59± ±2.21*** 48.23±0.21* ## Values are mean±sd of 6 mice. N: non-treatment group, E1: UVB irradiation group, E2: aged group, *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ## P<0.01, ### P<0.001 compared to the E1 group by ANOVA and Duncan's multiple range test.. y tvd š tv (Figure 1B). Masson s trichrome mw vd ü xk w, ƒ wš ³e Ÿ y ƒ q ƒ wš ³e š. y Ÿ y w yƒ ùkû (Figure 1C). Verhoeff s mw v vd ü k y, xk w, k ƒ ³e, Ÿ y k ƒ. y Ÿ y w k k wš ñ ¼ ƒ (Figure 1D). Toluidine blue mw vd vwd ü sƒ s k w, sƒ š k, Ÿ y sƒ x š k ƒ w ùkû. y Ÿ y w s ƒ (Figure 1E). yw vd ü TGF-β x w, w Ÿ y y x y w Ÿ y (Figure 1F). k m³ w v w w z XO y d w, w Ÿ y y w, y w Ÿ y w. w w z SOD
5 Skin changes of hairless mice by the aging type 177 Figure 1. Comparison of replica images in SKH-1 hairless mice at 6 weeks after the beginning of experiment a: normal group, b: UVB irradiation group, c: aged group (A). Histological observation on SKH-1 hairless mouse skin at 6 weeks after the beginning of experiment. H&E stain, 100 & 400 (enlarged box) (B). Masson s trichrome stain, 200 (C). Verhoeff s stain, 200 & 400(enlarged box) (D). Toluidine blue stain, 200 (E). Immunohistochemical staining for TGF-β in SKH-1 hairless mouse skin at 6 weeks after the beginning of experiment, 200 (F). y w Ÿ y y w û y Ÿ y w. CAT y w Ÿ y y w û y Ÿ y w (Table 4). j..1 l v MMP-3 mrna x d w, w Ÿ y y w y w Ÿ y w (Figure 2). v y yx š w j, v ü, w y x w»»» (Seo et al., 2001). Hairless v UVB w tvƒ É š ƒ q w k (fibroelstosis) wš glycosaminoglycan (GAG)ƒ ƒw v w v y (Fisher et al., 2002).
6 178 Kyung-Hwa Choi et al. Table 4. Comparison of xanthine oxidase (XO), superoxide dismutase (SOD) and catalase activities (CAT) in SKH-1 hairless mice skin at 6 weeks after the beginning of experiment ltems Normal Experimental N E1 E2 XO 1) 3.69± ±01.55*** 5.77±1.23* ## SOD 2) 20.49± ±0.98* 12.89±1.01** CAT 3) 8.10± ±1.47** 4.54±1.06** Values are mean±sd of 6 mice. 1) Unit: nmole uric acid formed/mg protein/min 2) Unit: U (50% inhibition of autoxidation of hematoxylin)/mg protein/min 3) Unit: nmole H 2 O 2 reduced/mg protein/min N: non-treatment group, E1: UVB irradiation group, E2: aged group *P<0.05, **P<0.01, ***P<0.001 compared to the N group, and ## P<0.01 compared to the E1 group by ANOVA and Duncan's multiple range test. hairless Ÿ y y w v y, w, w y v y sƒ x w d t wš w. y ƒ s v s w v x y j UV q, Ÿ, v, y, UVB v d¾ w w y ù y k (Trevithick et al., 1992). y d w w Ÿ y y w ƒ. ƒ d ƒ dü» n w w w w (Blanken et al., 1989), w v v t w ƒ d w v ù e v w w (Haratake et al., 1997; Jiang et al., 2007). v hyaluronic acid (HA) s», s, s y w (Kim et al., 2005), v y wì v k w w š (Ghersetich et al., 1994). w, tv d w mw v y w. w w Ÿ y w y eƒ û ù w. v w Ÿ y w ƒ y w e ùkü v ƒ w. v y ƒ ù Figure 2. Comparison of MMP-3 expression in hairless mice skin at 6 weeks after the beginning of experiment. Values are mean±sd of 6 mice. **P<0.01, ***P<0.001 compared to the N group by ANOVA and Duncan's multiple range test. ù ƒ y p y w w. w v MMP ƒ w w vü» j vd w v x ƒ y k (Wlaschek et al., 1995). Oba Edwards (2006) UVB w hairless» v ü w vü w 3 y x»w š šw. Ÿ y w ¾ ƒ ¾š x y Ÿ y w ¾ ƒ š x. w» w Visioline w 5 t(,, ¼, s³¼, s³¾ ) d w Ÿ y y w ùk ù v yƒ w y w. w y w Ÿ y 5 t w, Ÿ y y v y t z x w y w. v y, s (apoptosis) mw(matsumura and Ananthaswamy, 2004) v s e k (Cole et al., 2010). v w w Ÿ y y sƒ x ƒwš k w, s e w ùkû. y w Ÿ y ƒ w.
7 v v v k k ƒ wš (Lee et al., 1999), yƒ w tvƒ š» sd w v-tv ƒ rsw š s w s ƒ w. w v s, s» k (Makrantonaki and Zouboulis, 2007). Ÿ v tvd É v d s sƒ ƒwš w k w É (Seite et al., 2006). Ÿ y tv vƒ z š vü ƒ q, y tv v ̃ š ù Ÿ y w ƒ w. Chung (2001) Ÿ y v y v w w ƒw» w z MMP y ƒ wƒ ƒw» j w š w. x, v MMP-3 mrna x w Ÿ y y w, y w Ÿ y w e w š š q. v 90% w TGF-β w, activator-1 (AP-1) y y k MMP w wƒ (Massague, 1998). TGF-β ù AP-1 w MMP» w w (Fisher et al., 1996; Quan et al., 2002). vd ü TGF-β x w Ÿ y y x Ÿ y ƒ. s w y p ƒ ROS free radical w (Sander et el., 2002), w y z w (Rittie and Fisher, 2002). v y x z w y. XO y Ÿ y y w, Ÿ y ƒ w. SOD y w Ÿ y y w û y Ÿ y w ƒ. CAT y w Ÿ y y w û y Ÿ y w. Ÿ y y w v w y w q. x ww hairless Skin changes of hairless mice by the aging type 179 y x v y w, Ÿ y y w v y z w sƒw» w». q 2008 w ( )» w w. k Aebi, H. (1974) Catalase. In Methods of Enzymatic Analysis. pp , Academic Press, New York. Blanken, R., Vilsteren, M.J.T., Tupker, R.A. and Coenraads, P.J. (1989) Effect of mineral oil and linoleic-acid-containing emulsions on the skin vapour loss of sodium-lauryl-sulphateinduced irritant skin reactions. Contact Dermatitis 20(2), Chung, J.H., Seo, J.Y., Choi, H.R., Lee, M.K., Youn, C.S., Rhie, G., Cho, K.H., Kim, K.H., Park, K.C. and Eun, H.C. (2001) Modulation of skin collagen metabolism in aged and photoaged human skin in vivo. J. Invest. Dermatol. 117(5), Cole, N., Sou, P.W., Ngo, A., Tsang, K.H., Severino, J.A., Arun, S.J., Duke, C.C. and Reeve, V.E. (2010) Topical 'Sydney' Propolis Protects against UV-Radiation-Induced Inflammation, Lipid Peroxidation and Immune Suppression in Mouse Skin. Int. Arch. Allergy Immunol. 152(2), El-Domyati, M., Attia, S., Saleh, F., Brown, D., Birk, D.E., Gasparro, F., Ahmad, H. and Uitto. J. (2002) Intrinsic aging vs. photoaging: a comparative histopathological, immunohistochemical, and ultrastructural study of skin. Exp. Dermatol. 11(5), Fisher, G.J., Datta, S.C., Talwar, H.S., Wang, Z.Q., Varani, J., Kang, S. and Voorhees, J.J. (1996) Molecular basis of suninduced premature skin ageing and retinoid. Nature 379, Fisher, G.J., Kang, S., Varani, J., Bata-Csorgo, Z., Wan, Y., Datta, S. and Voorhees, J.J. (2002) Mechanisms of photoaging and chronological skin aging. Arch. Dermatol. 138, Fitzpatrick, R.E., and Rostan, E.F. (2003) Reversal of photodamage with topical growth factors: a pilot study. J. Cosmet. Laser Ther. 5, Ghersetich, I., Lotti, T., Campanile, G., Grappone, C. and Dini, G. (1994) Hyaluronic acid in cutaneous intrinsic aging. Int. J. Dermatol. 33(2), Haratake, A., Uchida, Y., Schmuth, M., Tanno, O., Yasuda, R., Epstein, J.H., Elias, P.M. and Holleran, W. M. (1997) UVBinduced alterations in permeability barrier function: roles for epidermal hyperproliferation and thymocyte-mediated response. J. Invest. Dermatol. 108(5), Inomata. S., Matsunaga, Y., Amano, S., Takada, K., Kobayashi, K., Tsunenaga, M., Nishiyama, T., Kohno, Y. and Fukuda, M. (2003) Possible involvement of gelatinase in basement membrane damage and wrinkle formation in chronically. J. Invest. Dermatol. 120(1), Jiang, S.J., Chu, A.W., Lu, Z.F., Pan, M.H., Che, D.F. and Zhou, X.J. (2007) Ultraviolet B-induced alterations of the skinbarrier and epidermal calcium gradient. Exp. Dermatol. 16(12), Kim, S.H., Nam, G.W., Kang, B.Y., Lee, H.K., Moon, S.J. and Chang, I.S. (2005) The effect of kaempferol quercetin on
8 180 Kyung-Hwa Choi et al. hyaluronan-synthesis stimulation in human keratinocytes (HaCaT). Korean J. Food Sci. Nutr. 31, Kligman, L.H. (1996) The hairless mouse model for photoaging. Clin. Dermatol. 14, Lee, K.K., Kim, J.H., Cho, J.J. and Choi, J.D. (1999) Inhibitory effects of 150 plant extracts on elastase activity, and their anti-inflammatory effects. Int. J. Cosmet. Sci. 21(2), Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall. R.J. (1951) Protein measurement with the folin phenol reagent. J. Biol. Chem. 193(1), Makrantonaki, E. and Zouboulis, C. C. (2007) Characteristics and pathomechanisms of endogeniously aged skin. Dermatol. 214(4), Martin, J.P., Dailey, M. and Sugarman, E. (1987) Negative and positive assays of superoxide dismutase based on hematoxylin autooxidation. Arch. Biochem. Biophys. 225(2), Martin, P., Hopkinson-Woolley, J. and McCluskey, J. (1992) Growth factors and cutaneous wound repair. Prog. Growth Factor Res. 4(1), Massague, J. (1998) TGF-β signal transduction. Ann. Rev. Biochem. 67, Matsumura, Y. and Ananthaswamy, H.N. (2004) Toxic effects of ultraviolet radiation on the skin. Toxicol. Appl. Pharmacol. 195(3), Oba A. and Edwards, C. (2006) Relationships between changes in mechanical properties of the skin, wrinkling, and destruction of dermal collagen fiber bundles caused by photoaging. Skin Res. Technol. 12(4), Peltonen, J., Kahari, L., Jaakkola, S., Kahari, V.M., Varga, J., Uitto, J. and Jimenez, S. A. (1990) Evaluation of transforming growth factorβ and type procollagen gene expression in fibrotic skin diseases by in situ hybridization. J. Invest. Dermatol. 94(3), Quan, T., He, T., Kang, S., Voorhees, J.J. and Fisher, G.J. (2002) Ultraviolet irradiation alters transforming growth factor beta/ smad pathway in human skin in vivo. J. Invest. Dermatol. 119(2), Rittie, L., and Fisher, G.J. (2002) UV-light-induced signal cascades and skin aging. Ageing Res. Rev. 1(4), Sander, C.S., Chang, H., Salzmann, S., Muller, C.S. Ekanayake- Mudiyanselage, S., Elsner, P. and Thiele, J.J. (2002) Photoaging is associated with protein oxidation in human skin in vivo. J. Invest. Dermatol. 118, Schmid, P., Kunz, S., Cerletti, N., Mcmaster, G. and Cox, D. (1993) Injury induced expression of TGF-β1 mrna is enhanced by exogenously applied TGF-βs. Biochem. Biophys. Res. Comm. 194(1), Seite, S., Zucchi, H., Septier, D., Igondjo-Tchen, S., Senni, K. and Godeau, G. (2006) Elastin changes during chronological and photo-ageing: the important role of lysozyme. J. Eur. Acad. Dermatol. Venereol. 20(8), Seo, J.Y., Cho, K.H., Eun, H.C. and Chung J. H. (2001) Skin aging from phenotype to mechanism. Korean J. Invest. Dermatol. 8(4), Stripe, F. and Della, C.E. (1969) The regulation of rat liver xanthine oxidase. Conversion in vitro of the enzyme activity from dehydrogenase(type D) oxidase (type O). J. Biol. Chem. 244(14), Sunderkötter, C., Kalden, H. and Luger, T.A. (1997) Aging and the skin immune system. Arch. Dermatol. 133(10), Trevithick, J.R., Xiong, H., Lee, S., Shum, D.T., Sanford, S.E., Karlik, S.J., Norley, C. and Dilworth GR. (1992) Topical tocopherol acetate reduces post-uvb, sunburn-associated erythema, edema, and skin sensitivity in hairless mice. Arch. Biochem. Biophys. 296(2), Waller, J.M. and Maibach. H.I. (2006) Age and skin structure and function, a quantitativeapproach (II): protein, glycosaminoglycan, water, and lipidcontent and structure. Skin Res. Technol. 12(3), Wlaschek, M., Briviba, K., Stricklin, G.P., Sies, H. and Scharffetter-Kochanek, K. (1995) Singlet oxygen may mediate the ultraviolet A-induced synthesis of interstitial collagenase. J. Invest. Dermatol. 104(2), Yaar, M. and Gilchrist, B.A. (1999) Aging of skin. Dermatology in general medicine. pp , Mcgraw-Hill, New York.
DBPIA-NURIMEDIA
백작약 열수추출물의 피부노화 억제 효과 (II) -주름형성 억제 효과를 중심으로- 권미화, 최소영 1, 김영철 1, J. ENVIRON. TOXICOL. Vol. 24, No. 2, 169~178 (2009) 국립독성과학원 독성병리과, 1 계명대학교 대학원 공중보건학과 Inhibitory Effects of Peonia japonica Water Extract
14.531~539(08-037).fm
G Journal of the Korea Concrete Institute Vol. 20, No. 4, pp. 531~539, August, 2008 š x y w m š gj p { sƒ z 1) * 1) w w Evaluation of Flexural Strength for Normal and High Strength Concrete with Hooked
605.fm
Journal of the Korean Housing Association Vol. 19, No. 6, 2008 y k y p w sƒ Care-giver s Needs and Evaluation on the Actual Condition of the Playgrounds in Child Care Facilities y* Choi, Mock-Wha x **
16(1)-3(국문)(p.40-45).fm
w wz 16«1y Kor. J. Clin. Pharm., Vol. 16, No. 1. 2006 x w$btf3fqpsu'psn û w m w Department of Statistics, Chonnam National University Eunsik Park College of Natural Sciences, Chonnam National University
11(5)-12(09-10)p fm
w wz J. Kor. Soc. Cloth. Ind. 11«5y, 2009 Vol. 11, No. 5, pp.799-807(2009) w w * k ƒm w pg p w, ƒm w q w A Qualitative Research on Pursuing Image and Appearance Management Behavior of Brides Eun-Joo Bae
< DC1A4C3A5B5BFC7E22E666D>
¼ (Jeong, Jung Chae)*, ý (Kim, Yoon Soo), (Shin, Woo Young), Þ Ñ (Park, Jong Man) ò ý ƒ Ð (Korea Evaluation Institute of Industrial Technology) (Shin, Jae-Heyg) Š æ (Ministry of Knowledge Economy) 1. :
82-01.fm
w y wz 8«( 2y) 57~61, 2005 J. of the Korean Society for Environmental Analysis p w w Á Á w w» y l Analysis of Influence Factors and Corrosion Characteristics of Water-pipe in Potable Water System Jae Seong
304.fm
Journal of the Korean Housing Association Vol. 20, No. 3, 2009 yw s w - û - A Study on the Planning of Improved-Hanok - Focused on Jeon-Nam Province - y* ** z*** **** Kang, Man-Ho Lee, Woo-Won Jeong, Hun
10(3)-12.fm
w y wz 10«3y 273~280 (2010.12.) Journal of Korean Society of Urban Environment p yá xá½k w y œw (2010 9 15, 2010 12 2 k) Analysis of Characteristics of Delivered Nonpoint Source Pollution at Forested Watershed
10(3)-10.fm
w y wz 10«3y 259~264 (2010.12.) Journal of Korean Society of Urban Environment w gj p p y Á Á½k * w m œw Á* w y œw (2010 9 28, 2010 10 12 k) Characteristics of Antiwashout Underwater Concrete for Reduction
49(6)-06.fm
Journal of the Korean Chemical Society 2005, Vol. 49, No. 6 Printed in the Republic of Korea 중학교과학교과서불꽃반응실험에서선스펙트럼관찰의문제점분석및개선연구 ½ Á Á * w w yw (2005. 10. 4 ) An Analysis and Improvement of the Line Spectrum
10(3)-09.fm
w y wz 10«3y 253~258 (2010.12.) Journal of Korean Society of Urban Environment ³ w Á» Á Á y w y œw (2010 11 22, 2010 12 9 k) Study on Determine of Detention Pond in Small Developed Area In-Soo Chang ½
12.077~081(A12_이종국).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 77-81 y w» e wx Á w œw Fabrication of Ceramic Batch Composition for Porcelain by Using Recycled Waste Ceramic Powder Hyun Guen Han, and
16(2)-7(p ).fm
w wz 16«2y Kor. J. Clin. Pharm., Vol. 16, No. 2. 2006 ü t xy y w tœ ½ BÁ x BC B y w w w C y w w w Current Status and Expectations of Orphan Drugs in Korea -In point of supplying medicines for the rare
416.fm
Journal of the Korean Housing Association Vol. 20, No. 4, 2009 œ qp œ y An Analysis of Change on the Apartment Unit Plans and the Interior Spaces Related to Women * Choi, ByungSook ** Park, JungA "CTUSBDU
γ
경락경혈학회지 Vol.27, No.1, pp.87 106, 2010 Journal of Meridian & Acupoint Dept. of 1 Meridian & Acupoint, 3 Acupuncture & Moxibustion, College of Oriental Medicine, Daejeon University 2 Division of Clinical
9(3)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 9«3y, 2007 Vol. 9, No. 3, pp.319-326(2007) w xk x p w q w Analysis of Foot Characteristics According to the Classification of Foot Types of Junior High School Girls Ji-Young
10(3)-02.fm
w y wz 10«3y 203~211 (2010.12.) Journal of Korean Society of Urban Environment w ù p yá k«áyw *Á xá½k w y œw Á* y w (2010 9 15, 2010 12 2 k) Characterization of Nonpoint Source Pollutant Loads from the
50(5)-07.fm
Printed in the Republic of Korea w 3w yû x w w w Á x* w w w yw (2006. 3. 14 ) A research of the Difference in Teaching Styles and Understanding of 9 th Grade Students About Lead-iodide Precipitation Reaction
82.fm
Journal of the Korean Ceramic Society Vol. 44, No. 9, pp. 524~528, 2007. Determination of Critical Chloride Content of Ordinary Portland Cement Concrete by Linear Polarization Technique Hong-Sam Kim, Hai-Moon
69-1(p.1-27).fm
99 A 380 B 787 : wœ z w * w w wœ» A380 B787 wœ» w. wœ» ww r. w wœ» p j y w r» w. I. II. z III. A380 B787 IV. A380 V. wœ» : x VI. z VII. I. A380 B787»ƒ z wœ w, w w p j w w ƒ r. t wœ w ƒ w w wœ» š œm wš,
19(1) 02.fm
Korean J. Crystallography Vol. 19, No. 1, pp.7~13, 2008 Ÿ (ICISS) w š t w (2): t w y w œw Surface Structure Analysis of Solids by Impact Collision Ion Scattering Spectroscopy (2): Atomic Structure of Semiconductor
93.fm
Journal of the Korean Ceramic Society Vol. 45, No. 10, pp. 625~630, 2008. Effect of Storage Conditions on the Setting Properties of Brushite Bone Cement Containing Granular β-tricalcium Phosphate Sun-Ae
50(1)-09.fm
2006, Vol. 50, No. 1 Printed in the Republic of Korea 언빨래가마르는현상에대한중등학교화학전공교사들의인식조사 ½x Á» Á½ # Á x* w w yw y š w w # w w (2005. 5. 11 ) A Research of Secondary School Chemistry Major Teachers Perceptions
8(2)-4(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 8«2y, 2006 Vol. 8, No. 2, pp.177-182(2006) x w e w 1) Á Ÿ 1) Á»û 2) 1) ƒm w q w 2) w w w The Effect of Media on Taking Plastic Surgery Chong-Hee Yun 1), Su-Kwang Sung 1) and
17.393~400(11-033).fm
Journal of the Korea Concrete Institute Vol. 23, No. 3, pp. 393~400, June, 2011 GGGGG DOI 10.4334/JKCI.2011.23.3.393 x RC { sƒ y y 1) *Á½ 1) Á 2) 1) y w œw 2) w œw Bond Strength Evaluation of RC Beams
01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6
Buffers & Gel Stain Chemicals Buffers & Chemicals Phone: 1588-9788 (ext.4->2) Email: reagents-support@bioneer.co.kr 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview
386-390.hwp
386 HANYANG MEDICAL REVIEWS Vol. 29 No. 4, 2009 우리나라 미숙아의 통계와 의료비용 Statistics and Medical Cost of Preterm in Korea 윤혜선 을지대학교 노원을지병원 소아청소년과학교실 Hye Sun Yoon, M.D., Ph.D., Department of Pediatrics, Nowon
untitled
[ ] œwz, 21«6y(2008) J. of the Korean Society for Heat Treatment, Vol. 21, No. 6, (2008) pp. 300~306 š y w p x*, **Á **Áy y* * ** w œ w œw, w» gœ Solid State Diffusion Brazing of the Aluminum Alloy Castings
012임수진
Received : 2012. 11. 27 Reviewed : 2012. 12. 10 Accepted : 2012. 12. 12 A Clinical Study on Effect of Electro-acupuncture Treatment for Low Back Pain and Radicular Pain in Patients Diagnosed with Lumbar
untitled
ª Œª Œ 27ƒ 2B Á 2007 3œ pp. 193 ~ 199 ª ƒ w d w ƒ sƒ Methodology of Drought Assessment Using National Groundwater Monitoring Network Data «x Á½ Kwon, Hyung JoongÁKim, Seong Joon Abstract The objective
w w l v e p ƒ ü x mw sƒw. ü w v e p p ƒ w ƒ w š (½kz, 2005; ½xy, 2007). ù w l w gv ¾ y w ww.» w v e p p ƒ(½kz, 2008a; ½kz, 2008b) gv w x w x, w mw gv
ª Œª Œ 30ƒ 5A Á 2010 9œ pp. 475 ~ 484 gj p ª v e p p PSC ƒ gv : II. x w Precast Concrete Copings for Precast Segmental PSC Bridge Columns : II. Experiments and Analyses ½kzÁ½ Á zá x Kim, Tae-HoonÁKim,
untitled
3. 농업환경연구과 과제구분 기본연구 수행시기 전반기 연구과제 및 세부과제 수행 기간 소 속 책임자 농가에 적합한 부식성곤충 대량 사육기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 1) 부식성 곤충 먹이 제조 기술 개발 12~ 13 농업환경연구과 곤충팀 이영혜 색인용어 부식성곤충, 장수풍뎅이, 계통, 먹이제조 ABSTRACT In first check,
DBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 425-430, 2005» 677*4 Ÿ w sƒ ½»x Á Á½ k w y w, w y œw Some considerations for the analytical approaches to measure atmospheric
14.fm
Journal of the Korean Ceramic Society Vol. 44, No. 2, pp. 93~97, 2007. Preparation of High Purity Si Powder by SHS Chang Yun Shin, Hyun Hong Min, Ki Seok Yun, and Chang Whan Won Engineering Research Center
10.063~070(B04_윤성식).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 63-70 Mg-3%Al-1%Zn w ƒœ» y Á x*á **Á Á w œw *w s l I ûer ** t Effect of Thermomechanical Treatment on Microstructure and Mechanical Properties
12(2)-04.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 12, No. 2, pp 106~111(2005) w y y w z œ k üœ» p ½ Á Á Á ³ Á Á½Ÿ w w w, *g», ** w w Effects of Strategies to Improve Indoor Air Quality at Pre-occupancy Stage
07.051~058(345).fm
w wz 8«3y 2008 6 pp. 51 ~ 58 m qp yp š w k sƒ Evaluation of Dynamic Modulus based on Aged Asphalt Binder y*á **Á***Á**** Lee, Kwan-HoÁCho, Kyung-RaeÁLee, Byung-SikÁSong, Yong-Seon Abstract Development
( )Kju269.hwp
만성세균성전립선염모델흰쥐에서 의항염효과 Anti-inflammatory Effect of Lycopene on Chronic Bacterial Prostatitis Rat Model Cho Hwan Yang, Dong Wan Sohn, Yong-Hyun Cho From the Department of Urology, The Catholic University
10(1)-08.fm
w y wz 10«( 1y) 47~52, 2007 J. of the Korean Society for Environmental Analysis œ w t y ½ xá Á x Á½ Á x* Ÿ œ, * w œw Optimization of Coagulation In The Conventional Water Treatment Plant Jun-Hyun Kim,
fm
J. Fd Hyg. Safety 20(4), 253 257 (2005) ü w w w Áy»xÁ Á Á Á«Á Áw Á x Á yx Á½ Á½ Á½ t t» t t ƒ q Study on Management of Artificial Flavors in Korea Tal-Soo Lee, Young-Mi Jang, Ki-Hyoung Hong, Sung-Kwan
16(5)-06(58).fm
Journal of Korean Powder Metallurgy Institute DOI: 10.4150/KPMI.2009.16.5.336 y-y w Sm-Fe w ƒ w zá *Á w»» The Effect of Excess Samarium Oxide on the PreparationG of Sm-Fe Alloy Powder by Reduction-diffusion
DBPIA-NURIMEDIA
한국소음진동공학회 2015추계학술대회논문집년 Study of Noise Pattern and Psycho-acoustics Characteristic of Household Refrigerator * * ** ** Kyung-Soo Kong, Dae-Sik Shin, Weui-Bong Jeong, Tae-Hoon Kim and Se-Jin Ahn Key Words
12(3) 10.fm
KIGAS Vol. 12, No. 3, September, 2008 (Journal of the Korean Institute of Gas) ü LP ƒ š Database w š Á Á½z w ywœw (2008 6 10, 2008 8 12 (1 ), 2008 9 5 (2 ), 2008 9 5 k) Constructing a Database Structure
27(5A)-07(5806).fm
ª Œª Œ 27ƒ 5A Á 2007 9œ pp. 753 ~ 758 gj pœw gj p { x A New Test Method for Pure Isotropic Flexural Tensile Strength of Concretes Ÿ Á y Á x Zi, GoangseupÁOh, HongseobÁChoi, Jinhyek Abstract Proposed is
Journal of Biomedical Research 13(1) : (2012) Morphological and Histological Changes in Photoaged Hairless Mice Induced by Phellodendrin cortex
Journal of Biomedical Research 13(1) : 35-46 (2012) Morphological and Histological Changes in Photoaged Hairless Mice Induced by Phellodendrin cortex Water Extract Application In-Soon Bae 1, Mi-Ja Shim
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α= ,.,,..,,,.,. :,, ( )
:,,.,. 456, 253 ( 89, 164 ), 203 ( 44, 159 ). Cronbach α=.83.91.,.,,..,,,.,. :,, (402-751) 253 E-mail : yspark@inha.ac.kr ..,.,.,. Bandura(1997),.,,,,., (,,, 2009), (,,,, 2014).?.,,,.. Bandura (1995) (Resiliency
12(4) 10.fm
KIGAS Vol. 12, No. 4, December, 2008 (Journal of the Korean Institute of Gas) l x CNG» v m s w ½ Á y w» œw (2008 9 30, 2008 12 10, 2008 12 10 k) Numerical Analysis for Temperature Distribution and Thermal
51(4)-13.fm
Journal of the Korean Chemical Society 2007, Vol. 51, No. 4 Printed in the Republic of Korea w x - w y *Á š w w w yw (2007. 3. 28 ) Case Study on Verbal Interactions of Teacher-Small Group StudentsG in
(JBE Vol. 21, No. 1, January 2016) (Regular Paper) 21 1, (JBE Vol. 21, No. 1, January 2016) ISSN 228
(JBE Vol. 1, No. 1, January 016) (Regular Paper) 1 1, 016 1 (JBE Vol. 1, No. 1, January 016) http://dx.doi.org/10.5909/jbe.016.1.1.60 ISSN 87-9137 (Online) ISSN 16-7953 (Print) a), a) An Efficient Method
DBPIA-NURIMEDIA
J. ENVIRON. TOXICOL. Vol. 21, No. 2, 165~172 (2006) UVB 조사로인한마우스피부조직의산화적손상 이승자, 김영철 1, 건동대학교사회복지학과, 1 계명대학교공중보건학과 A Study on the Oxidative Damage Induced by UVB Irradiation to Mouse Skin Sungja Rhie and
김범수
Analysis of Outcomes after Resection of Sarcomatous Hepatocellular Carcinoma Purpose: Sarcomatous hepatocellular carcinoma (HCC) is rare. Therefore, the clinicopathologic characteristics and prognosis
15.101~109(174-하천방재).fm
w wz 8«4y 2008 8 pp. 101 ~ 109 w» m -,, - A Study on Warnning Criteria Investigation of Automated Rainfall Warning System -Focused on Realationship of Water Level, Discharge and Precipitation - Á Á Á Ahn,
fm
[ ] w wz DOI: 10.3740/MRSK.2009.19.12.692 Kor. J. Mater. Res. Vol. 19, No. 12 (2009) y INCONEL 718w Gas Tungsten Arc Welding» p sƒ ½»y Á *Á *Á y** ( ) d lj p wœq, *w wœ» q **( ) d lj p t Mechanical Properties
Can032.hwp
Chromosomal Alterations in Hepatocellular Carcinoma Cell Lines Detected by Comparative Genomic Hybridization Sang Jin Park 1, Mahn Joon Ha, Ph.D. 1, Hugh Chul Kim, M.D. 2 and Hyon Ju Kim, M.D. 1 1 Laboratory
(2)-02(최경자).fm
Res. Plant Dis. 16(2) : 148-152 (2010) Research in Plant Disease The Korean Society of Plant Pathology z w t w sƒ Á½ Á Á yá * w yw yw l Development of Effective Screening Method and Evaluation of Radish
4.fm
Journal of the Korean Ceramic Society Vol. 46, No. 1, pp. 30~34, 2009. Optimization of Glass Wafer Dicing Process using Sand Blast Won Seo, Young-mo Koo*, Jae-Woong Ko**, and Gusung Kim Department of Electronic
23(2) 71.fm
J. of Korean Institute of Fire Sci. & Eng. [ ] Vol. 23, No. 2, 2009 w w w w w w Stud on the Fire Behaviour of Composite Beam with Loading and Unloading ½ *Á û**á½ ***Á½ Sung-Bae Kim* Chang-Nam Lee** Woo-Chul
Lumbar spine
Lumbar spine CT 32 111 DOI : 10.3831/KPI.2010.13.2.111 Lumbar Spine CT 32 Received : 10. 05. 23 Revised : 10. 06. 04 Accepted : 10. 06. 11 Key Words: Disc herniation, CT scan, Clinical analysis The Clinical
27(5A)-13(5735).fm
27ƒ 5A Á 2007 9œ pp. 735 ~ 743 gj p ª w š p w { ³ p Flexural Behavior and Cracking Characteristics of High Performance Fiber Reinforced Cementitious Composites according to Fine Aggregate Contents *Á ³x**
(Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern (Micro- Environment) Re
EMF Health Effect 2003 10 20 21-29 2-10 - - ( ) area spot measurement - - 1 (Exposure) Exposure (Exposure Assesment) EMF Unknown to mechanism Health Effect (Effect) Unknown to mechanism Behavior pattern
09-감마선(dh)
Journal of Radiation Industry 4 (3) : 253~257 (2010) Review Paper 감마선 조사가 포인세티아의 발근, 생육 및 색상변이에 미치는 영향 이은경* 김원희 김성태 강시용 1 국립원예특작과학원, 1 한국원자력연구원 Rooting, Growth, and Color Mutation of Poinsettias Affected
Sheu HM, et al., British J Dermatol 1997; 136: Kao JS, et al., J Invest Dermatol 2003; 120:
Sheu HM, et al., British J Dermatol 1997; 136:884-890 Kao JS, et al., J Invest Dermatol 03; 1:446-464 1 10 0 3 Day Normal MLE Lotion Lotion MLE Cream Cream 80 7 70 6 3 Day Normal MLE Lotion Lotion MLE
<30332DB9E8B0E6BCAE2E666D>
kœw» y w k p y w k» z wš ye z w mdkqvqrg üœ» y» Ÿ w kœwgeqgpikpggtkpiy glj GEQVGEJPQNQI[ œw w k w yz š y j œ w m w y ˆ mw y» kœ w k û ³ y ƒ ƒ» ƒ w œw w w y ƒƒ» k z w» %NGCP 9CVGT #EV wšw y ù» œ w w w t
14(4) 09.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 4, pp 343~350(2007) w y y w z 14 «4 y 2007 yw» l s p»xá ³ *w w w œw, **w w w The Property of Pressure Distribution of Hybrid Underfloor Air Distribution
Microsoft Word - KSR2012A038.doc
YWXY º º t rzyywxyhwz_ º zƒ A Study on the Relation of Railroad System and Energy Saving ö ä ø ã ä ãã In Moon, Han-Min Lee *, Jong-Eun Ha * * Abstract Now the world, such as the impact of fossil energy
14(2) 02.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 14, No. 2, pp 117~125(2007) w y y w z sm Ÿ š w œ l ³Á½ * w, **w w w Impact of Photosensor Sensitivity on the Control Performance of a Daylight Dimming System
1..
Volume 12, Number 1, 6~16, Factors influencing consultation time and waiting time of ambulatory patients in a tertiary teaching hospital Jee-In Hwang College of Nursing Science, Kyung Hee University :
32(4B)-04(7455).fm
32«4ByÁ 2012 7 pp. 233 ~ 242 œ w w w y œ r Estimation of Domestic Water Supply Benefit Using Demand Function Approach ³ Á Á½¼yÁ Yeo, Kyu DongÁYi, Choong SungÁKim, Gil HoÁLee, Sang Won Abstract In the past,
27 2, 1-16, * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** ( :
27 2, 1-16, 2009. * **,,,,. KS,,,., PC,.,,.,,. :,,, : 2009/08/12 : 2009/09/03 : 2009/09/30 * ** (: jjhkim@cau.ac.kr) 2 한국교육문제연구제 27 권 2 호, 2009 Ⅰ.,. 2008 3,536, 10 99.9% (, 2008). PC,, (, 2007). (, 2008),.,
Kor. J. Aesthet. Cosmetol., 및 자아존중감과 스트레스와도 밀접한 관계가 있고, 만족 정도 에 따라 전반적인 생활에도 영향을 미치므로 신체는 갈수록 개 인적, 사회적 차원에서 중요해지고 있다(안희진, 2010). 따라서 외모만족도는 개인의 신체는 타
RESEARCH ARTICLE Kor. J. Aesthet. Cosmetol., 20-40대 여성의 외모만족도가 미용관리태도에 미치는 영향 홍수남 1, 김효숙 2 * 1 건국대학교 뷰티사이언스디자인학과, 2 건국대학교 의상디자인과 Effects of Extrinsic Body Satisfaction on Beauty Management Behavior of
..................
ptical & Mechanical Characteristics of Lining Papers Oby the Artificial Heat Ageing Treatment 1 1 This study was carried out to investigate the effect of artificial accelerated ageing treatment on the
<30312DC0CCC7E2B9FC2E666D>
균류의다양성과역할 이향범 û w œw 머리말 k w š ³ q š yw < Ð >» w ww k w w v š q w Á Á w tyw š 2QKPVKPI CPF *[FG ú ƒ x %QPXGPVKQP QP $KQNQIKECN &KXGTUKV[ %$&» w w ««wš y w» š x ƒ w œ ƒ» ƒ œsw w ³ wš ù š y š ƒ t š ƒ wš»ƒ
15(2)-07.fm
J. Korean. Soc. Living. Environ. Sys. Vol. 15, No. 2, pp 145~154(2008) w y y w z 15 «2 y 2008 ³ l w sm ½ Á yáy * w y w, ** w w Recommended Sensitivity of a Fully-shielded Photosensor for a Daylight Dimming
03-서연옥.hwp
농업생명과학연구 49(4) pp.31-37 Journal of Agriculture & Life Science 49(4) pp.31-37 Print ISSN 1598-5504 Online ISSN 2383-8272 http://dx.doi.org/10.14397/jals.2015.49.4.31 국가산림자원조사 자료를 적용한 충남지역 사유림경영율 추정 서연옥
DBPIA-NURIMEDIA
J. ENVIRON. TOXICOL. Vol. 24, No. 4, 351~357 (2009) Hairless 마우스에서대추열수추출물의피부내염증및장벽손상완화효과 최소영, 김영철 계명대학교대학원공중보건학과 Alleviative Effects of Jujube Water Extract on the Inflammation and Barrier Damage in Hairless
main.hwp
열화상 측정기를 이용한 안마의자의 인체 영향 평가 박세진, 구준모, 이현자 한국표준과학연구원 생활계측그룹 Evaluation of Massage Chair Effect on Human Body using Infrared Imaging/Radiometric Camera Se Jin Park, Jun Mo Koo, Hyun Ja Lee Human L ife Measurement
84-01.fm
w y wz 8«( 4y) 00~00, 2005 J. of the Korean Society for Environmental Analysis HPLC f y e t p»wá½»x w y w»y Detection Characteristics of a HPLC Method on Carbonyl-DNPH Derivatives in Relation with Column
07.045~051(D04_신상욱).fm
J. of Advanced Engineering and Technology Vol. 1, No. 1 (2008) pp. 45-51 f m s p» w Á xá zá Ÿ Á w m œw Image Retrieval Based on Gray Scale Histogram Refinement and Horizontal Edge Features Sang-Uk Shin,
Statistical Data of Dementia.
Screening of Prolyl Endopeptidase Inhibitors from Medicinal Plants. Lee Si-young, Lee Jung-han, Paik Young-Sook College of Environment and Applied Chemistry, Kyung Hee University. Statistical Data of Dementia.
(163번 이희수).fm
Journal of the Korean Ceramic Society Vol. 48, No. 4, pp. 323~327, 2011. DOI:10.4191/KCERS.2011.48.4.323 Electrical Properties and Temperature Stability of Dysprosium and Erbium Co-doped Barium Titanate
01.01~08(유왕진).fm
JOURNAL OF KOREA SOCIETY OF PACKAGING SCIENCE & TECHNOLOGY. Vol. 14, No. 1 1~8 (2008) s w Á w» w Comparative Study on the Changes and Prospects of Flexible Food Packaging Design Kyung Soo Noh and Wang
<283732372D3733312920B4D9C3CAC1A120BCD2C7C1C6AEC4DCC5C3C6AEB7BBC1EEC0C720B3EBBEC8C0C720BDC3B7C2BAB8C1A4BFA120B4EBC7D120C0AFBFEBBCBA20C6F2B0A1283035292E687770>
대한안과학회지 제 49 권 제 5 호 2008 J Korean Ophthalmol Soc 49(5):727-731, 2008 DOI : 10.3341/jkos.2008.49.5.727 다초점 소프트콘택트렌즈의 노안의 시력보정에 대한 유용성 평가 김현경 1 김효명 2 정성근 1 가톨릭대학교 의과대학 성모병원 안과학교실 1, 고려대학교 의과대학 안암병원 안과학교실
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in Univ
Analysis of objective and error source of ski technical championship Jin Su Seok 1, Seoung ki Kang 1 *, Jae Hyung Lee 1, & Won Il Son 2 1 yong in University & 2 Kang Won University [Purpose] [Methods]
8(3)-15(p ).fm
w wz J. Kor. Soc. Cloth. Ind. 8«3y, 2006 Vol. 8, No. 3, pp.357-362(2006) w p k sƒ ½ Á Á w w w A Study on the Mechanical and Hand Properties of the Lining Fabrics Myung-Ok Kim, Mi-Kyung Uh and Myung-Ja
26(2)-04(손정국).fm
Ñ s k w 1Á y 2 Á û 1 Á½ z 1 Á½ 1* 1 ³ w yw, 2 w» (*E-mail: jimankim@skku.edu) 1. m ƒ w»» w 4»» y š. w 4»» l, l, l w» w» k. w»» { ƒ j. x š x w ƒwš k (Direct Methanol Fuel Cell: DMFC)[1]ƒ wù ƒ w š. DMFC
18211.fm
J. of the Korean Sensors Society Vol. 18, No. 2 (2009) pp. 168 172 p k ù p p l xá xá ³ Á *Á w * Fabrication of the CNT-FET biosensors with a double-gate structure Byunghyun Cho, Byounghyun Lim, Jang-Kyoo
노인정신의학회보14-1호
제14권 1호 통권 제23호 www.kagp.or.kr 발행인 : 정인과 / 편집인 : 이동우 / 발행처 : 정인과 (152-703) 서울특별시 구로구 구로동 80번지 고려대학교 구로병원 정신과 / TEL : 02-818-6608 / FAX : 02-852-1937 발행일 : 2008년 4월 30일 / 제 작 : (주)엠엘커뮤니케이션 140-846 서울특별시
03이경미(237~248)ok
The recent (2001-2010) changes on temperature and precipitation related to normals (1971-2000) in Korea* Kyoungmi Lee** Hee-Jeong Baek*** ChunHo Cho**** Won-Tae Kwon*****. 61 (1971~2000) 10 (2001~2010).
54 한국교육문제연구제 27 권 2 호, I. 1.,,,,,,, (, 1998). 14.2% 16.2% (, ), OECD (, ) % (, )., 2, 3. 3
27 2, 53-70, 2009. (Nursing Home) * ** (Nursing Home). 5 50 5 2 1,,,,, SPSS t.,,,,,,,. :,, : 2009/08/27 : 2009/09/24 : 2009/09/30 * ** (: hjkim@daelim.ac.kr) 54 한국교육문제연구제 27 권 2 호, 2009. I. 1.,,,,,,, (,
DBPIA-NURIMEDIA
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 18, No. 5, 436-443, 2005,1"$ w Q) t p z Á 1w w œw 2 w œ yw Effects of surface properties and solution ph on the pollutants removal of
25(6)-21(김유곤).fm
Printed in the Republic of Korea "/"-:5*$"- 4$*&/$& 5&$)/0-0(: Vol. 25, No. 6, 483-491, 2012 http://dx.doi.org/10.5806/ast.2012.25.6.483 Study on stability test of in process sample of recombinant Protein
<33372DC7D7B3EBC8ADC8ADC0E5C7B02E687770>
논문접수일 : 2013.09.24 심사일 : 2013.10.06 게재확정일 : 2013.10.25 항노화화장품의 국내현황과 항노화관심도에 따른 자외선차단제소비성향조사 Status and anti-aging cosmetics Interest in accordance with anti-aging sunscreen Consumption Survey 주저자 : 김미영
82-02.fm
w y wz 8«( 2y) 00~00, 2005 J. of the Korean Society for Environmental Analysis Calix[6]arene w k š w *Á x Á Á«ƒm w yw, *w w yw Cesium Ion Selective Solid Contact Electrodes Based on Calix[6]arene Won-sik
Pharmacotherapeutics Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee Univ
Application of New Pathogenesis on the Drug Treatment of Diabetes Young Seol Kim, M.D. Department of Endocrinology Kyung Hee University College of Medicine & Hospital E mail : ycell2@yahoo.co.kr Abstract
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong
Analyses the Contents of Points per a Game and the Difference among Weight Categories after the Revision of Greco-Roman Style Wrestling Rules Han-bong An 1 & Kyoo-jeong Choi 2 * 1 Korea National Wrestling
101.fm
Lab. Anim. Res. 2010: 26(1), 1-6 Anti-hepatofibrogenic Effect of Turnip Water Extract on Thioacetamide-induced Liver Fibrosis Lan Li 1#, Dae-Hun Park 2#, Yong-Chun Li 1, Seung-Kee Park 3, Yun-Lyul Lee
歯1.PDF
200176 .,.,.,. 5... 1/2. /. / 2. . 293.33 (54.32%), 65.54(12.13%), / 53.80(9.96%), 25.60(4.74%), 5.22(0.97%). / 3 S (1997)14.59% (1971) 10%, (1977).5%~11.5%, (1986)
untitled
G Journal of the Korea Concrete Institute Vol. 20, No. 3, pp. 345~356, June, 2008 p -k w gj p k k 1) Á y 2) * 1) ƒm w w 2) w w Direct Inelastic Design of Reinforced Concrete Members Using Strut-and-Tie
11(1)-15.fm
w y wz 11«1y 73~80 (2011.8.) Journal of Korean Society of Urban Environment SWMM 을이용한도시지역비점오염부하저류시설용량산정 Áw«Á *Áy **Á½ yá½ Á x w w Á* û w y œw Á** w y lœw (2011 6 13, 2011 6 27 k) Determine Capacity of